FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2045655020> ?p ?o ?g. }

• W2045655020 endingPage "20069" @default.
• W2045655020 startingPage "20063" @default.
• W2045655020 abstract "A broad array of stressors induce ACTH release from the anterior pituitary, with consequent stimulation of the adrenal cortex and release of glucocorticoids critical for survival of the animal. ACTH stimulates adrenocortical gene expression in vivo and inhibits adrenocortical cell proliferation. Binding of ACTH to its G-protein-coupled receptor stimulates the production of cAMP and activation of the protein kinase A pathway. The stress-activated protein kinases (SAPKs) (or c-Jun N-terminal kinases) and the extracellular signal-regulated kinases (ERKs) are members of the mitogen-activated protein kinase family of serine/threonine kinases, which have recently been implicated in G-protein-coupled receptor intracellular signaling. The SAPKs are preferentially induced by osmotic stress and UV light, whereas the ERKs are preferentially induced by growth factors and proliferative signals in cultured cells. In these studies, ACTH stimulated SAPK activity 3–4-fold both in the adrenal cortex in vivo and in the Y1 adrenocortical cell line. 12-O-Tetradecanoylphorbol-13-acetate but not cAMP induced SAPK activity in Y1 cells. The isoquinolinesulfonamide inhibitors H-8 and H-89 blocked ACTH induction of SAPK activity at protein kinase C inhibitory doses but not at protein kinase A inhibitory doses. The calcium chelating agent EGTA inhibited ACTH-induced SAPK activity and the calcium ionophore A23187 induced SAPK activity 3-fold. In contrast with the induction of SAPK by ACTH, ERK activity was inhibited in the adrenal cortex in vivoand in Y1 adrenal cells. Together these findings suggest that ACTH induces SAPK activity through a PKC and Ca+2-dependent pathway. The induction of SAPK and inhibition of ERK by ACTH in vivo may preferentially regulate target genes involved in the adrenocortical stress responses in the whole animal. A broad array of stressors induce ACTH release from the anterior pituitary, with consequent stimulation of the adrenal cortex and release of glucocorticoids critical for survival of the animal. ACTH stimulates adrenocortical gene expression in vivo and inhibits adrenocortical cell proliferation. Binding of ACTH to its G-protein-coupled receptor stimulates the production of cAMP and activation of the protein kinase A pathway. The stress-activated protein kinases (SAPKs) (or c-Jun N-terminal kinases) and the extracellular signal-regulated kinases (ERKs) are members of the mitogen-activated protein kinase family of serine/threonine kinases, which have recently been implicated in G-protein-coupled receptor intracellular signaling. The SAPKs are preferentially induced by osmotic stress and UV light, whereas the ERKs are preferentially induced by growth factors and proliferative signals in cultured cells. In these studies, ACTH stimulated SAPK activity 3–4-fold both in the adrenal cortex in vivo and in the Y1 adrenocortical cell line. 12-O-Tetradecanoylphorbol-13-acetate but not cAMP induced SAPK activity in Y1 cells. The isoquinolinesulfonamide inhibitors H-8 and H-89 blocked ACTH induction of SAPK activity at protein kinase C inhibitory doses but not at protein kinase A inhibitory doses. The calcium chelating agent EGTA inhibited ACTH-induced SAPK activity and the calcium ionophore A23187 induced SAPK activity 3-fold. In contrast with the induction of SAPK by ACTH, ERK activity was inhibited in the adrenal cortex in vivoand in Y1 adrenal cells. Together these findings suggest that ACTH induces SAPK activity through a PKC and Ca+2-dependent pathway. The induction of SAPK and inhibition of ERK by ACTH in vivo may preferentially regulate target genes involved in the adrenocortical stress responses in the whole animal. ACTH binds to specific G-protein (Gs)-coupled surface receptors in the adrenal cortex to induce secretion of steroid hormones critical for the normal stress response. The stimulatory guanine nucleotide-bound Gs couples to adenylate cyclase, leading to a series of signaling cascades. The acute ACTH response is associated with a rapid increase in steroid secretion and is mediated by cAMP and cAMP-dependent protein kinase A (PKA) 1The abbreviations used are: PKA, protein kinase A; PKC, protein kinase C; TPA, 12-O-tetradecanoylphorbol-13-acetate; SAPK, stress-activated protein kinases; ERK, extracellular signal-regulated kinase; H-8,N-(2-(methylamino)ethyl)-5-isoquinolinesulfonamide hydrochloride; H-89,N-(2-(p-bromocinnamyl)amino)ethyl-5-isoquinolinesulfonamide hydrochloride; MOPS, 4-morpholinepropanesulfonic acid; TNFα, tumor necrosis factor α CRE, cAMP response element; 8-bromo-cAMP, 8-bromoadenosine 3′:5′-cyclic monophosphate. 