FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2045554095> ?p ?o ?g. }

• W2045554095 endingPage "29873" @default.
• W2045554095 startingPage "29864" @default.
• W2045554095 abstract "Vascular smooth muscle cell (VSMC) proliferation and migration contribute significantly to atherosclerosis, postangioplasty restenosis, and transplant vasculopathy. Forkhead transcription factors belonging to the FoxO subfamily have been shown to inhibit growth and cell cycle progression in a variety of cell types. We hypothesized that forkhead proteins may play a role in VSMC biology. Under in vitro conditions, platelet-derived growth factor (PDGF)-BB, tumor necrosis factor-α, and insulin-like growth factor 1 stimulated phosphorylation of FoxO in human coronary artery smooth muscle cells via MEK1/2 and/or phosphatidylinositol 3-kinase-dependent signaling pathways. PDGF-BB, tumor necrosis factor-α, and insulin-like growth factor 1 treatment resulted in the nuclear exclusion of FoxO, whereas PDGF-BB alone down-regulated the FoxO target gene, p27kip1, and enhanced cell survival and progression through the cell cycle. These effects were abrogated by overexpression of a constitutively active, phosphorylation-resistant mutant of the FoxO family member, TM-FKHRL1. The anti-proliferative effect of TM-FKHRL1 was partially reversed by small interfering RNA against p27kip1. In a rat balloon carotid arterial injury model, adenovirus-mediated gene transfer of FKHRL1 caused an increase in the expression of p27kip1 in the VSMC and inhibition of neointimal hyperplasia. These data suggest that FoxO activity inhibits VSMC proliferation and activation and that this signaling axis may represent a therapeutic target in vasculopathic disease states. Vascular smooth muscle cell (VSMC) proliferation and migration contribute significantly to atherosclerosis, postangioplasty restenosis, and transplant vasculopathy. Forkhead transcription factors belonging to the FoxO subfamily have been shown to inhibit growth and cell cycle progression in a variety of cell types. We hypothesized that forkhead proteins may play a role in VSMC biology. Under in vitro conditions, platelet-derived growth factor (PDGF)-BB, tumor necrosis factor-α, and insulin-like growth factor 1 stimulated phosphorylation of FoxO in human coronary artery smooth muscle cells via MEK1/2 and/or phosphatidylinositol 3-kinase-dependent signaling pathways. PDGF-BB, tumor necrosis factor-α, and insulin-like growth factor 1 treatment resulted in the nuclear exclusion of FoxO, whereas PDGF-BB alone down-regulated the FoxO target gene, p27kip1, and enhanced cell survival and progression through the cell cycle. These effects were abrogated by overexpression of a constitutively active, phosphorylation-resistant mutant of the FoxO family member, TM-FKHRL1. The anti-proliferative effect of TM-FKHRL1 was partially reversed by small interfering RNA against p27kip1. In a rat balloon carotid arterial injury model, adenovirus-mediated gene transfer of FKHRL1 caused an increase in the expression of p27kip1 in the VSMC and inhibition of neointimal hyperplasia. These data suggest that FoxO activity inhibits VSMC proliferation and activation and that this signaling axis may represent a therapeutic target in vasculopathic disease states. Atherosclerosis, a leading cause of mortality and morbidity in the Western world, involves a multitude of pathophysiological processes including endothelial dysfunction, inflammation, vascular smooth muscle cell (VSMC) 1The abbreviations used are: VSMC, vascular smooth muscle cell(s); PDGF, platelet-derived growth factor; TNF, tumor necrosis factor; IGF, insulin-like growth factor; HA, hemagglutinin; siRNA, small interfering RNA; CASMC, coronary artery smooth muscle cell(s); SmBM, smooth muscle basal medium; FBS, fetal bovine serum; Adv, adenovirus encoding the cDNA for β-galactosidase; WT-FKHRL1, wild type FKHRL1; TM-FKHRL1, triple mutant FKHRL1; DAPI, 4′,6-diamidino-2-phenylindole; FACS, fluorescence-activated cell sorting; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; PI3K, phosphatidylinositol 3-kinase.1The abbreviations used are: VSMC, vascular smooth muscle cell(s); PDGF, platelet-derived growth factor; TNF, tumor necrosis factor; IGF, insulin-like growth factor; HA, hemagglutinin; siRNA, small interfering RNA; CASMC, coronary artery smooth muscle cell(s); SmBM, smooth muscle basal medium; FBS, fetal bovine serum; Adv, adenovirus encoding the cDNA for β-galactosidase; WT-FKHRL1, wild type FKHRL1; TM-FKHRL1, triple mutant FKHRL1; DAPI, 4′,6-diamidino-2-phenylindole; FACS, fluorescence-activated cell sorting; MEK, mitogen-activated protein kinase/extracellular signal-regulated kinase kinase; PI3K, phosphatidylinositol 3-kinase. proliferation, and alteration in the extracellular matrix (1Lusis A.J. Nature. 