FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2045882503> ?p ?o ?g. }

• W2045882503 endingPage "7558" @default.
• W2045882503 startingPage "7549" @default.
• W2045882503 abstract "Matrix metalloproteinase-2 (MMP-2) is an enzyme with proteolytic activity against matrix and nonmatrix proteins, particularly basement membrane constituents. Thus, any naturally occurring genetic variants that directly affect gene expression and/or protein function would be expected to impact on progression of pathological processes involving tissue remodeling. We scanned a 2-kilobase pair promoter region and all 13 exons of the humanMMP-2 gene, from a panel of 32 individuals, and we identified the position, nature, and relative allele frequencies of 15 variant loci as follows: 6 in the promoter, 1 in the 5′-untranslated region, 6 in the coding region, 1 in intronic sequence, and 1 in the 3′-untranslated region. The majority of coding region polymorphisms resulted in synonymous substitutions, whereas three promoter variants (at −1306, −790, and +220) mapped onto cis-acting elements. We functionally characterized all promoter variants by transient transfection experiments with 293, RAW264.7, and A10 cells. The common C → T transition at −1306 (allele frequency 0.26), which disrupts an Sp1-type promoter site (CCACC box), displayed a strikingly lower promoter activity with the T allele. Electrophoretic mobility shift assays confirmed that these differences in allelic expression were attributable to abolition of Sp1 binding. These data suggest that this common functional genetic variant influencesMMP-2 gene transcription in an allele-specific manner and is therefore an important candidate to test for association in a wide spectrum of pathologies for which a role for MMP-2 is implicated, including atherogenesis and tumor invasion and metastasis.AJ298926 Matrix metalloproteinase-2 (MMP-2) is an enzyme with proteolytic activity against matrix and nonmatrix proteins, particularly basement membrane constituents. Thus, any naturally occurring genetic variants that directly affect gene expression and/or protein function would be expected to impact on progression of pathological processes involving tissue remodeling. We scanned a 2-kilobase pair promoter region and all 13 exons of the humanMMP-2 gene, from a panel of 32 individuals, and we identified the position, nature, and relative allele frequencies of 15 variant loci as follows: 6 in the promoter, 1 in the 5′-untranslated region, 6 in the coding region, 1 in intronic sequence, and 1 in the 3′-untranslated region. The majority of coding region polymorphisms resulted in synonymous substitutions, whereas three promoter variants (at −1306, −790, and +220) mapped onto cis-acting elements. We functionally characterized all promoter variants by transient transfection experiments with 293, RAW264.7, and A10 cells. The common C → T transition at −1306 (allele frequency 0.26), which disrupts an Sp1-type promoter site (CCACC box), displayed a strikingly lower promoter activity with the T allele. Electrophoretic mobility shift assays confirmed that these differences in allelic expression were attributable to abolition of Sp1 binding. These data suggest that this common functional genetic variant influencesMMP-2 gene transcription in an allele-specific manner and is therefore an important candidate to test for association in a wide spectrum of pathologies for which a role for MMP-2 is implicated, including atherogenesis and tumor invasion and metastasis.AJ298926 matrix metalloproteinases single-nucleotide polymorphisms polymerase chain reaction denaturing high performance liquid chromatography 5′-untranslated region 3′-untranslated region stimulating protein 1 cell cycle-dependent element kilobase pair base pair nucleotide electrophoretic mobility shift assays The matrix metalloproteinases (MMPs)1 constitute a family of secreted and membrane-associated zinc-dependent endopeptidases that are capable of selectively degrading a wide spectrum of both extracellular matrix and nonmatrix proteins (1Werb Z. Cell. 1997; 91: 439-442Abstract Full Text Full Text PDF PubMed Scopus (1131) Google Scholar). Currently upwards of 20 vertebrate MMPs have been reported that can be categorized, by substrate specificity, to give the collagenases, stromelysins, gelatinases, and