1The abbreviations used are: PKA, protein kinase A; PKC, protein kinase C; TPA, 12-O-tetradecanoylphorbol-13-acetate; SAPK, stress-activated protein kinases; ERK, extracellular signal-regulated kinase; H-8,N-(2-(methylamino)ethyl)-5-isoquinolinesulfonamide hydrochloride; H-89,N-(2-(p-bromocinnamyl)amino)ethyl-5-isoquinolinesulfonamide hydrochloride; MOPS, 4-morpholinepropanesulfonic acid; TNFα, tumor necrosis factor α CRE, cAMP response element; 8-bromo-cAMP, 8-bromoadenosine 3′:5′-cyclic monophosphate. (1Rae P.A. Gutman N.S. Tsao J. Schimmer B.P. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 1896-1900Crossref PubMed Scopus (129) Google Scholar, 2Wong M. Krolcyzk A.J. Schimmer B.P. Mol. Endocrinol. 1992; 6: 1614-1624PubMed Google Scholar). Although ACTH stimulates an increase in cAMP formation (3Halkerston I.D. Adv. Cyclic Nucleotide Res. 1975; 6: 99-136PubMed Google Scholar, 4Schimmer B.P. Adv. Cyclic Nucleotide Res. 1980; 13: 181-214PubMed Google Scholar, 5Waterman M.R. J. Biol. Chem. 1994; 269: 27783-27786Abstract Full Text PDF PubMed Google Scholar), other secondary messengers including protein kinase C (PKC) (6Vilgrain I. Cochet C. Chambaz E.M. J. Biol. Chem. 1984; 259: 3403-3406Abstract Full Text PDF PubMed Google Scholar), Ca+2-calmodulin-dependent protein kinase (7Papadopoulos V. Brown A.S. Hall P.F. Mol. Cell. Endocrinol. 1990; 74: 109-123Crossref PubMed Scopus (24) Google Scholar) and the phosphoinositol pathway (8Bird I.M. Walker S.W. Williams B.C. J. Mol. Endocrinol. 1990; 5: 191-209Crossref PubMed Scopus (42) Google Scholar, 9Bird I.M. Smith A.D. Schulster D. J. Lipid Mediators. 1990; 2: 343-354PubMed Google Scholar) are also induced by ACTH. Early and delayed gene expression is elicited by ACTH (5Waterman M.R. J. Biol. Chem. 1994; 269: 27783-27786Abstract Full Text PDF PubMed Google Scholar). The immediate early genes junB, c-myc, and c-foswere stimulated by ACTH in cultured adrenocortical cells (10Heikkila P. Arola J. Salmi A. Kahri A.I. J. Endocrinol. 1995; 145: 379-385Crossref PubMed Scopus (7) Google Scholar), and c-fos and c-jun mRNAs were induced by ACTH in the Y1 adrenal cell line (11Kimura E. Sonobe M.H. Armelin M.C.S. Armelin H.A. Mol. Endocrinol. 1993; 7: 1463-1471Crossref PubMed Scopus (0) Google Scholar). The steroidogenic P-450 genes, including P-450 side chain cleavage (CYP11A1), are induced in a more delayed manner in both the adrenal cortex in vivo and in Y1 cells (5Waterman M.R. J. Biol. Chem. 1994; 269: 27783-27786Abstract Full Text PDF PubMed Google Scholar). Several observations suggest that ACTH regulates PKA-independent signaling. ACTH and cAMP induced immediate early gene expression with quite different kinetics (11Kimura E. Sonobe M.H. Armelin M.C.S. Armelin H.A. Mol. Endocrinol. 1993; 7: 1463-1471Crossref PubMed Scopus (0) Google Scholar). The immediate early gene expression profile induced by ACTH in Y1 cells resembled the expression profile induced by stimulating the PKC pathway with phorbol esters (11Kimura E. Sonobe M.H. Armelin M.C.S. Armelin H.A. Mol. Endocrinol. 1993; 7: 1463-1471Crossref PubMed Scopus (0) Google Scholar). In addition, c-myc mRNA levels were induced by the PKC activator 12-O-tetradecanoylphorbol-13-acetate (TPA), and ACTH-induced c-myc expression was blocked by the PKC inhibitor H-7 in rat primary adrenal cell cultures (10Heikkila P. Arola J. Salmi A. Kahri A.I. J. Endocrinol. 