2000; 407: 233-241Crossref PubMed Scopus (4612) Google Scholar, 2Ross R. Am. Heart J. 1999; 138: S419-S420Crossref PubMed Google Scholar). Percutaneous transluminal coronary angioplasty is a well established procedure for revascularization of patients with arterial occlusive disease. The occurrence of restenosis at the site of angioplasty remains a major limitation of this procedure. An important goal is to elucidate the molecular basis of restenosis and to use this information to identify novel therapeutic targets.Neointimal hyperplasia, a hallmark of VSMC proliferation, contributes significantly to the restenotic process after percutaneous transluminal coronary angioplasty. The complex response involves initial accumulation of inflammatory cells and the release of growth factors and chemotactic cytokines (3Dzau V.J. Braun-Dullaeus R.C. Sedding D.G. Nat. Med. 2002; 8: 1249-1256Crossref PubMed Scopus (714) Google Scholar). Various studies have implicated a role for platelet-derived growth factor (PDGF), tumor necrosis factor (TNF)-α, and insulin-like growth factor (IGF)-1 in this process (4Law R.E. Meehan W.P. Xi X.P. Graf K. Wuthrich D.A. Coats W. Faxon D. Hsueh W.A. J. Clin. Invest. 1996; 98: 1897-1905Crossref PubMed Scopus (461) Google Scholar, 5Miao R.Q. Murakami H. Song Q. Chao L. Chao J. Circ. Res. 2000; 86: 418-424Crossref PubMed Scopus (32) Google Scholar, 6Hall J.L. Gibbons G.H. Chatham J.C. Am. J. Physiol. 2002; 283: E465-E471Google Scholar, 7Khorsandi M.J. Fagin J.A. Giannella-Neto D. Forrester J.S. Cercek B. J. Clin. Invest. 1992; 90: 1926-1931Crossref PubMed Scopus (95) Google Scholar, 8Myllarniemi M. Frosen J. Calderon Ramirez L.G. Buchdunger E. Lemstrom K. Hayry P. Cardiovasc. Drugs Ther. 1999; 13: 159-168Crossref PubMed Scopus (68) Google Scholar, 9Bayes-Genis A. Conover C.A. Schwartz R.S. Circ. Res. 2000; 86: 125-130Crossref PubMed Scopus (380) Google Scholar, 10Zhu B. Zhao G. Witte D.P. Hui D.Y. Fagin J.A. Endocrinology. 2001; 142: 3598-3606Crossref PubMed Scopus (64) Google Scholar, 11Mattana J. Effiong C. Kapasi A. Singhal P.C. Kidney Int. 1997; 52: 1478-1485Abstract Full Text PDF PubMed Scopus (35) Google Scholar, 12Selzman C.H. McIntyre Jr., R.C. Shames B.D. Whitehill T.A. Banerjee A. Harken A.H. J. Mol. Cell Cardiol. 1998; 30: 889-896Abstract Full Text PDF PubMed Scopus (56) Google Scholar, 13Selzman C.H. Meldrum D.R. Cain B.S. Meng X. Shames B.D. Ao L. Harken A.H. J. Surg. Res. 1998; 80: 352-356Abstract Full Text PDF PubMed Scopus (33) Google Scholar, 14Selzman C.H. Shames B.D. Reznikov L.L. Miller S.A. Meng X. Barton H.A. Werman A. Harken A.H. Dinarello C.A. Banerjee A. Circ. Res. 1999; 84: 867-875Crossref PubMed Scopus (81) Google Scholar, 15Young W. Mahboubi K. Haider A. Li I. Ferreri N.R. Circ. Res. 2000; 86: 906-914Crossref PubMed Scopus (84) Google Scholar).PDGF-BB, which is expressed in multiple cell types, including VSMC, is a potent mitogen for VSMC in vitro and in vivo (16Kariya K.I. Kawahara Y. Tsuda T. Fukuzaki H. Takai Y. Atherosclerosis. 1987; 63: 251-255Abstract Full Text PDF PubMed Scopus (81) Google Scholar, 17Ikeda U. Ikeda M. Oohara T. Kano S. Yaginuma T. Atherosclerosis. 1990; 84: 183-188Abstract Full Text PDF PubMed Scopus (63) Google Scholar, 18Zhan Y. Kim S. Izumi Y. Izumiya Y. Nakao T. Miyazaki H. Iwao H. Arterioscler. Thromb. Vasc. Biol. 2003; 23: 795-801Crossref PubMed Scopus (279) Google Scholar, 19Ferns G.A. Reidy M.A. Ross R. Am. J. Pathol. 1991; 138: 1045-1057PubMed Google Scholar, 20Sawada M. Yanamoto H. Nagata I. Hashimoto N. Nakahara I. Akiyama Y. Kikuchi H. Macdonald R.L. Stroke. 1999; 30: 644-650Crossref PubMed Scopus (16) Google Scholar, 21Desfaits A.C. Raymond J. Muizelaar J.P. Stroke. 