membrane-type MMPs. The broad range of substrates conveys a pivotal role for MMP involvement during both normal physiological processes (e.g. embryonic development, bone remodeling, angiogenesis, nerve growth, etc.) and pathological states (e.g. arthritis, cancer, atherosclerosis, liver fibrosis, etc.) (2Woessner Jr., J.F. Parks W.C. Mecham R.P. Matrix Metalloproteinases. Academic Press, Inc., San Diego, CA1998: 1-14Crossref Google Scholar). Accordingly, MMP activity is tightly coordinated at several levels including transcriptional regulation, activation of latent zymogen, and interaction with endogenous inhibitors (3Birkedal Hansen H. Curr. Opin. Cell. Biol. 1995; 7: 728-735Crossref PubMed Scopus (974) Google Scholar). MMP-2 (gelatinase A) has type IV collagenolytic activity and is constitutively expressed by most connective tissue cells including endothelial cells, osteoblasts, fibroblasts, and myoblasts. The membrane-bound activation of pro-MMP-2 ensures that proteolytic activity, predominantly against components of the basement membrane, is localized to discrete regions on the cell surface (4Strongin A.Y. Collier I. Bannikov G. Marmer B.L. Grant G.A. Goldberg G.I. J. Biol. Chem. 1995; 270: 5331-5338Abstract Full Text Full Text PDF PubMed Scopus (1435) Google Scholar, 5Brooks P.C. Stromblad S. Sanders L.C. von Schalscha T.L. Aimes R.T. Stetler Stevenson W.G. Quigley J.P. Cheresh D.A. Cell. 1996; 85: 683-693Abstract Full Text Full Text PDF PubMed Scopus (1422) Google Scholar, 6Butler G.S. Butler M.J. Atkinson S.J. Will H. Tamura T. van Westrum S.S. Crabbe T. Clements J. d'Ortho M.P. Murphy G. J. Biol. Chem. 1998; 273: 871-880Abstract Full Text Full Text PDF PubMed Scopus (539) Google Scholar) thereby potentiating extracellular matrix remodeling as well as uniquely generating several different biologically active molecules including laminin, fibronectin, and monocyte chemoattractant protein-3 (7Giannelli G. Falk Marzillier J. Schiraldi O. Stetler Stevenson W.G. Quaranta V. Science. 1997; 277: 225-228Crossref PubMed Scopus (1038) Google Scholar, 8Zuo J. Ferguson T.A. Hernandez Y.J. Stetler Stevenson W.G. Muir D. J. Neurosci. 1998; 18: 5203-5211Crossref PubMed Google Scholar, 9Watanabe K. Takahashi H. Habu Y. Kamiya Kubushiro N. Kamiya S. Nakamura H. Yajima H. Ishii T. Katayama T. Miyazaki K. Fukai F. Biochemistry. 2000; 39: 7138-7144Crossref PubMed Scopus (48) Google Scholar, 10McQuibban G.A. Gong J. Tam E.M. McCulloch C.A.G. Clark-Lewis I. Overall C.M. Science. 2000; 289: 1202-1206Crossref PubMed Scopus (643) Google Scholar). Indeed, the majority of MMP-2 studies have focused on demonstrating an essential role in promoting cell invasiveness during tumor angiogenesis, arthritis, and atherogenesis (11Fang J. Shing Y. Wiederschain D. Yan L. Butterfield C. Jackson G. Harper J. Tamvakopoulos G. Moses M.A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 3884-3889Crossref PubMed Scopus (344) Google Scholar, 12Itoh T. Tanioka M. Yoshida H. Yoshioka T. Nishimoto H. Itohara S. Cancer Res. 1998; 58: 1048-1051PubMed Google Scholar, 13Konttinen Y.T. Ainola M. Valleala H. Ma J. Ida H. Mandelin J. Kinne R.W. Santavirta S. Sorsa T. Lopez Otin C. Takagi M. Ann. Rheum. Dis. 1999; 58: 691-697Crossref PubMed Scopus (367) Google Scholar, 14Barger A.C. Beeuwkes R.D. Lainey L.L. Silverman K.J. N. Engl. J. Med. 1984; 310: 175-177Crossref PubMed Scopus (596) Google Scholar, 15Moulton K.S. Heller E. Konerding M.A. Flynn E. Palinski W. Folkman J. Circulation. 1999; 99: 1726-1732Crossref PubMed Scopus (647) Google Scholar), as well as tumor metastasis where levels of MMP-2 expression can be correlated with tumor grade (16Poulsom R. Pignatelli M. Stetler Stevenson W.G. Liotta L.A. Wright P.A. Jeffery R.E. Longcroft J.M. Rogers L. Stamp G.W. Am. J. Pathol. 1992; 141: 389-396PubMed Google Scholar, 17Boag A.H. Young I.D. Am. J. Pathol. 1994; 144: 585-591PubMed Google Scholar). Not surprisingly, the design of specific and selective inhibitors of MMP-2, for therapeutic intervention, remains an intense focus of research (18Sang Q.A. Jia M. Schwartz M.A. Jaye M.C. Kleinman H.K. Ghaffari M.A. Luo Y. Biochem. Biophys. Res. Commun. 