1995; 145: 379-385Crossref PubMed Scopus (7) Google Scholar). Stimuli that activate either the PKC, the Ca+2-calmodulin-dependent protein kinase, or the phosphoinositol pathway, also induce members of the mitogen-activated protein kinase family of serine/threonine kinases (12Cobb M.H. Goldsmith E.J. J. Biol. Chem. 1995; 270: 14843-14846Abstract Full Text Full Text PDF PubMed Scopus (1657) Google Scholar). Mitogen-activated protein kinases include the related but distinct p54 stress-activated protein kinases (SAPKs) (or c-JunN-terminal kinases), the p42 and p44 extracellular signal-regulated kinases (ERKs), and p38 kinases (13Hibi M. Lin A. Smeal T. Minden A. Karin M. Genes Dev. 1993; 7: 2135-2148Crossref PubMed Scopus (1708) Google Scholar, 14Lin A. Smeal T. Binetruy B. Deng T. Chambard J.C. Karin M. Adv. Second Messenger Phosphoprotein Res. 1993; 28: 255-260PubMed Google Scholar, 15Minden A. Lin A. McMahon M. Lange-Carter C. Derijard B. Davis R.J. Johnson G.J. Karin M. Science. 1994; 266: 1719-1722Crossref PubMed Scopus (1010) Google Scholar, 16Minden A. Lin A. Smeal T. Derijard B. Cobb M. Davis R. Karin M. Mol. Cell. Biol. 1994; 14: 6683-6688Crossref PubMed Scopus (436) Google Scholar, 17Kyriakis J.M. Banerjee P. Nikolakaki E. Dai T. Rubie E.A. Ahmad M.F. Avruch J. Woodgett J.R. Nature. 1994; 369: 156-160Crossref PubMed Scopus (2411) Google Scholar). These serine/threonine kinases activate downstream transcription factors, which in turn induce expression of target genes. A variety of environmental stressors induce SAPK activity in cultured cells, including heat shock and UV irradiation and calcium ionophores (17Kyriakis J.M. Banerjee P. Nikolakaki E. Dai T. Rubie E.A. Ahmad M.F. Avruch J. Woodgett J.R. Nature. 1994; 369: 156-160Crossref PubMed Scopus (2411) Google Scholar, 18Cano E. Hazzalan C.A. Mahadevan L.C. Mol. Cell. Biol. 1994; 14: 7352-7362Crossref PubMed Scopus (268) Google Scholar, 19Zohn I.E. Xiong H.Y. Cox A.D. Earp H.S. Mol. Cell. Biol. 1995; 15: 6160-6168Crossref PubMed Scopus (140) Google Scholar, 20Yan M. Dai T. Deak J.C. Kyriakis J.M. Zon L.I. Woodgett J.R. Templeton D.J. Nature. 1994; 372: 798-800Crossref PubMed Scopus (658) Google Scholar, 21Sanchez I. Hughes R.T. Mayer B.J. Yee K. Woodgett J.R. Avruch J. Kyriakis J.M. Zon L.I. Nature. 1994; 372: 794-798Crossref PubMed Scopus (916) Google Scholar, 22Su B. Jacinto E. Hibi M. Kallunki T. Karin M. Ben-Neriah Y. Cell. 1994; 77: 727-736Abstract Full Text PDF PubMed Scopus (849) Google Scholar). Angiotensin II, activating mutations of G-protein-coupled receptors, and activators of the PKC pathway also induce SAPK activity (13Hibi M. Lin A. Smeal T. Minden A. Karin M. Genes Dev. 1993; 7: 2135-2148Crossref PubMed Scopus (1708) Google Scholar, 14Lin A. Smeal T. Binetruy B. Deng T. Chambard J.C. Karin M. Adv. Second Messenger Phosphoprotein Res. 1993; 28: 255-260PubMed Google Scholar, 15Minden A. Lin A. McMahon M. Lange-Carter C. Derijard B. Davis R.J. Johnson G.J. Karin M. Science. 1994; 266: 1719-1722Crossref PubMed Scopus (1010) Google Scholar, 16Minden A. Lin A. Smeal T. Derijard B. Cobb M. Davis R. Karin M. Mol. Cell. Biol. 1994; 14: 6683-6688Crossref PubMed Scopus (436) Google Scholar, 17Kyriakis J.M. Banerjee P. Nikolakaki E. Dai T. Rubie E.A. Ahmad M.F. Avruch J. Woodgett J.R. Nature. 1994; 369: 156-160Crossref PubMed Scopus (2411) Google Scholar, 23Vara Prasad M.V.V.S. Dermott J.M. Heasley L.E. Johnson G.J. Dhanasekaran N. J. Biol. Chem. 1995; 270: 18655-18659Abstract Full Text Full Text PDF PubMed Scopus (173) Google Scholar, 24Watanabe G. Lee R.J. Albanese C. Rainey W.E. Batlle D. Pestell R.G. J. Biol. Chem. 1996; 271: 22570-22577Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar). Relatively little is known about the regulation of the SAPK pathway in vivo. The effects of ACTH on SAPK activity were previously unknown. ERK activity is stimulated by proliferative stimuli including growth factors and increases in intracellular Ca+2 in a cell type-specific manner (25Marshall C.J. Cell. 1995; 80: 179-185Abstract Full Text PDF PubMed Scopus (4224) Google Scholar, 26Burgering B.M.T. Bos J.L. Trends Biochem. Sci. 1995; 20: 18-22Abstract Full Text PDF PubMed Scopus (290) Google Scholar, 27Burgering B.M.T. Pronk G.J. van Weeren P.C. Chardin P. Bos J.L. Mol. Cell. Biol. 1993; 13: 7248-7256Crossref PubMed Scopus (151) Google Scholar). ERK activity induced by either epidermal growth factor or platelet-derived growth factor in fibroblast cell lines was inhibited by cAMP (25Marshall C.J. Cell. 1995; 80: 179-185Abstract Full Text PDF PubMed Scopus (4224) Google Scholar, 28Wu J. Jelinek T. Wolfman A. Weber M.J. Sturgill T.W. Science. 