2000; 31: 498-507Crossref PubMed Scopus (32) Google Scholar). PDGF has been shown to be secreted from platelets at sites of intimal injury and/or thrombus (22Liu M.W. Roubin G.S. King III, S.B. Circulation. 1989; 79: 1374-1387Crossref PubMed Google Scholar, 23Marmur J.D. Poon M. Rossikhina M. Taubman M.B. Circulation. 1992; 86: III53-III60PubMed Google Scholar). Several recent studies have reported that inhibition of PDGF or PDGF receptor attenuates neointimal hyperplasia (24Nili N. Cheema A.N. Giordano F.J. Barolet A.W. Babaei S. Hickey R. Eskandarian M.R. Smeets M. Butany J. Pasterkamp G. Strauss B.H. Am. J. Pathol. 2003; 163: 869-878Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar, 25Haery C. Sachar R. Ellis S.G. Clev. Clin. J. Med. 2004; 71: 815-824Crossref PubMed Scopus (13) Google Scholar, 26Oliva G. Espallargues M. Pons J.M. Rev. Esp. Cardiol. 2004; 57: 617-628Crossref PubMed Google Scholar). Others demonstrated a direct association between PDGF expression and neointimal thickening (27Mehta D. George S.J. Jeremy J.Y. Izzat M.B. Southgate K.M. Bryan A.J. Newby A.C. Angelini G.D. Nat. Med. 1998; 4: 235-239Crossref PubMed Scopus (130) Google Scholar, 28Brasen J.H. Kivela A. Roser K. Rissanen T.T. Niemi M. Luft F.C. Donath K. Yla-Herttuala S. Arterioscler. Thromb. Vasc. Biol. 2001; 21: 1720-1726Crossref PubMed Scopus (64) Google Scholar, 29Vazquez-Padron R.I. Lasko D. Li S. Louis L. Pestana I.A. Pang M. Liotta C. Fornoni A. Aitouche A. Pham S.M. J. Vasc. Surg. 2004; 40: 1199-1207Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar).TNF-α is a pluripotent mediator of inflammation (30Warner S.J. Libby P. J. Immunol. 1989; 142: 100-109PubMed Google Scholar) and is believed to play a pathophysiological role in vascular remodeling. TNF-α promotes migration of cultured VSMC (31Sawada H. Kan M. McKeehan W.L. In Vitro Cell Dev. Biol. 1990; 26: 213-216Crossref PubMed Scopus (31) Google Scholar, 32Jovinge S. Hultgardh-Nilsson A. Regnstrom J. Nilsson J. Arterioscler. Thromb. Vasc. Biol. 1997; 17: 490-497Crossref PubMed Scopus (147) Google Scholar) and induces the expression of growth factors and cytokines (33Yoshida S. Ono M. Shono T. Izumi H. Ishibashi T. Suzuki H. Kuwano M. Mol. Cell Biol. 1997; 17: 4015-4023Crossref PubMed Scopus (582) Google Scholar), adhesion molecules (34Couffinhal T. Duplaa C. Labat L. Lamaziere J.M. Moreau C. Printseva O. Bonnet J. Arterioscler. Thromb. 1993; 13: 407-414Crossref PubMed Google Scholar), and extracellular matrix-degrading metalloproteinase (35Galis Z.S. Muszynski M. Sukhova G.K. Simon-Morrissey E. Libby P. Ann. N. Y. Acad. Sci. 1995; 748: 501-507Crossref PubMed Scopus (247) Google Scholar). Under in vivo conditions, TNF-α is expressed by macrophages and VSMC in atherosclerotic plaques but not in normal vessels (36Tipping P.G. Hancock W.W. Am. J. Pathol. 1993; 142: 1721-1728PubMed Google Scholar, 37Barath P. Fishbein M.C. Cao J. Berenson J. Helfant R.H. Forrester J.S. Am. J. Pathol. 1990; 137: 503-509PubMed Google Scholar, 38Rayment N.B. Moss E. Faulkner L. Brickell P.M. Davies M.J. Woolf N. Katz D.R. Cardiovasc. Res. 1996; 32: 1123-1130Crossref PubMed Scopus (37) Google Scholar). In various animal models, TNF-α levels are increased following balloon injury, following wire carotid injury, following common carotid artery ligation, and during acute rejection of cardiac allografts (32Jovinge S. Hultgardh-Nilsson A. Regnstrom J. Nilsson J. Arterioscler. Thromb. Vasc. Biol. 1997; 17: 490-497Crossref PubMed Scopus (147) Google Scholar, 39Tanaka H. Swanson S.J. Sukhova G. Schoen F.J. Libby P. Am. J. Pathol. 1995; 147: 617-626PubMed Google Scholar, 40Zimmerman M.A. Selzman C.H. Reznikov L.L. Miller S.A. Raeburn C.D. Emmick J. Meng X. Harken A.H. Am. J. Physiol. 2002; 283: R505-R512Crossref PubMed Scopus (36) Google Scholar, 41Tanaka H. Sukhova G. Schwartz D. Libby P. Arterioscler. Thromb. Vasc. Biol. 1996; 16: 12-18Crossref PubMed Scopus (119) Google Scholar, 42Rectenwald J.E. Moldawer L.L. Huber T.S. Seeger J.M. Ozaki C.K. Circulation. 2000; 102: 1697-1702Crossref PubMed Scopus (159) Google Scholar). Blockade of TNF-α with a soluble TNF-α receptor inhibited acute coronary neointimal formation in an animal model of coronary graft atherosclerosis (43Clausell N. Molossi S. Sett S. Rabinovitch M. Circulation. 