FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2045971982> ?p ?o ?g. }

• W2045971982 endingPage "23685" @default.
• W2045971982 startingPage "23676" @default.
• W2045971982 abstract "With increasing interest on mucins as diagnostic and therapeutic targets in cancers and other diseases, it is becoming imperative to characterize novel mucins and investigate their biological significance. Here, we present the completed coding sequence and genomic organization of the previously published partial cDNA sequence of MUC17. Rapid amplification of cDNA ends with PCR, sequences from the Human Genome databases, and in vitro transcription/translational assays were used for these analyses. The MUC17 gene is located within a 39-kb DNA fragment between MUC12 and SERPINE1 on chromosome 7 in the region q22.1. The full-length coding sequence of MUC17 transcribes a 14.2-kb mRNA encompassing 13 exons. Alternate splicing generates two variants coding for a membrane-anchored and a secreted form. The canonical variable number of tandem repeats polymorphism of the central tandem repeat domain of the MUC genes is not significantly detected in the MUC17 gene. In addition, we show the overexpression of MUC17 by Western blot and immunohistochemical analyses in pancreatic tumor cell lines and tumor tissues compared with the normal pancreas. The expression of MUC17 is regulated by a 1,146-bp fragment upstream of MUC17 that contains VDR/RXR, GATA, NFκB, and Cdx-2 response elements. With increasing interest on mucins as diagnostic and therapeutic targets in cancers and other diseases, it is becoming imperative to characterize novel mucins and investigate their biological significance. Here, we present the completed coding sequence and genomic organization of the previously published partial cDNA sequence of MUC17. Rapid amplification of cDNA ends with PCR, sequences from the Human Genome databases, and in vitro transcription/translational assays were used for these analyses. The MUC17 gene is located within a 39-kb DNA fragment between MUC12 and SERPINE1 on chromosome 7 in the region q22.1. The full-length coding sequence of MUC17 transcribes a 14.2-kb mRNA encompassing 13 exons. Alternate splicing generates two variants coding for a membrane-anchored and a secreted form. The canonical variable number of tandem repeats polymorphism of the central tandem repeat domain of the MUC genes is not significantly detected in the MUC17 gene. In addition, we show the overexpression of MUC17 by Western blot and immunohistochemical analyses in pancreatic tumor cell lines and tumor tissues compared with the normal pancreas. The expression of MUC17 is regulated by a 1,146-bp fragment upstream of MUC17 that contains VDR/RXR, GATA, NFκB, and Cdx-2 response elements. Mucins, the main components of the mucus, are high molecular weight O-glycoproteins expressed and secreted by epithelial cells and, in some cases, by endothelial cells (1Hollingsworth M.A. Swanson B.J. Nat. Rev. Cancer. 2004; 4: 45-60Crossref PubMed Scopus (1363) Google Scholar, 2Moniaux N. Escande F. Porchet N. Aubert J.P. Batra S.K. Front. Biosci. 2001; 6: D1192-D1206Crossref PubMed Google Scholar). Their principal function is to protect and lubricate the epithelial surfaces; however (1Hollingsworth M.A. Swanson B.J. Nat. Rev. Cancer. 2004; 4: 45-60Crossref PubMed Scopus (1363) Google Scholar), recent reports also demonstrate that mucins and, more specifically, membrane-bound mucins have a role in the signal transduction and oncogenic processes (1Hollingsworth M.A. Swanson B.J. Nat. Rev. Cancer. 2004; 4: 45-60Crossref PubMed Scopus (1363) Google Scholar, 3Moniaux N. Andrianifahanana M. Brand R.E. Batra S.K. Br. J. Cancer. 2004; 91: 1633-1638Crossref PubMed Scopus (116) Google Scholar, 4Singh A.P. Moniaux N. chauhan S.C. Meza J.L. Batra S.K. Cancer Res. 2004; 64: 622-630Crossref PubMed Scopus (212) Google Scholar). Presently, 20 mucin (MUC) 3The abbreviations used are: MUC, mucin; EGF, epidermal growth factor; RACE, rapid amplification of cDNA ends; RT, reverse transcription; TR, tandem repeat; VNTR, variable number of tandem repeats. 3The abbreviations used are: MUC, mucin; EGF, epidermal growth factor; RACE, rapid amplification of cDNA ends; RT, reverse transcription; TR, tandem repeat; VNTR, variable number of tandem repeats. genes have been identified and are named MUC1–2, MUC3A/B, MUC4, MUC5AC, MUC5B, MUC6 –13, and MUC15–20 (2Moniaux N. Escande F. Porchet N. Aubert J.P. Batra S.K. Front. Biosci. 