1993; 262: 1065-1068Crossref PubMed Scopus (818) Google Scholar, 29Cook S.J. McCormick F. Science. 1993; 262: 1069-1072Crossref PubMed Scopus (862) Google Scholar). In contrast, cAMP induced ERK activity in PC12 cells (30Frodin M. Peraldi P. Van Obberghen E. J. Biol. Chem. 1994; 269: 6207-6214Abstract Full Text PDF PubMed Google Scholar), rat ovarian granulosa cells (31Das E. Maizels E.T. DeManno D. St. Clair D. Adam S.A. Hunzicker-Dunn M. Endocrinology. 1996; 137: 967-974Crossref PubMed Scopus (112) Google Scholar), and cardiac myocytes (32Lazou A. Bogoyevitch M.A. Clerk A. Fuller S.J. Marshall C.J. Sugden P.H. Circ. Res. 1994; 75: 932-941Crossref PubMed Scopus (85) Google Scholar), indicating that the effect of cAMP on ERK activity is cell type-specific. In addition to adrenal cells, ACTH receptors are expressed on a number of different cell types including lymphocytes (33Clarke B.L. Moore D.R. Blalock J.E. Endocrinology. 1994; 135: 1780-1786Crossref PubMed Scopus (19) Google Scholar), pancreatic islet cells (34Gagliardino J.J. Borelli M.I. Boschero A.C. Rojas E. Atwater I. Arch. Physiol. Biochem. 1995; 103: 73-78Crossref PubMed Scopus (9) Google Scholar), and adipose tissue (35Izawa T. Mochizuki T. Komabayashi T. Suda K. Tsuboi M. Am. J. Physiol. 1994; 266: E418-E426PubMed Google Scholar); thus, an understanding of intracellular signaling by ACTH may have implications in a broad array of different cell types. To understand more fully the intracellular signaling pathways governing ACTH action, we examined the effect of ACTH on the activity of the mitogen-activated protein kinases, SAPK, and ERK kinases in vivo and in cultured adrenocortical cells. Since previous studies suggested that the induction of several immediate early genes by ACTH appeared to involve mechanisms separate from the PKA pathway, we examined the regulation of immediate early gene expression and promoter activity in response to ACTH. Male CD rats (175–200 g; Charles River Laboratories, Wilmington, MA) were used for the experiments. The rats used in this study were maintained in accordance with the guidelines of the animal care committee of Northwestern University. Free-feeding rats were injected with ACTH (5 units/100 g weight; Cortrosyn, Organon, Bedford, OH) by the tail vein and sacrificed by decapitation after CO2 inhalation. Adrenals were taken at the time point indicated in the text. The adrenal cortex was dissected free from the medulla and lysed with radioimmune precipitation buffer (100 mm Tris, pH 7.5, 150 mm NaCl, 0.1% SDS, 1% Nonidet P-40, 0.1 mm Na3VO4, 0.5% deoxycholate, 0.1 mm phenylmethylsulfonyl fluroide, 1 μg/ml leupeptin), and the extracts were used for immune complex kinase assays and Western blotting. Porcine adrenocorticotropic hormone (ACTH(1–39)) (Sigma), 8-bromo-cAMP (Sigma),N-(2-(methylamino)ethyl)-5-isoquinolinesulfonamide hydrochloride (H-8),N-(2-(p-bromocinnamyl)amino)ethyl-5-isoquinolinesulfonamide hydrochloride (H-89), A23187 (Calbiochem-Novabiochem International), BAPTA (Molecular Probes, Inc. Eugene, OR), EGTA (Sigma), and TPA (Sigma) were reconstituted and stored as recommended by the manufacturer. The SignaTECT cAMP-dependent protein kinase A assay system (Promega, Madison, WI), which uses biotinylated Leu-Arg-Arg-Ala-Ser-Leu-Gly (Kemptide) as substrate, and the SignaTECT protein kinase C assay system (Promega), which uses biotinylated Ala-Ala-Lys-Ile-Gln-Ala-Ser-Phe-Arg-Gly-His-Met-Ala-Arg-Lys-Lys (Neurogranin) peptide, were used as recommended by the manufacturer. Assays were performed as recently described on extracts derived from rats or cultured cells (24Watanabe G. Lee R.J. Albanese C. Rainey W.E. Batlle D. Pestell R.G. J. Biol. Chem. 1996; 271: 22570-22577Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar, 36Pestell R.G. Albanese C. Watanabe G. Johnson J. Eklund N. Lastowiecki P. Jameson J.L. J. Biol. Chem. 1995; 270: 18301-18308Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar). Staphylococcal protein A-agarose beads were incubated with anti-ERK antibody (C14, Santa Cruz Biotechnology, Santa Cruz, CA) or anti-SAPK antibody (a gift from Dr. J. Kyriakis) (17Kyriakis J.M. Banerjee P. Nikolakaki E. Dai T. Rubie E.A. Ahmad M.F. Avruch J. Woodgett J.R. Nature. 