1994; 89: 2768-2779Crossref PubMed Scopus (115) Google Scholar). Finally, injury- or ligation-induced intimal hyperplasia of the carotid artery is markedly attenuated in mice that are null for TNF-α (40Zimmerman M.A. Selzman C.H. Reznikov L.L. Miller S.A. Raeburn C.D. Emmick J. Meng X. Harken A.H. Am. J. Physiol. 2002; 283: R505-R512Crossref PubMed Scopus (36) Google Scholar, 42Rectenwald J.E. Moldawer L.L. Huber T.S. Seeger J.M. Ozaki C.K. Circulation. 2000; 102: 1697-1702Crossref PubMed Scopus (159) Google Scholar, 44Zimmerman M.A. Reznikov L.L. Sorensen A.C. Selzman C.H. Am. J. Physiol. 2003; 284: R1213-R1218PubMed Google Scholar).IGF-1 is a weak mitogen for VSMC in vitro. Previous studies have demonstrated increased levels of IGF-1 in the region of intimal hyperplasia in rabbit aorta (45Sidway A.N. Hakim F.S. Jones B.A. Norberto J.M. Neville R.F. Korman L.Y. J. Vasc. Surg. 1996; 23: 308-313Abstract Full Text Full Text PDF PubMed Scopus (11) Google Scholar) and in the neointima of arteriovenous fistulas (46Stracke S. Konner K. Kostlin I. Friedl R. Jehle P.M. Hombach V. Keller F. Waltenberger J. Kidney Int. 2002; 61: 1011-1019Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). In addition, IGF-1 receptor is highly expressed in the VSMC of intact arteries and in cultured VSMC (7Khorsandi M.J. Fagin J.A. Giannella-Neto D. Forrester J.S. Cercek B. J. Clin. Invest. 1992; 90: 1926-1931Crossref PubMed Scopus (95) Google Scholar, 47Myit S. Delafontaine P. Bochaton-Piallat M.L. Giraud S. Gabbiani G. Brink M. J. Vasc. Res. 2003; 40: 97-104Crossref PubMed Scopus (23) Google Scholar).The forkhead winged helix transcription factor, DAF-16, was shown to regulate longevity and lipid metabolism in Caenorhabditis elegans (48Ogg S. Paradis S. Gottlieb S. Patterson G.I. Lee L. Tissenbaum H.A. Ruvkun G. Nature. 1997; 389: 994-999Crossref PubMed Scopus (1525) Google Scholar). Mammalian homologues of DAF-16 (namely members of the FoxO family (FKHR, FKHRL1, and AFX)) have been implicated in cell growth, cell cycle, and differentiation (49Tran H. Brunet A. Griffith E.C. Greenberg M.E. Sci. STKE 2003. 2003; : RE5Google Scholar, 50Birkenkamp K.U. Coffer P.J. Biochem. Soc. Trans. 2003; 31: 292-297Crossref PubMed Google Scholar). In various cell types, insulin and IGF-1 induce phosphorylation of FoxO proteins, which results in their exclusion from the nucleus and decreased expression of downstream target genes involved in programmed cell death and cell cycle arrest (51Brunet A. Bonni A. Zigmond M.J. Lin M.Z. Juo P. Hu L.S. Anderson M.J. Arden K.C. Blenis J. Greenberg M.E. Cell. 1999; 96: 857-868Abstract Full Text Full Text PDF PubMed Scopus (5367) Google Scholar, 52Guo S. Rena G. Cichy S. He X. Cohen P. Unterman T. J. Biol. Chem. 1999; 274: 17184-17192Abstract Full Text Full Text PDF PubMed Scopus (468) Google Scholar). Recently, we demonstrated a role for forkhead proteins in mediating endothelial cell cycle arrest and apoptosis (53Abid M.R. Guo S. Minami T. Spokes K.C. Ueki K. Skurk C. Walsh K. Aird W.C. Arterioscler. Thromb. Vasc. Biol. 2004; 24: 294-300Crossref PubMed Scopus (191) Google Scholar, 54Skurk C. Maatz H. Kim H.S. Yang J. Abid M.R. Aird W.C. Walsh K. J. Biol. Chem. 2004; 279: 1513-1525Abstract Full Text Full Text PDF PubMed Scopus (218) Google Scholar). In the current study, we show that FoxO proteins lie downstream of PDGF-BB, TNF-α, and IGF-1 signaling pathways in VSMC in vitro, and we provide evidence for an inhibitory role of forkhead proteins in injury-induced neointimal hyperplasia in vivo.EXPERIMENTAL PROCEDURESMaterials—PD98059, LY294002, and wortmannin were purchased from Calbiochem. Recombinant human PDGF-BB, TNF-α, and IGF-1 were purchased from R&D Systems (Minneapolis, MN). Antibodies to AKT, phospho-AKT-Ser-473, FKHR, FKHRL1, phospho-FKHR-Ser-256 (which also recognizes phospho-AFX-Ser-193), β-actin, and hemagglutinin (HA) were from Cell Signaling (Beverly, MA). Cy3-conjugated anti-smooth muscle actin antibody was purchased from Sigma. Anti-PDGF-B antibody was from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Anti-p27kip1 antibody, annexin V staining kit, and propidium iodide were from BD Biosciences. Anti-HA-fluorescein antibody was purchased from Roche Applied Science. Biotinylated anti-mouse and anti-rabbit IgGs, streptavidin Texas Red and