2000; 274: 780-786Crossref PubMed Scopus (16) Google Scholar). The diseases in which a role for MMP-2 has been demonstrated are characterized by varying individual susceptibility, implying the role of genetic factors. Traditional linkage analysis methods for mapping the genes of Mendelian disorders have not been as successful in the studies of complex genetic diseases including coronary heart disease, cancers, and arthritic disorders. Attention has therefore focused on the rapid elucidation of a new class of genetic markers termed single-nucleotide polymorphisms (SNPs). These are the most common types of stable genetic variants estimated to occur, on average, every 1,000 bp and are therefore valuable markers in tests of association for susceptibility, or resistance, to common and genetically complex diseases (19Chakravarti A. Nat. Genet. 1999; 21: 56-60Crossref PubMed Scopus (486) Google Scholar, 20Kruglyak L. Nat. Genet. 1997; 17: 21-24Crossref PubMed Scopus (388) Google Scholar, 21Risch N. Merikangas K. Science. 1996; 273: 1516-1517Crossref PubMed Scopus (4270) Google Scholar) and pharmacogenetic traits (22Housman D. Ledley F.D. Nat. Biotechnol. 1998; 16: 492-493Crossref PubMed Scopus (101) Google Scholar). Indeed, the emergence of the common disease-common variant hypothesis (21Risch N. Merikangas K. Science. 1996; 273: 1516-1517Crossref PubMed Scopus (4270) Google Scholar, 23Collins F.S. Guyer M.S. Charkravarti A. Science. 1997; 278: 1580-1581Crossref PubMed Scopus (845) Google Scholar) has provided important examples of such associations, including theAPOE-4 allele in Alzheimer's disease (24Martin E.R. Lai E.H. Gilbert J.R. Rogala A.R. Afshari A.J. Riley J. Finch K.L. Stevens J.F. Livak K.J. Slotterbeck B.D. Slifer S.H. Warren L.L. Conneally P.M. Schmechel D.E. Purvis I. Pericak Vance M.A. Roses A.D. Vance J.M. Am. J. Hum. Genet. 2000; 67: 383-394Abstract Full Text Full Text PDF PubMed Scopus (324) Google Scholar) and theCCR5 allele in HIV resistance (25Mummidi S. Ahuja S.S. Gonzalez E. Anderson S.A. Santiago E.N. Stephan K.T. Craig F.E. O'Connell P. Tryon V. Clark R.A. Dolan M.J. Ahuja S.K. Nat. Med. 1998; 4: 786-793Crossref PubMed Scopus (299) Google Scholar). However, the power of association-based studies can be compromised by multiple hypothesis testing that is exacerbated by publication bias (26Altshuler D. Kruglyak L. Lander E. N. Engl. J. Med. 1998; 338: 1626Crossref PubMed Scopus (99) Google Scholar). This problem can be overcome, in part, by distinguishing functional SNPs from neutral counterparts across a candidate region thereby generating a panel of robust, informative variants that are more likely to have an influence in disease progression. The specific predilection of MMP-2 for substrates important in basement membrane integrity makes it a strong candidate for a number of heritable traits including, for example, atherosclerosis (by allowing immigration of smooth muscle cells and by facilitating plaque rupture). Common variants that alter the amount of protein expressed, for instance by affecting transcriptional regulation, or that subtly alter the activity of the protein itself would be expected to have a quantitative influence on disease activity. We have therefore identified the nature and extent of genetic variation in the promoter (∼2 kb) and complete coding region of the human matrix metalloproteinase-2 gene. We describe the in vitrocharacterization of the entire panel of promoter polymorphisms, and we identify one particular functional variant that alters MMP-2promoter activity through allele-specific binding of the transcription factor Sp1. The Human Genome Walking kit (CLONTECH) was used to obtain additional MMP-2 5′-flanking sequence to that previously published (27Bian J. Sun Y. Mol. Cell. Biol. 1997; 17: 6330-6338Crossref PubMed Scopus (249) Google Scholar). A primer complementary to the sequence +51/+72 relative to the major transcription start site (28Huhtala P. Chow L.T. Tryggvason K. J. Biol. Chem. 1990; 265: 11077-11082Abstract Full Text PDF PubMed Google Scholar) was used in combination with an adaptor primer in primary PCRs using five human genomic libraries as templates. A secondary PCR, using a nested MMP-2-specific primer (−13/+10 relative to the transcription start site), was performed, and products from the DraI, SspI, and ScaI libraries were gel-purified and cloned into pBluescript II SK(−) (Stratagene). Sequence extending 1900 bp upstream of the transcription start site