1994; 369: 156-160Crossref PubMed Scopus (2411) Google Scholar) for 1 h at 4 °C. The antibody-beads complexes were washed once with radioimmune precipitation buffer and incubated with 200 μg of extracts for a further 2 h at 4 °C. The immunoprecipitates were washed with radioimmune precipitation buffer, wash buffer (0.5 m LiCl, 0.1 m Tris-Cl, pH 8.0, 1 mm dithiothreitol, and kinase buffer (for SAPK: 20 mm MOPS, pH 7.2, 2 mm EGTA, 10 mmMgCl2, 0.1% Triton X-100, 1 mm dithiothreitol; for ERK: 25 mm HEPES, pH 7.2, 10 mmMgCl2, 10 mm MnCl2, 1 mm dithiothreitol). The reactions were performed at 30 °C for 20 min in 40 μl of kinase buffer with 10 μCi of [γ-32P]ATP (6000 Ci/mmol, 1 Ci = 37 GBq) and 2 μg of glutathione S-transferase c-Jun (1–135) protein fragment for SAPK activity or 2 μg of myelin basic protein for ERK activity. The samples were analyzed by SDS-polyacrylamide gel electrophoresis upon termination of the reaction with Laemmli buffer and boiling. The phosphorylation of glutathioneS-transferase c-Jun or myelin basic protein was quantified by densitometry using a Bio-Rad Molecular Analyst 1.1.1. The cell extracts used for immunoprecipitation kinase assays were also used to quantify protein abundance of the immediate early gene and Cyp11A1 gene products. Western blotting was performed as described previously using antibodies to JunB (N-17), JunD (329), c-Fos (K-25), c-Myc (C-8, Santa Cruz Biotechnology), α-tubulin (5H1) (37Caceres A. Binder L.I. Payne M.R. Bender P. Rebhun L. Steward O. J. Neurosci. 1983; 4: 394-410Crossref Google Scholar), and the rat Cyp11A1 (38Farkash Y. Timberg R. Orly J. Endocrinology. 1986; 118: 1353-1365Crossref PubMed Scopus (118) Google Scholar,39Goldring N.B. Durica J.M. Lifka J. Hedin L. Ratoosh S.L. Miller W.L. Orly J. Richards J.S. Endocrinology. 1987; 120: 1942-1950Crossref PubMed Scopus (162) Google Scholar). Reactive proteins were visualized by the enhanced chemiluminescence system (Amersham Life Science, Inc.). The abundance of immunoreactive protein was quantified by densitometry using a Bio-Rad Molecular Analyst 1.1.1. The reporter c-fosLUC (24Watanabe G. Lee R.J. Albanese C. Rainey W.E. Batlle D. Pestell R.G. J. Biol. Chem. 1996; 271: 22570-22577Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar) contains the human c-fos promoter from −361 to +157 in the pA3LUC reporter (40Wood W.M. Kao M.Y. Gordon D.F. Ridgway E.C. J. Biol. Chem. 1989; 264: 14840-14847Abstract Full Text PDF PubMed Google Scholar). The junB promoter was cloned by polymerase chain reaction using oligonucleotides to the published sequences (5′ GGTACCCGCGAGCCGCCTCCTCCC, 3′ AAGCTTCCGGGCGGCCCAGGCGGT) and was subcloned into the reporter pA3LUC to create the reporter junBLUC. The c-myc P1/P2 promoters from −157 to +500 (41DesJardins E. Hay N. Mol. Cell. Biol. 1993; 13: 5710-5724Crossref PubMed Google Scholar) were linked to the pA3LUC reporter to form c-mycLUC. The cAMP-responsive chorionic gonadotropin α subunit promoter fragments linked to the luciferase reporter gene −846αLUC referred to asCRELUC and −172αLUC were previously described (42Pestell R.G. Hollenberg A. Albanese C. Jameson J.L. J. Biol. Chem. 1994; 269: 31090-31096Abstract Full Text PDF PubMed Google Scholar). The reporter plasmid −172 m4αLUC reporter that contains a mutation within the chorionic gonadotropin α subunit cAMP response element (CRE) which abolishes cAMP responsiveness and cAMP-responsive element binding protein binding was described previously (42Pestell R.G. Hollenberg A. Albanese C. Jameson J.L. J. Biol. Chem. 1994; 269: 31090-31096Abstract Full Text PDF PubMed Google Scholar). The −2700-base pair ovine CYP11A1 promoter fragment linked to the luciferase reporter gene, −2700 CYPLUC, was described previously (43Pestell R.G. Albanese C. Watanabe G. Lee R.J. Lastowiecki P. Zon L.I. Ostrowski M. Jameson J.L. Mol. Endocrinol. 1996; 10: 1084-1094PubMed Google Scholar). The integrity of all constructs was determined by restriction enzyme analysis and dideoxy DNA sequencing (44Sanger F. Nicklen S. Coulson A.R. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 5463-5467Crossref PubMed Scopus (52411) Google Scholar) using an Applied Biosystems Inc. automated sequencer. The construction of the plasmid encoding the wild type and inactive mutant catalytic subunits of protein kinase A were described previously (45Maurer R.A. J. Biol. Chem. 1989; 264: 6870-6873Abstract Full Text PDF PubMed Google Scholar). Cell culture, DNA transfection, and luciferase assays were performed as described previously (42Pestell R.G. Hollenberg A. Albanese C. Jameson J.L. J. Biol. Chem. 1994; 269: 31090-31096Abstract Full Text PDF PubMed Google Scholar, 46Pestell R.G. Hammond V. Crawford R. J. Mol. Endocrinol. 