fluorescein isothiocyanate, and Vectastain Elite ABC kit were from Vector Laboratories (Burlingame, CA). siRNAs were purchased from Qiagen Inc. (Valencia, CA). The XTT assay kit was from Roche Applied Science.Cell Culture—Human coronary artery smooth muscle cells (CASMC) (Cambrex Bio Science, Baltimore, MD) were cultured in smooth muscle basal medium (SmBM) supplemented with SingleQuots and 10% FBS (Cambrex Bio Science). All studies were carried out with CASMC at passages 5-8. CASMC were grown for 16-72 h (as indicated) in SmBM in the absence of serum before treating with PDGF-BB, TNF-α, or IGF-1. CASMC from two independent donors were tested for the in vitro experiments.Western and Northern Blot Analyses—Immunoblot assays were performed by modification of the procedure previously described (55Abid M.R. Tsai J.C. Spokes K.C. Deshpande S.S. Irani K. Aird W.C. FASEB J. 2001; 15: 2548-2550Crossref PubMed Scopus (149) Google Scholar). Briefly, CASMC were washed in phosphate-buffered saline twice and harvested by scraping in 20 mm Tris-HCl (pH 7.5), 150 mm NaCl, 1 mm EDTA, 1 mm EGTA, 1% Triton X-100, 20 mm β-glycerophosphate, 10 mm sodium pyrophosphate, 10 mm sodium vanadate, 1 μg/ml leupeptin, 1 mm NaF, and 1 mm phenylmethylsulfonyl fluoride, and protease inhibitor mixture (Roche Applied Science). Protein concentration was determined using a Bio-Rad protein assay kit. Protein (25 μg) was separated on 10% of Tris-HCl SDS-polyacrylamide electrophoresis gel and transferred to a nitrocellulose membrane (Bio-Rad Laboratories). The membrane was blocked with TBST (10 mm Tris, 0.2% Tween 20) containing 5% nonfat milk for 1 h and then incubated with primary antibody for 2 h at room temperature. After three washes with TBST, the membrane was incubated with secondary antibody for 1 h at room temperature. The enhanced chemiluminescence kit (Pierce) was used for detection. Membranes were stripped with Restore Western blot stripping buffer (Pierce) for 15 min at room temperature followed by washing with TBST. Primary antibodies were used as indicated. Secondary antibodies included anti-rabbit IgG/horseradish peroxidase conjugate or anti-mouse IgG/horseradish peroxidase conjugate (1:1000 dilution; Amersham Biosciences). RNA was harvested with the Trizol reagent, and hybridization was performed with p27kip1 cDNA probe as previously described (53Abid M.R. Guo S. Minami T. Spokes K.C. Ueki K. Skurk C. Walsh K. Aird W.C. Arterioscler. Thromb. Vasc. Biol. 2004; 24: 294-300Crossref PubMed Scopus (191) Google Scholar). Northern and Western blots were performed in triplicate, and representative blots are shown.Adenovirus Vector Constructs and Transduction—CASMC were transduced with replication-defective adenovirus encoding the cDNA for β-galactosidase (Adv), wild type FKHRL1 (WT-FKHRL1), and the phosphorylation-resistant triple mutant FKHRL1 (TM-FKHRL1), which contains T32A, S253A, and S319A (53Abid M.R. Guo S. Minami T. Spokes K.C. Ueki K. Skurk C. Walsh K. Aird W.C. Arterioscler. Thromb. Vasc. Biol. 2004; 24: 294-300Crossref PubMed Scopus (191) Google Scholar). For virus transductions, CASMC were plated at ∼70-80% confluence and cultured for 5 h at 37 °C, 5% CO2 in smooth muscle growth medium (SmGM, Cambrex Bio Science). The cells were washed once with and incubated in Opti-MEM I (without phenol red) for 30 min and then transduced at a multiplicity of infection of 20 in SmGM medium for 12 h, grown in fresh medium for another 10 h, and then serum-starved in SmBM for 16-72 h as indicated.FKHR and FKHRL1 Immunofluorescence—CASMC were plated onto 4-well chamber slides (Lab-Tek, Christchurch, New Zealand) at a density of 50,000 cells/well. The cells were fixed in 3.7% paraformaldehyde for 20 min at room temperature, washed with phosphate-buffered saline, and incubated in blocking buffer (4 mg/ml bovine serum albumin, 0.1% saponin in phosphate-buffered saline) for 10 min. The cells were incubated with anti-FKHR, anti-FKHRL1, or anti-HA antibody (1:100) in 200 μl of blocking buffer for 1 h at room temperature, followed by fluorescein isothiocyanate-conjugated secondary anti-rabbit IgG (1:100) in 200 μl of blocking buffer for 1 h. After extensive washing, the cells were incubated with DAPI-containing mounting medium Vectashield (Vector Laboratories, Burlingame, CA) for 