was obtained by sequencing several independent clones on an ABI 377 automated sequencing apparatus with cycle sequencing according to the manufacturer's instructions (PerkinElmer Life Sciences). Eleven overlapping PCR amplicons were designed to analyze the promoter sequence (1900 bp), whereas 25 PCR fragments were generated to scan the 5′-UTR, coding region, and 3′-UTR (see Table I). To address the extent of genetic variation at splice site junctions, scanning primers were designed based on sequence information obtained by amplifying between exons, using oligonucleotides based on the genomic organization (28Huhtala P. Chow L.T. Tryggvason K. J. Biol. Chem. 1990; 265: 11077-11082Abstract Full Text PDF PubMed Google Scholar).Table IPrimers used to amplify regions of the human MMP-2 gene for DHPLC analysisPrimerSequence (5–3′)OrientationRef. positionAmplicon sizeRegionbpP19TTCCACTCTCAGCTCTCAGCTCTForward−1900 to −1878271PromoterP20GGCTTCAGACAAGTTCAGGCTTGReverse−1652 to −1630P1ACTGACTCTGGAAAGTCAGAGCACForward−1688 to −1665269PromoterP2GGCACAGGGTGAGGGGATGGReverse−1439 to −1420P3CTGACCCCCAGTCCTATCTGCCForward−1497 to −1476295PromoterP4TGTTGGGAACGCCTGACTTCAGReverse−1224 to −1203P5TTCAGGTCTCAGCTCAGAAGTCAForward−1292 to −1270284PromoterP6AGGAGCCCTCAGTTCCACGAAReverse−1029 to −1009sP7CCACATGGATTCTTGGCTTGGCForward−1081 to −1060344PromotermP7CCGCATTCTCGGTCACAGGATGAGATReverse−763 to −738P31GTCGCTTTCTTTGCCATCTTForward−871 to −852134PromoterP32CCGCATTCTCGGTCACAGGATReverse−758 to −738P33GGGTCTTTGTGACCTCTATCForward−810 to −791203PromoterP34AGATACACCTTGGGAAATAGReverse−627 to −608P35GGTCTCAGCCTCATTTTACCForward−712 to −693258PromoterP36ATTTAGGGATAGGGACAGAGReverse−474 to −455P11AAGGCTTACACATTTGCAGAAGGAForward−579 to −556353PromotermP2CCACTTGCCTCTCTCGCGReverse−244 to −227P21ATTCCTTCCCGTTCCTGACCForward−397 to −378229PromoterP22CCCGGCCGCCTGCTACTCCTReverse−188 to −169Pr1GTTTCCCAGCAGGGGGTTCTForward−282 to −263268PromoterPr2GGGCAGCCGCCAGATGTAGCReverse−34 to −15Pr3CCGCCCCCAGCCCCGCTCTGForward−77 to −581545′-UTRPr4GGTCCTGGCAATCCCTTTGTReverse+58 to +77P27CGGCTGCCCTCCCTTGTTTCForward−23 to −42385′-UTRP28CGCCTGGTTGGAGCCTGCTCReverse+196 to +215P29CGCGGGGGCCGGACCATGAGForward+110 to +1292385′-UTRP30GGCAGCCCAGGAGACAGAGCReverse+328 to +347EX1ACACACGCACCGAGCCAGCGAForward+226 to +245218Exon 1EX1BAGCAACTCACCACTGCCAACReverse+10 (beginning of intron 1)EX21GTACTGTGCCATCCTAATGTGGCForward−54 (beginning of exon 2)337Exon 2EX22GGAGACTCGTGTCCCTCAGCCReverse+56 (beginning of intron 2)EX31CATACACTTATGCACATGCATACAForward−52 (beginning of exon 3)250Exon 3EX32CTCAACACTGATCCCTGCTGGCReverse+49 (beginning of intron 3)EX41CAGGGTCTAGGTGGCACAGCTAForward−46 (beginning of exon 4)220Exon 4EX42GGACAGGAGAGAAGGTCTGGGReverse+45 (beginning of intron 4)EX51AGGCCTGGAGAAGTCCAACCTCForward−44 (beginning of exon 5)305Exon 5EX52GAGAGTGTGGAGGGAAGAGCACReverse+87 (beginning of intron 5)EX61AGCCAGCCCTGTGCCCATGGAForward−65 (beginning of exon 6)283Exon 6EX62AGCAGGTGCTGGGCCCTGAGReverse+44 (beginning of intron 6)EX73AGGTCAGCGTCATGTCATTGForward−80 (beginning of exon 7)323Exon 7EX74GTTTTTGGAGCAAGTTTAGGReverse+69 (beginning of intron 7)EX8ACTCATCTCTCTTCCTGTCTTTCForward−49 (beginning of exon 8)215Exon 8EX8BGGAGGTTTACCATAGAGCTCReverse+10 (beginning of intron 8)EX9ATTCTCCCCAGGGGCCTCTCCForward−10 (beginning of exon 9)197Exon 9EX9BAGAGCAGAGGACAGGAGACAReverse+51 (beginning of intron 9)EX10.1GAGCTGCAGGGTGACTGAAGATForward−45 (beginning of exon 10)227Exon 10EX10.2GAGCCCTGTGGAGCTGAGGGReverse+45 (beginning of intron 10)EX11ZTCCACCCCAGGGAATGAATACForward−10 (beginning of exon 11)180Exon 11EX11BCCTCCCTTACCTCCAGAATTReverse+10 (beginning of intron 11)EX12ATTCTTTACAGATACAATGAGForward−10 (beginning of exon 12)130Exon 12EX12CGGGTGCTCACCGCCGCCCTGReverse+10 (beginning of intron 12)EX13TCTATCCCAGGTCACAGCTACForward−10 (beginning of exon 13)171Exon 13EX13.2CAGGCCCGGTGTATCGAAGGCReverse+161 (exon 13)P37GAAGCATCAAATCCGACTGGForward+73 (exon 13)1963′-UTRP38GAGCCACTCTCTGGAATCTTReverse+268 (exon 13)P39CGTGCCTTCAGCTCTACAGCForward+197 (exon 13)1883′-UTRP40CTGCGTTGAAAATATCAAAGReverse+384 (exon 13)P41ATCCCACCAACCCTCAGAGCForward+329 (exon 13)2063′-UTRP42GCCCTGTCCCACTGCCCTGTReverse+534 (exon 13)P43TGGAGCCAATGGAGACTGTCForward+463 (exon 13)1863′-UTRP44AAACAAGACCCAAAGAAAAAReverse+648 (exon 13)P45AGACCCCTGGCTTTTCACTGForward+554 (exon 13)2343′-UTRP46TGGAGAAGAGACTCGGTAGGReverse+787 (exon 