1993; 10: 297-311Crossref PubMed Scopus (12) Google Scholar). The Y1 cell line was a gift from Dr. B. Schimmer. Y1 cells were grown in Ham's F-10 medium with 1% penicillin, streptomycin, 2.5% fetal bovine serum, and 15% horse serum. 3 × 105 cells were transfected by calcium phosphate precipitation, the medium was changed after 6 h, and luciferase activity was determined after a further 24 h (42Pestell R.G. Hollenberg A. Albanese C. Jameson J.L. J. Biol. Chem. 1994; 269: 31090-31096Abstract Full Text PDF PubMed Google Scholar, 46Pestell R.G. Hammond V. Crawford R. J. Mol. Endocrinol. 1993; 10: 297-311Crossref PubMed Scopus (12) Google Scholar). Luciferase assays were performed using an Autolumat LB 953 (EG & G Berthold). Luciferase content was measured by calculating the light emitted during the initial 30 s of the reaction, and the values are expressed in arbitrary light units (36Pestell R.G. Albanese C. Watanabe G. Johnson J. Eklund N. Lastowiecki P. Jameson J.L. J. Biol. Chem. 1995; 270: 18301-18308Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar,42Pestell R.G. Hollenberg A. Albanese C. Jameson J.L. J. Biol. Chem. 1994; 269: 31090-31096Abstract Full Text PDF PubMed Google Scholar). The percent effect was determined by comparison with its untreated activity. Statistical analyses were performed using the Mann WhitneyU test. To examine the effect of ACTH on adrenal cortical SAPK activity in vivo, rats were treated with intravenous ACTH. The adrenal cortex was dissected from the medulla, and immune complex kinase assays were performed using a polyclonal SAPK antibody and the amino terminus of c-Jun (amino acids 1–135) as the substrate (17Kyriakis J.M. Banerjee P. Nikolakaki E. Dai T. Rubie E.A. Ahmad M.F. Avruch J. Woodgett J.R. Nature. 1994; 369: 156-160Crossref PubMed Scopus (2411) Google Scholar, 24Watanabe G. Lee R.J. Albanese C. Rainey W.E. Batlle D. Pestell R.G. J. Biol. Chem. 1996; 271: 22570-22577Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar,43Pestell R.G. Albanese C. Watanabe G. Lee R.J. Lastowiecki P. Zon L.I. Ostrowski M. Jameson J.L. Mol. Endocrinol. 1996; 10: 1084-1094PubMed Google Scholar). Adrenal cortical SAPK activity was increased 2-fold at 15 min (Fig. 1 A) and 3-fold (3.1 ± 0.5, n = 5) at 30 min (Fig. 1, A andB). SAPK activity remained elevated at 1 h (3.2-fold) and at 6 h (2-fold), indicating the response to ACTH was both rapid and sustained (Fig. 1, A and B). The sustained induction of SAPK activity contrasts with the transient induction of SAPK activity we previously observed in response to growth factors (43Pestell R.G. Albanese C. Watanabe G. Lee R.J. Lastowiecki P. Zon L.I. Ostrowski M. Jameson J.L. Mol. Endocrinol. 1996; 10: 1084-1094PubMed Google Scholar). In control animals treated with intravenous saline, there was no increase in SAPK activity. In contrast with the induction of SAPK activity, ERK activity was reduced 40% at 30 min in the same ACTH-treated adrenal cortical extracts (data not shown). The effect of ACTH on SAPK and ERK activity was also determined in cultured Y1 adrenal cells. ACTH (10−6m) treatment for 30 min stimulated SAPK activity an average of 3-fold in Y1 cells (Fig.2 A). To determine the time course of SAPK induction by ACTH in Y1 cells, treatment with ACTH was conducted for 15 min to 24 h, and the cells were harvested. SAPK activity was induced 2.5-fold (n = 6, range 1.4–4-fold) within 15 min and was sustained at 2 h (Fig.2 B), returning to baseline at 6 h (data not shown). The induction of SAPK was observed at 10−8m and 10−10m ACTH (Fig. 2 B). SAPK activity was also induced by ACTH in the absence of serum (Fig.2 C). In contrast with the effect of ACTH on SAPK, ERK activity was reduced by ACTH treatment with a mean reduction of 45% at 30 min (Fig. 2, D and E). The inhibition of ERK activity by ACTH was observed at 10−6m and 10−8m ACTH (Fig. 2 E). Studies were performed to investigate the second messenger pathways regulating SAPK activity and involved in ACTH regulation of SAPK activity. In previous studies of cultured hepatocytes, heat shock and tumor necrosis factor α (TNFα) were shown to induce SAPK activity 4- and 5-fold, respectively (17Kyriakis J.M. Banerjee P. Nikolakaki E. Dai T. Rubie E.A. Ahmad M.F. Avruch J. Woodgett J.R. Nature. 