10 min at room temperature, and representative images were captured with a Nikon Eclipse E800 microscope and a Spot digital camera. The images were merged using Adobe Photoshop software.Proliferation Assays—CASMC were grown to a density of 50,000 cells/well in 12-well plates. At 80% confluence, the cells were starved for 48 h in SmBM in the absence of serum. The cells were treated with TNF-α, PDGF-BB, or 10% fetal calf serum for 20 h to induce cell cycle reentry and pulsed with 1 mCi/liter [3H]thymidine (Amersham Biosciences) during the last 4 h of incubation. After washes with cold phosphate-buffered saline, cells were trypsinized and solubilized with 0.2 m NaOH. Radioactivity incorporated into DNA was measured in a scintillation counter. In addition, the XTT assay was employed to determine cell proliferation. This assay is based on the conversion of the yellow tetrazolium salt XTT into an orange, water-soluble dye, formazan, by metabolically active cells. Cells were serum-starved for 48 h, treated with agonists for 48 h, and then incubated with XTT for 4 h. Formation of formazan was directly quantitated in 96-well plates with an enzyme-linked immunosorbent assay reader at A490-655 nm (model 680; Bio-Rad). Trypan blue exclusion method was also used to count the number of viable cells where indicated (55Abid M.R. Tsai J.C. Spokes K.C. Deshpande S.S. Irani K. Aird W.C. FASEB J. 2001; 15: 2548-2550Crossref PubMed Scopus (149) Google Scholar).Flow Cytometry for Cell Cycle and Apoptosis Assay—FACS analyses were carried out to determine apoptosis as assayed by annexin V-propidium iodide staining of intact cells and to determine the cell cycle distribution of CASMC by quantifying propidium iodide-labeled DNA content of ethanol-permeabilized cells, as previously described (53Abid M.R. Guo S. Minami T. Spokes K.C. Ueki K. Skurk C. Walsh K. Aird W.C. Arterioscler. Thromb. Vasc. Biol. 2004; 24: 294-300Crossref PubMed Scopus (191) Google Scholar). A total of 10,000 cells were counted (gated) by FACS.In Vitro Knockdown of p27kip1 by siRNA—p27kip1 siRNA was synthesized using the DNA target sequence: AAGTACGAGTGGCAAGAGGTG (56Le X.F. Claret F.X. Lammayot A. Tian L. Deshpande D. LaPushin R. Tari A.M. Bast Jr., R.C. J. Biol. Chem. 2003; 278: 23441-23450Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar). 400,000 CASMC were plated onto a 60-mm plate, and 24 h later, the cells were transfected with 5 μg of siRNA p27kip1. In brief, 25 μl of Lipofectin was added to 225 μl of Opti-MEM I in a polystyrene tube. Following a 30-min incubation at room temperature, the mixture was combined with 250 μl of Opti-MEM I containing 5 μg of control nonsilencing Alex Fluor 488 (NS) (Qiagen) or p27kip1 siRNA and incubated for an additional 30 min. 2 ml of fresh Opti-MEM I was added to each polystyrene tube containing 500 μl of the mixture of siRNA and Lipofectin. The cells were washed with Opti-MEM I and then incubated with 2.5 ml of the above mixture at 37 °C, 5% CO2. After 4.5 h, Opti-MEM I was removed, and cells were incubated in SmGM medium for 24-48 h, as indicated. For co-transduction with adenovirus and siRNA, the cells were plated and transduced with the viruses expressing either control β-galactosidase (Adv) or TM-FKHRL1 on day 1 and then transfected with either NS or p27kip1 siRNA on the next day.Gene Transfer and in Vivo Balloon Angioplasty—The rat carotid balloon angioplasty model was performed according to the method described by Clowes et al. (57Clowes A.W. Reidy M.A. Clowes M.M. Lab. Invest. 1983; 49: 327-333PubMed Google Scholar, 58Clowes A.W. Reidy M.A. Clowes M.M. Lab. Invest. 1983; 49: 208-215PubMed Google Scholar). Briefly, 4-month-old Sprague-Dawley rats (350-400 g) were heparinized systemically (100 units/kg). 1-1.5 cm of the left carotid arteries of adult males were injured with a 2F embolectomy catheter (Baxter Edwards Healthcare, Irvine, CA), which was inflated in the carotid and passed three times to achieve significant injury. The vessel was filled with 50 μl of normal saline (n = 8) or with 108 to 5 × 108 plaque-forming units of rAd.TM-FKHRL1 (n = 14) or control rAd.