13)P47ATTGCATTTCCTGACAGAAGForward+666 (exon 13)1173′-UTRP48AAGAGACTCGGTAGGGACATReverse+782 (exon 13)P49TTGTCTGAAGTCACTGCACAForward+694 (exon 13)2083′-UTRP50GCCACTCAGTAGGTGTCTTTReverse+901 (exon 13)Nucleotide positions are referenced relative to the major transcription start-site of the human MMP-2 sequence (28Huhtala P. Chow L.T. Tryggvason K. J. Biol. Chem. 1990; 265: 11077-11082Abstract Full Text PDF PubMed Google Scholar). Open table in a new tab Nucleotide positions are referenced relative to the major transcription start-site of the human MMP-2 sequence (28Huhtala P. Chow L.T. Tryggvason K. J. Biol. Chem. 1990; 265: 11077-11082Abstract Full Text PDF PubMed Google Scholar). Denaturing high performance liquid chromatography (DHPLC) was used to scan the MMP-2 gene for sequence variation, using the WAVE™ DNA Fragment Analysis System (Transgenomic), as previously described (29Underhill P.A. Jin L. Zemans R. Oefner P.J. Cavalli Sforza L.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 196-200Crossref PubMed Scopus (322) Google Scholar). Optimal PCR conditions for faithful amplification were derived for each amplicon; reactions were performed in 50-μl volumes containing 20 ng of genomic DNA, 50 mm potassium chloride, 25-pmol primers, 200 μm dNTPs, 1 mm MgCl2, and 2.5 units of PfuTurbo polymerase (Stratagene). Genomic DNA was amplified from a panel of 32 unrelated healthy Caucasian subjects. PCR products (45 μl) were denatured at 95 °C for 4 min and allowed to reanneal to form homo- and heteroduplexes by cooling to 25 °C over a 50-min period. 10 μl of each PCR product was applied to the WAVETM machine using varying column temperatures (57–69 °C), as predetermined by the Transgenomic Analysis Software (according to the predicted melting characteristics of each amplicon). Individual PCR products, which displayed heteroduplex signaling patterns, were purified with QIAquick™ purification columns (Qiagen), and both strands were sequenced on an ABI 377. Luciferase reporter plasmids were constructed by cloning 3 concatenated copies of the adjacent 24 nucleotides, flanking a variant, upstream of a previously characterized minimal promoter region of the human translation initiation factor EIF-4AI gene (30Quinn C.M. Wiles A.P. El Shanawany T. Catchpole I. Alnadaf T. Ford M.J. Gordon S. Greaves D.R. Genomics. 1999; 62: 468-476Crossref PubMed Scopus (15) Google Scholar). KpnI sites were introduced at the 5′- and 3′-ends of concatamers to facilitate cloning. The sequences of the forward oligonucleotides used for concatenation are shown with variant(s) in lowercase: −1575G, 5′-AAGACATAATCgTGACCTCCAATG-3′; −1575A, 5′-AAGACATAATCaTGACCTCCAATG-3′; −1306C, 5′-ACCCAGCACTCcACCTCTTTAGCT-3′; −1306T, 5′-ACCCAGCACTCtACCTCTTTAGCT-3′; −955C, 5′-TGCCATGGCATTTATAcACTGCCA-3′; −955A, 5′-TGCCATGGCATTTATAaACTGCCA-3′; −790T/−787T, 5′-GTGACCTCTATCtTAtTAAACCAG-3′; −790G/−787T, 5′-GTGACCTCTATCgTAtTAAACCAG-3′; −790T/−787G, 5′-GTGACCTCTATCtTAgTAAACCAG-3′; 790G/−787G, 5′-GTGACCTCTATCgTAgTAAACCAG-3′; −168G, 5′-AGGCGGCCGGGgAAAAGAGGTGGA-3′; −168T, 5′-AGGCGGCCGGGtAAAAGAGGTGGA-3′; +220G, 5′-ACCAGGCGGCGAgGCGGCCACACG-3′; and +220C, 5′-ACCAGGCGGCGAcGCGGCCACACG-3′. Additionally, a PCR-based approach was used to generate a construct encompassing −1691 to +10 of the human MMP-2 promoter. 5′-HindIII and 3′-XhoI cloning sites were included in the forward and reverse primers, respectively. To obtain the −1691/+10 DNA fragment, the oligonucleotide sequence −1691/−1671 (5′-GTCAAAGCTTA-AAACTGACTCTGGAAAGTCA-3′) and −11/+10 (5′-GTCACTCGAGTCTGGATGCAGCGGAAACAAG-3′) were used in the PCR in combination with PfuTurbo polymerase to ensure high fidelity amplification. The PCR product was digested with HindIII andXhoI and ligated into an appropriately digested pGL3-Basic vector. The resulting construct was designated as p1306T because sequence analysis demonstrated that it contains a thymine at the −1306 polymorphic site. Subsequently, p1306T acted as a template to generate a construct with a thymine to cytosine point mutation at the −1306 position, assigned p1306C, using the QuikChangeTMSite-directed Mutagenesis Kit (Stratagene), according to the manufacturer's instructions. All constructs used in this study were restriction-mapped and sequenced to confirm their authenticity. The RAW264.7, A10, and 293 cell lines were obtained from