1994; 369: 156-160Crossref PubMed Scopus (2411) Google Scholar). When Y1 cells were treated with heat shock (42 °C) or TNFα (50 ng/ml) for 15 min, SAPK activity was induced 4-fold and 5-fold, respectively (Fig.3 A). ERK activity was induced 4.5-fold by heat shock but was induced only 1.5-fold by TNFα (not shown). As cAMP is activated by ACTH, the effect of cAMP on SAPK activity was determined. cAMP (10−3m) treatment was associated with a modest reduction in SAPK activity shown at 20 min (Fig. 3 B). Previous studies have demonstrated activation of the PKC pathway in ACTH-treated Y1 cells (33Clarke B.L. Moore D.R. Blalock J.E. Endocrinology. 1994; 135: 1780-1786Crossref PubMed Scopus (19) Google Scholar). To examine whether activation of the PKC pathway induced SAPK activity, Y1 cells were treated with the phorbol ester TPA (100 ng/ml). SAPK activity was induced 4-fold at 15 min and 5.5-fold at 30 min (Fig. 3 C). Intracellular Ca+2 fluxes played an important role in both angiotensin II-induced SAPK activity in liver epithelial cells (19Zohn I.E. Xiong H.Y. Cox A.D. Earp H.S. Mol. Cell. Biol. 1995; 15: 6160-6168Crossref PubMed Scopus (140) Google Scholar) and T cell activation of SAPK activity (22Su B. Jacinto E. Hibi M. Kallunki T. Karin M. Ben-Neriah Y. Cell. 1994; 77: 727-736Abstract Full Text PDF PubMed Scopus (849) Google Scholar). To examine the role of intracellular Ca+2 on SAPK activity in Y1 cells, the effect of the calcium ionophore A23187 was assessed. SAPK activity was induced 4.5-fold at 15 min and 12-fold at 30 min by A23187 (60 μm) (Fig. 3 D). Together these studies indicate that several distinct intracellular stressors induce, but that cAMP inhibits, SAPK activity in Y1 cells. To further investigate the secondary messenger pathways involved in ACTH-induced SAPK activity, chemical inhibitors of the isoquinolinesulfonamide family were used. H-8 is a preferential and potent inhibitor of PKA (K i 1.3 μm) compared with its effect against protein kinase C (K i, 15 μm) (47Ohtsuki M. Massague J. Mol. Cell. Biol. 1992; 12: 261-265Crossref PubMed Google Scholar). Treatment of Y1 cells with the PKA inhibitor H-8 (3 μm) did not significantly affect ACTH-induced SAPK activity (Fig.4 A). At higher concentrations, H-8 (30 μm) inhibits the PKC pathway (48Findik D. Song Q. Hidaka H. Lavin M. J. Cell. Biochem. 1995; 57: 12-21Crossref PubMed Scopus (51) Google Scholar), and ACTH-induced SAPK activity was inhibited 40% by pretreatment with 30 μm H-8 (Fig. 4 A, lane 4). The isoquinolinesulfonamide H-89 preferentially inhibits PKA (K i, 500 nm) compared with the PKC pathway (K i, 76 μm). Pretreatment of Y1 cells with 76 μm H-89 abolished SAPK induction by ACTH (not shown). Intracellular Ca+2 levels are increased in ACTH-treated Y1 cells (33Clarke B.L. Moore D.R. Blalock J.E. Endocrinology. 1994; 135: 1780-1786Crossref PubMed Scopus (19) Google Scholar). To examine the role of Ca+2 levels in ACTH-induced SAPK activity, the Ca+2 chelating agent EGTA was used. The increase in SAPK activity by ACTH was completely blocked by the addition of EGTA, suggesting that the transport of Ca+2 from the extracellular to the intracellular space may play a role in the ACTH-induced SAPK activity (Fig. 4 B,lanes 6 and 7 versus 8). Together these studies suggest SAPK activity is induced by the PKC pathway and that ACTH induction of SAPK involves both the PKC and Ca+2pathway. Because H-8 at 3 μm did not affect SAPK induction by ACTH and was used to inhibit PKA activity, we examined the effect of H-8 at this concentration on cAMP-induced activity in Y1 cells. cAMP activity was assayed using either transient reporter studies or biochemical assays. Recent studies have demonstrated the high sensitivity of a luciferase reporter system using the CRE to assay cAMP-regulated activity in cultured cells (49Christin-Maitre S. Taylor A.E. Khoury R.H. Hall J.E. Martin K.A. Smith P.C. Albanese C. Jameson J.L. Crowley W.F.J" @default.
• W2045655020 created "2016-06-24" @default.