β-gal (n = 6) for 20 min. The adenovirus solution was flushed out via the opened external carotid artery. The external carotid was then ligated, and blood flow was restored. All rats were housed at the BIDMC animal facility and were treated according to published National Institutes of Health guidelines.Tissue Collection, Morphology, and Immunocytochemistry—Rats subjected to balloon injury were monitored for 14 days and subsequently sacrificed. Injured carotids were retrieved, fixed in 10% formalin, embedded in paraffin, sectioned, and stained with hematoxylin/eosin for histomorphometric analysis. The ratio of intima versus media (I/M) in each carotid was measured by morphometric analysis using the NIH Image version 1.62 public domain software. I/M ratios from 10 serial sections 50 μm apart were averaged for each animal. To detect PDGF-B in the tissue sections, immunochemical staining was performed using biotinylated anti-IgG as a secondary antibody. Apoptotic cells were identified using the Vectastain Elite ABC kit. Immunofluorescent staining of 5-μm frozen sections was employed to detect Ki-67, smooth muscle actin, HA, FKHRL1, and p27kip1. The snap frozen tissue sections were fixed with 2% paraformaldehyde followed by the heat treatment in 10 mm citrate buffer.Statistical Analysis—Data are given as mean ± S.E. of at least three independent experiments. Statistical analysis was performed by analysis of variance as appropriate.RESULTSPDGF-BB, TNF-α, and IGF-1 Induce Phosphorylation of FoxO Proteins in CASMC—To determine whether PDGF-BB, TNF-α, and IGF-1 modulate the phosphorylation of forkhead proteins in VSMC, we carried out Western blot analyses of CASMC treated in the absence or presence of the cytokine/growth factor. As shown in Fig. 1, incubation of CASMC with PDGF-BB (10 ng/ml for 15 min), TNF-α (10 ng/ml for 30 min), or IGF-1 (100 ng/ml for 15 min) each resulted in phosphorylation of Akt at serine 473, FKHR at serine 256, and AFX at serine 193. PDGF-BB-mediated induction of FKHR phosphorylation was blocked by pretreatment with the PI3K inhibitors, LY294002 and wortmannin, but not by the MEK1/2 inhibitor, PD980059 (Fig. 1A shows LY294002 and PD980059). In contrast, PDGF-BB-induced phosphorylation of AFX was only partially inhibited by LY294002. The effect of TNF-α on the phosphorylation of FKHR and AFX was partially attenuated by LY294002 and PD980059 (Fig. 1B). Finally, IGF-1-mediated phosphorylation of FKHR and AFX was blocked by LY294002 (Fig. 1C). In time course experiments, the effect of TNF-α on phosphorylation of FKHR and AFX was delayed (maximum at 30 min) compared with PDGF-BB and IGF-1 (maximum at 15 min) (data not shown). Taken together, these data indicate that PDGF-BB, TNF-α, and IGF-1 each induces phosphorylation of forkhead in CASMC through MEK1/2 and/or PI3K-dependent signaling pathways.PDGF-BB, TNF-α, and IGF-1 Induce Nuclear Export of FKHR and FKHRL1 in CASMC—To determine the effect of PDGF-BB, TNF-α, or IGF-1 on nuclear localization of FoxO, CASMC were cultured in 4-well chamber slides, serum-starved for 24 h, and then treated with or without 10 ng/ml PDGF-BB, 10 ng/ml TNF-α, or 100 ng/ml IGF-1 for 30 min. Subcellular distribution of FKHR and FKHRL1 was assayed by immunofluorescence. Under serum starvation conditions, FKHR and FKHRL1 were predominantly localized in the nucleus. Treatment with PDGF-BB, TNF-α, or IGF-1 resulted in nuclear export of FKHR and FKHRL1 (Figs. 2, A and B). Preincubation of CASMC with 50 μm LY294002 significantly inhibited PDGF-BB-, TNF-α-, and IGF-1-mediated nuclear exclusion of FKHR, whereas the inhibitory effect of 50 μm PD98059 was limited to TNF-α-mediated translocation of FKHR (Fig. 2C). These results are consistent with the phosphorylation data (see Fig. 1) and collectively suggest that PDGF-BB-, TNF-α-, and IGF-1-mediated phosphorylation of FoxO results in cytoplasmic translocation/nuclear exclusion of the transcription factors.Fig. 2PDGF-BB, TNF-α, and IGF-1 each induces nuclear exclusion of forkhead proteins in CASMC. A total of 50,000 cells of CASMC were cultured in 4-well chamber slides; serum-starved for 24 h; treated in the absence or presence of PDGF-BB, TNF-α, and IGF-1 for 30 min; fixed with paraformaldehyde; and then incubated with primary antibodies to FKHR (A) or FKHRL1 (B), followed by Cy3-conjugated anti-IgG secondary antibody. The cells were incubated with DAPI for nuclear staining and observe" @default.