the Sir William Dunn School of Pathology Cell Bank, and reagents were purchased from Life Technologies, Inc. Cells were grown in RPMI 1640 (RAW264.7) or Dulbecco's modified Eagle's medium (A10 and 293) supplemented with 10% (v/v) heat-inactivated fetal calf serum, 2 mmglutamine, and antibiotics at 37 °C and 5% CO2 in a humidified incubator. For transient transfection experiments, 5 × 104 cells were plated in 10-mm 24-multiwell plates and grown to 60–70% confluence. Transfection was carried out using FuGENE™ 6 Transfection Reagent (Roche Molecular Biochemicals) according to the manufacturer's protocol. Cells were cotransfected with 0.5 μg of reporter plasmid and 0.1 μg of pcDNA3-β-galactosidase expression vector (30Quinn C.M. Wiles A.P. El Shanawany T. Catchpole I. Alnadaf T. Ford M.J. Gordon S. Greaves D.R. Genomics. 1999; 62: 468-476Crossref PubMed Scopus (15) Google Scholar) to standardize for transfection efficiency. Cells were incubated for 24 h, washed twice in phosphate-buffered saline, and harvested by the addition of 100 μl of lysis buffer (Luciferase Assay System, Promega). Luciferase levels were quantified using a Luminoskan Ascent Luminometer (Labsystems), and β-galactosidase activities were measured using a commercially available ELISA kit (Roche Molecular Biochemicals). All experiments were carried out in triplicate and independently performed at least three times. Results were expressed as a ratio of luciferase activity to β-galactosidase activity, and statistical levels of significance, for comparison between transfections, were determined by the Student's t test. Mammalian expression vectors containing wild-type and mutant murine GATA-1 were a kind gift from Dr. Sjaak Philipsen (Erasmus University, Rotterdam, The Netherlands). Nuclear extracts were prepared as described previously (31Cowan P.J. Tsang D. Pedic C.M. Abbott L.R. Shinkel T.A. d'Apice A.J. Pearse M.J. J. Biol. Chem. 1998; 273: 11737-11744Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). EMSAs were performed using the following double-stranded oligonucleotides as probes: −1306C, 5′-ACCCAGCACTCCACCTCTTTAGCT-3′; −1306T, 5′-ACCCAGCACTCTACCTCTTTAGCT-3′; and Sp1cons, 5′-ATTCGATCGGGGCGGGGCGAGC-3′. 0.25 ng of32P-end-labeled oligonucleotide (>30,000 cpm) was incubated for 20 min at room temperature with 10 μg of nuclear extract in a 20-μl reaction volume containing 40 mm Hepes (pH 7.9), 12.5% glycerol, 1 mm EDTA, 2 μg of poly(dI-dC), 0.1 μg of bovine serum albumin, and 0.2 μg of sheared salmon sperm. For competition experiments, a 50–100-fold molar excess of unlabeled double-stranded oligonucleotide containing either cold probe, an Sp1-mutant consensus site (5′-ATTCGATCGGTTCGGGGCGAGC-3′), or a nonspecific oligonucleotide (5′-GAGCGCATACTGACTATCGGAGAC-3′) was preincubated for 10 min at room temperature with the nuclear extracts prior to the addition of labeled probe. For supershift experiments, antibodies raised against Sp1 (sc-59X), AP-2 (sc-184X), RANTES (sc-1410), and control rabbit IgG were purchased, with Sp1-blocking peptide (sc-59P), from Santa Cruz Biotechnology. Antibody (2 μg), or antibody-blocking peptide complex, was incubated with nuclear extracts at 4 °C for 30 min, followed by an additional incubation for 20 min at room temperature with labeled oligonucleotide. Samples were run on a nondenaturing 7% polyacrylamide gel in 0.25× TBE, at 250 V for 2–3 h. Dried gels were exposed overnight to Kodak X-Omat film at −80 °C. To generate additional sequence data for variant analysis, an extended promoter region of the human MMP-2 gene was isolated. Nested MMP-2-specific primers were used with adaptor primers to amplify the promoter from five adaptor-ligated human genomic libraries. The DraI,SspI, and ScaI libraries yielded products of 1.7, 4.1, and 6.0 kb, respectively, that were cloned and analyzed by restriction enzyme mapping. The DNA sequence extending 1900 bp upstream of the major transcription start site (28Huhtala P. Chow L.T. Tryggvason K. J. Biol. Chem. 1990; 265: 11077-11082Abstract Full Text PDF PubMed Google Scholar) was determined, and 11 overlapping amplicons were designed for DHPLC analysis. Additional intronic sequence was generated to that available (28Huhtala P. Chow L.T. Tryggvason K. J. Biol. Chem. 1990; 265: 11077-11082Abstract Full Text PDF PubMed Google Scholar) by