• W2045655020 creator A5006688566 @default.
• W2045655020 creator A5007585656 @default.
• W2045655020 creator A5016235708 @default.
• W2045655020 creator A5039355847 @default.
• W2045655020 creator A5074781343 @default.
• W2045655020 creator A5085462852 @default.
• W2045655020 date "1997-08-01" @default.
• W2045655020 modified "2023-10-01" @default.
• W2045655020 title "Adrenocorticotropin Induction of Stress-activated Protein Kinase in the Adrenal Cortex in Vivo" @default.
• W2045655020 cites W1037454573 @default.
• W2045655020 cites W1533192527 @default.
• W2045655020 cites W1539871462 @default.
• W2045655020 cites W1555489233 @default.
• W2045655020 cites W1564731863 @default.
• W2045655020 cites W1588998681 @default.
• W2045655020 cites W1608533627 @default.
• W2045655020 cites W1616748355 @default.
• W2045655020 cites W1666846362 @default.
• W2045655020 cites W1968590447 @default.
• W2045655020 cites W1968800299 @default.
• W2045655020 cites W1969158591 @default.
• W2045655020 cites W1971356760 @default.
• W2045655020 cites W1971766644 @default.
• W2045655020 cites W1973052457 @default.
• W2045655020 cites W1976385326 @default.
• W2045655020 cites W1981022683 @default.
• W2045655020 cites W1982390204 @default.
• W2045655020 cites W1983532191 @default.
• W2045655020 cites W1990491999 @default.
• W2045655020 cites W1990540386 @default.
• W2045655020 cites W1992205212 @default.
• W2045655020 cites W1993876642 @default.
• W2045655020 cites W1995819749 @default.
• W2045655020 cites W1996530399 @default.
• W2045655020 cites W2002282120 @default.
• W2045655020 cites W2003367060 @default.
• W2045655020 cites W2005900169 @default.
• W2045655020 cites W2023613710 @default.
• W2045655020 cites W2026951979 @default.
• W2045655020 cites W2031312561 @default.
• W2045655020 cites W2036377185 @default.
• W2045655020 cites W2038337988 @default.
• W2045655020 cites W2038513777 @default.
• W2045655020 cites W2041922550 @default.
• W2045655020 cites W2044138206 @default.
• W2045655020 cites W2045876058 @default.
• W2045655020 cites W2055181868 @default.
• W2045655020 cites W2065114189 @default.
• W2045655020 cites W2068502127 @default.
• W2045655020 cites W2076415703 @default.
• W2045655020 cites W2077880395 @default.
• W2045655020 cites W2078757969 @default.
• W2045655020 cites W2081249104 @default.
• W2045655020 cites W2082058772 @default.
• W2045655020 cites W2084686256 @default.
• W2045655020 cites W2092109378 @default.
• W2045655020 cites W2121430531 @default.
• W2045655020 cites W2121995422 @default.
• W2045655020 cites W2122492417 @default.
• W2045655020 cites W2126400723 @default.
• W2045655020 cites W2138270253 @default.
• W2045655020 cites W2170906235 @default.
• W2045655020 doi "https://doi.org/10.1074/jbc.272.32.20063" @default.
• W2045655020 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9242678" @default.
• W2045655020 hasPublicationYear "1997" @default.
• W2045655020 type Work @default.
• W2045655020 sameAs 2045655020 @default.
• W2045655020 citedByCount "53" @default.
• W2045655020 countsByYear W20456550202012 @default.
• W2045655020 countsByYear W20456550202013 @default.
• W2045655020 countsByYear W20456550202014 @default.
• W2045655020 countsByYear W20456550202016 @default.
• W2045655020 countsByYear W20456550202018 @default.
• W2045655020 countsByYear W20456550202020 @default.
• W2045655020 countsByYear W20456550202021 @default.
• W2045655020 countsByYear W20456550202023 @default.
• W2045655020 crossrefType "journal-article" @default.
• W2045655020 hasAuthorship W2045655020A5006688566 @default.
• W2045655020 hasAuthorship W2045655020A5007585656 @default.
• W2045655020 hasAuthorship W2045655020A5016235708 @default.
• W2045655020 hasAuthorship W2045655020A5039355847 @default.
• W2045655020 hasAuthorship W2045655020A5074781343 @default.
• W2045655020 hasAuthorship W2045655020A5085462852 @default.
• W2045655020 hasBestOaLocation W20456550201 @default.
• W2045655020 hasConcept C126322002 @default.
• W2045655020 hasConcept C134018914 @default.
• W2045655020 hasConcept C184235292 @default.
• W2045655020 hasConcept C185592680 @default.
• W2045655020 hasConcept C207001950 @default.
• W2045655020 hasConcept C2777977426 @default.
• W2045655020 hasConcept C54355233 @default.
• W2045655020 hasConcept C71924100 @default.
• W2045655020 hasConcept C86803240 @default.
• W2045655020 hasConcept C95444343 @default.
• W2045655020 hasConcept C97029542 @default.
• W2045655020 hasConceptScore W2045655020C126322002 @default.

• next