• W2045554095 created "2016-06-24" @default.
• W2045554095 creator A5014702282 @default.
• W2045554095 creator A5015016192 @default.
• W2045554095 creator A5028352991 @default.
• W2045554095 creator A5030218241 @default.
• W2045554095 creator A5047892382 @default.
• W2045554095 creator A5048165415 @default.
• W2045554095 creator A5064853635 @default.
• W2045554095 creator A5081047738 @default.
• W2045554095 date "2005-08-01" @default.
• W2045554095 modified "2023-10-09" @default.
• W2045554095 title "Forkhead Transcription Factors Inhibit Vascular Smooth Muscle Cell Proliferation and Neointimal Hyperplasia" @default.
• W2045554095 cites W145716214 @default.
• W2045554095 cites W1578392373 @default.
• W2045554095 cites W1595974511 @default.
• W2045554095 cites W1602113709 @default.
• W2045554095 cites W1631908837 @default.
• W2045554095 cites W1897507144 @default.
• W2045554095 cites W1963943410 @default.
• W2045554095 cites W1966828006 @default.
• W2045554095 cites W1968142145 @default.
• W2045554095 cites W1969091160 @default.
• W2045554095 cites W1971705405 @default.
• W2045554095 cites W1978641537 @default.
• W2045554095 cites W1985443301 @default.
• W2045554095 cites W1987430295 @default.
• W2045554095 cites W1988924493 @default.
• W2045554095 cites W1991174835 @default.
• W2045554095 cites W1991568785 @default.
• W2045554095 cites W1992847318 @default.
• W2045554095 cites W1993209978 @default.
• W2045554095 cites W1993966022 @default.
• W2045554095 cites W1998917786 @default.
• W2045554095 cites W2005760229 @default.
• W2045554095 cites W2006527950 @default.
• W2045554095 cites W2007530728 @default.
• W2045554095 cites W2011785467 @default.
• W2045554095 cites W2016207968 @default.
• W2045554095 cites W2017882868 @default.
• W2045554095 cites W2022416092 @default.
• W2045554095 cites W2023060386 @default.
• W2045554095 cites W2024529788 @default.
• W2045554095 cites W2026248402 @default.
• W2045554095 cites W2028429116 @default.
• W2045554095 cites W2038978803 @default.
• W2045554095 cites W2040170245 @default.
• W2045554095 cites W2041529675 @default.
• W2045554095 cites W2043385366 @default.
• W2045554095 cites W2046028018 @default.
• W2045554095 cites W2046623154 @default.
• W2045554095 cites W2051904824 @default.
• W2045554095 cites W2054193823 @default.
• W2045554095 cites W2064013576 @default.
• W2045554095 cites W2064440744 @default.
• W2045554095 cites W2066372429 @default.
• W2045554095 cites W2071923579 @default.
• W2045554095 cites W2076262819 @default.
• W2045554095 cites W2087332436 @default.
• W2045554095 cites W2090412760 @default.
• W2045554095 cites W2090759987 @default.
• W2045554095 cites W2094123695 @default.
• W2045554095 cites W2095287248 @default.
• W2045554095 cites W2096334465 @default.
• W2045554095 cites W2098282651 @default.
• W2045554095 cites W2099461384 @default.
• W2045554095 cites W2103494164 @default.
• W2045554095 cites W2104139750 @default.
• W2045554095 cites W2107327751 @default.
• W2045554095 cites W2107383402 @default.
• W2045554095 cites W2119235794 @default.
• W2045554095 cites W2122855275 @default.
• W2045554095 cites W2129129118 @default.
• W2045554095 cites W2134199670 @default.
• W2045554095 cites W2137035181 @default.
• W2045554095 cites W2143631034 @default.
• W2045554095 cites W2149932234 @default.
• W2045554095 cites W2152214792 @default.
• W2045554095 cites W2152424657 @default.
• W2045554095 cites W2152705884 @default.
• W2045554095 cites W2156263462 @default.
• W2045554095 cites W2156552442 @default.
• W2045554095 cites W2166028130 @default.
• W2045554095 cites W2166525118 @default.
• W2045554095 cites W4256475235 @default.
• W2045554095 doi "https://doi.org/10.1074/jbc.m502149200" @default.
• W2045554095 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15961397" @default.
• W2045554095 hasPublicationYear "2005" @default.
• W2045554095 type Work @default.
• W2045554095 sameAs 2045554095 @default.
• W2045554095 citedByCount "103" @default.
• W2045554095 countsByYear W20455540952012 @default.
• W2045554095 countsByYear W20455540952013 @default.
• W2045554095 countsByYear W20455540952014 @default.
• W2045554095 countsByYear W20455540952015 @default.
• W2045554095 countsByYear W20455540952016 @default.
• W2045554095 countsByYear W20455540952017 @default.
• W2045554095 countsByYear W20455540952018 @default.

• next