sequencing introns, isolated as PCR products, and the information obtained was used to design appropriate primers for DHPLC analysis to evaluate the extent of genetic variation at MMP-2 splice-site junctions. Thirty four different PCR primer pairs, encompassing the promoter sequence (1900 bp), 5′-UTR, complete coding region, and 3′-UTR, were designed to assess the nature and extent of nucleotide variation in the human MMP-2 gene (see TableI). Amplicons were generated from a panel of 32 unrelated healthy Caucasian individuals. This number was chosen to provide >90% power to detect polymorphisms with an allele frequency of >5% (21Risch N. Merikangas K. Science. 1996; 273: 1516-1517Crossref PubMed Scopus (4270) Google Scholar), on the basis that common variants were the principal target of this screen. PCR products were applied to the DHPLC column and subjected to partial heat denaturation, over a 6.8-min interval, to produce sequence-specific chromatograms. Elution profiles were compared with each other, with double or multiple peak patterns indicating the presence of polymorphic site(s) (Fig.1). The nature and location of variants were determined by dye-terminator sequencing. By using this approach, a total of 15 novel sequence variants were identified in the MMP-2 gene. All variants were single base substitutions, comprising seven transversions and eight transitions distributed throughout the gene with six variants in the promoter, one in the 5′-UTR, six in the coding region, one in intervening sequence, and one in the 3′-UTR (Fig. 2). The majority of coding region variants (Fig.2 A) results in synonymous substitutions; however, the G → A transition at cDNA position 1646 causes a nonconservative amino acid change from glycine to serine (G456S). This amino acid is situated in the hinge region of the protein, which links the catalytic domain to the hemopexin-like domain, and is believed to be important in the targeting of substrates (32Imper V. Van Wart H.E. Parks W.C. Mecham R.P. Matrix Metalloproteinases. Academic Press, Inc., San Diego, CA1998: 219-242Crossref Google Scholar). Clustal alignment revealed that Gly-456 is conserved across species (chicken, rabbit, rat, and mouse) demonstrating the importance of this small neutral residue and signifying the potential impact that a substitution to a larger hydrophilic amino acid may have upon enzymatic activity/substrate specificity. We are currently undertaking in vitro studies to address possible functional effects of this variant. We identified one intronic sequence variant in intron 5, located 11 bp downstream of the intron start site. This does not map to known splice-site junction consensus sequences and is therefore unlikely to affect mRNA splicing patterns. We also identified a common A → C transversion in the 3′-UTR of the gene (nt 2523). Sequence analysis established that this variant does not lie within, or in close proximity to, adenylate/uridylate-rich elements that are known to be bound by families of proteins implicated in the regulation of mRNA stability (33Mitchell P. Tollervey D. Curr. Opin. Genet. & Dev. 2000; 10: 193-198Crossref PubMed Scopus (237) Google Scholar). Six variants were identified in the promoter region (four transversions and two transitions) that were evenly distributed across a ∼2-kb interval with the exception of two T → G transversions at −790 and −787 (Fig. 2 B). Sequence analysis demonstrated an error in the published sequence (27Bian J. Sun Y. Mol. Cell. Biol. 1997; 17: 6330-6338Crossref PubMed Scopus (249) Google Scholar) with the AG dinucleotide reported at position −1569 actually being the G → A polymorphism at −1575 (allowing for the different transcription start sites mapped in these studies). To determine whether variants created or abolished potentialcis-acting elements, we used the TRANSFAC data base (34Heinemeyer T. Wingender E. Reuter I. Hermjakob H. Kel A.E. Kel O.V. Ignatieva E.V. Ananko E.A. Podkolodnaya O.A. Kolpakov F.A. Podkolodny N.L. Kolchanov N.A. Nucleic Acids Res. 1998; 26: 362-367" @default.
• W2045882503 created "2016-06-24" @default.
• W2045882503 creator A5033758288 @default.
• W2045882503 creator A5062457146 @default.
• W2045882503 creator A5064842155 @default.
• W2045882503 date "2001-03-01" @default.
• W2045882503 modified "2023-10-17" @default.
• W2045882503 title "Identification of Novel, Functional Genetic Variants in the Human Matrix Metalloproteinase-2 Gene" @default.
• W2045882503 cites W1507020270 @default.
• W2045882503 cites W1567487285 @default.
• W2045882503 cites W1824808675 @default.
• W2045882503 cites W1964871265 @default.
• W2045882503 cites W1976831807 @default.
• W2045882503 cites W1977127210 @default.
• W2045882503 cites W1978837916 @default.
• W2045882503 cites W1989539292 @default.
• W2045882503 cites W1994158075 @default.
• W2045882503 cites W2001230231 @default.
• W2045882503 cites W2005285972 @default.
• W2045882503 cites W2005999235 @default.
• W2045882503 cites W2007672220 @default.
• W2045882503 cites W2013256513 @default.
• W2045882503 cites W2028662837 @default.
• W2045882503 cites W203419568 @default.
• W2045882503 cites W2042103448 @default.
• W2045882503 cites W2046056761 @default.
• W2045882503 cites W2049220062 @default.
• W2045882503 cites W2051088799 @default.
• W2045882503 cites W2055774593 @default.
• W2045882503 cites W2057576736 @default.
• W2045882503 cites W2060761177 @default.
• W2045882503 cites W2065901679 @default.
• W2045882503 cites W2071094106 @default.
• W2045882503 cites W2072103796 @default.
• W2045882503 cites W2073003782 @default.
• W2045882503 cites W2074754379 @default.
• W2045882503 cites W2075748014 @default.
• W2045882503 cites W2076718353 @default.
• W2045882503 cites W2077923251 @default.
• W2045882503 cites W2078888764 @default.
• W2045882503 cites W2080053060 @default.
• W2045882503 cites W2083535354 @default.
• W2045882503 cites W2084144722 @default.
• W2045882503 cites W2089019735 @default.
• W2045882503 cites W2089126365 @default.
• W2045882503 cites W2096007233 @default.
• W2045882503 cites W2097846180 @default.
• W2045882503 cites W2118375178 @default.
• W2045882503 cites W2122374538 @default.
• W2045882503 cites W2133861999 @default.
• W2045882503 cites W2143229158 @default.
• W2045882503 cites W2148191159 @default.
• W2045882503 cites W2151625863 @default.
• W2045882503 cites W2152639592 @default.
• W2045882503 cites W2155093913 @default.
• W2045882503 cites W2160782760 @default.
• W2045882503 cites W314786035 @default.
• W2045882503 cites W4254753097 @default.
• W2045882503 doi "https://doi.org/10.1074/jbc.m010242200" @default.
• W2045882503 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11114309" @default.
• W2045882503 hasPublicationYear "2001" @default.
• W2045882503 type Work @default.
• W2045882503 sameAs 2045882503 @default.
• W2045882503 citedByCount "373" @default.
• W2045882503 countsByYear W20458825032012 @default.
• W2045882503 countsByYear W20458825032013 @default.
• W2045882503 countsByYear W20458825032014 @default.
• W2045882503 countsByYear W20458825032015 @default.
• W2045882503 countsByYear W20458825032016 @default.
• W2045882503 countsByYear W20458825032017 @default.
• W2045882503 countsByYear W20458825032018 @default.
• W2045882503 countsByYear W20458825032019 @default.
• W2045882503 countsByYear W20458825032020 @default.
• W2045882503 countsByYear W20458825032021 @default.
• W2045882503 countsByYear W20458825032022 @default.
• W2045882503 countsByYear W20458825032023 @default.
• W2045882503 crossrefType "journal-article" @default.
• W2045882503 hasAuthorship W2045882503A5033758288 @default.
• W2045882503 hasAuthorship W2045882503A5062457146 @default.
• W2045882503 hasAuthorship W2045882503A5064842155 @default.
• W2045882503 hasBestOaLocation W20458825031 @default.
• W2045882503 hasConcept C104317684 @default.
• W2045882503 hasConcept C109523444 @default.
• W2045882503 hasConcept C116834253 @default.
• W2045882503 hasConcept C2910007452 @default.
• W2045882503 hasConcept C54355233 @default.
• W2045882503 hasConcept C55728118 @default.
• W2045882503 hasConcept C59822182 @default.
• W2045882503 hasConcept C70721500 @default.
• W2045882503 hasConcept C86803240 @default.
• W2045882503 hasConceptScore W2045882503C104317684 @default.
• W2045882503 hasConceptScore W2045882503C109523444 @default.
• W2045882503 hasConceptScore W2045882503C116834253 @default.
• W2045882503 hasConceptScore W2045882503C2910007452 @default.
• W2045882503 hasConceptScore W2045882503C54355233 @default.
• W2045882503 hasConceptScore W2045882503C55728118 @default.
• W2045882503 hasConceptScore W2045882503C59822182 @default.
• W2045882503 hasConceptScore W2045882503C70721500 @default.

• next