2001; 6: D1192-D1206Crossref PubMed Google Scholar, 5Gum Jr., J.R. Crawley S.C. Hicks J.W. Szymkowski D.E. Kim Y.S. Biochem. Biophys. Res. Commun. 2002; 291: 466-475Crossref PubMed Scopus (167) Google Scholar, 6Higuchi T. Orita T. Nakanishi S. Katsuya K. Watanabe H. Yamasaki Y. Waga I. Nanayama T. Yamamoto Y. Munger W. Sun H.W. Falk R.J. Jennette J.C. Alcorta D.A. Li H. Yamamoto T. Saito Y. Nakamura M. J. Biol. Chem. 2004; 279: 1968-1979Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 7O'Brien T.J. Beard J.B. Underwood L.J. Dennis R.A. Santin A.D. York L. Tumour Biol. 2001; 22: 348-366Crossref PubMed Scopus (232) Google Scholar, 8Yin B.W. Lloyd K.O. J. Biol. Chem. 2001; 276: 27371-27375Abstract Full Text Full Text PDF PubMed Scopus (484) Google Scholar). These mucins have been grouped into two subfamilies, the secreted and the membrane-bound. The secreted mucins are exclusively expressed by specialized epithelial cells and exhibit a restricted pattern of expression within the human body (1Hollingsworth M.A. Swanson B.J. Nat. Rev. Cancer. 2004; 4: 45-60Crossref PubMed Scopus (1363) Google Scholar, 2Moniaux N. Escande F. Porchet N. Aubert J.P. Batra S.K. Front. Biosci. 2001; 6: D1192-D1206Crossref PubMed Google Scholar). The membrane-bound mucins are expressed at the apical region of epithelial cells under normal conditions and have a wide expression (1Hollingsworth M.A. Swanson B.J. Nat. Rev. Cancer. 2004; 4: 45-60Crossref PubMed Scopus (1363) Google Scholar, 2Moniaux N. Escande F. Porchet N. Aubert J.P. Batra S.K. Front. Biosci. 2001; 6: D1192-D1206Crossref PubMed Google Scholar). Moreover, alternative splicing and proteolytic cleavage can lead to the generation of three distinct forms of the transmembrane mucins, such as soluble (proteolytic cleavage of the membrane-bound form), secreted (alternatively splice variants), and one lacking the tandem repeat domain (alternatively spliced variants) (9Baruch A. Hartmann M. Zrihan-Licht S. Greenstein S. Burstein M. Keydar I. Weiss M. Smorodinsky N. Wreschner D.H. Int. J. Cancer. 1997; 71: 741-749Crossref PubMed Scopus (82) Google Scholar, 10Choudhury A. Moniaux N. Winpenny J.P. Hollingsworth M.A. Aubert J.P. Batra S.K. J. Biochem. (Tokyo). 2000; 128: 233-243Crossref PubMed Scopus (68) Google Scholar, 11Choudhury A. Moniaux N. Ringel J. King J. Moore E. Aubert J.P. Batra S.K. Teratog. Carcinog. Mutagen. 2001; 21: 83-96Crossref PubMed Scopus (33) Google Scholar, 12Crawley S.C. Gum J.R.J. Hicks J.W. Pratt W.S. Aubert J.P. Swallow D.M. Kim Y.S. Biochem. Biophys. Res. Commun. 1999; 263: 728-736Crossref PubMed Scopus (68) Google Scholar). The ratio of one form to another shows tissue specificity and is associated with the physiologic condition (13Moniaux N. Escande F. Batra S.K. Porchet N. Laine A. Aubert J.P. Eur. J. Biochem. 2000; 267: 4536-4544Crossref PubMed Scopus (88) Google Scholar, 14Obermair A. Schmid B.C. Stimpfl M. Fasching B. Preyer O. Leodolter S. Crandon A.J. Zeillinger R. Gynecol. Oncol. 2001; 83: 343-347Abstract Full Text PDF PubMed Scopus (24) Google Scholar).MUC17, a membrane-bound mucin, was recently identified and located in the mucin cluster at the chromosomal locus, 7q22 along with MUC3A/B, MUC11, and MUC12 mucins (5Gum Jr., J.R. Crawley S.C. Hicks J.W. Szymkowski D.E. Kim Y.S. Biochem. Biophys. Res. Commun. 2002; 291: 466-475Crossref PubMed Scopus (167) Google Scholar, 15Williams S.J. McGuckin M.A. Gotley D.C. Eyre H.J. Sutherland G.R. Antalis T.M. Cancer Res. 1999; 59: 4083-4089PubMed Google Scholar, 16Pratt W.S. Islam I. Swallow D.M. Ann. Hum. Genet. 1996; 60: 21-28Crossref PubMed Scopus (27) Google Scholar). The first partial length cDNA sequence, now known to correspond to MUC17, was identified by Van Klinken et al. (17Van Klinken B.J. Van Dijken T.C. Oussoren E. Buller H.A. Dekker J. Einerhand A.W. Biochem. Biophys. Res. Commun. 1997; 238: 143-148Crossref PubMed Scopus (23) Google Scholar), who reported five tandem repeats, each encoding 59 amino acid residues, located upstream of the 17 tandem repeat residues of MUC3. Both sequences, repeated in tandem, were identified on the same cDNA fragment. However, after the characterization of the full-length sequence of MUC3A and MUC3B, the clone isolated by Van Klinken appeared as a chimera cDNA fragment, composed with an unknown gene sequence fused to the MUC3 tandem repeat sequence. In 2002, driven with the hypothesis that the five 59-amino acid residue tandem repeat sequences were part of a new unidentified mucin, Gum et al. (5Gum Jr., J.R. Crawley S.C. Hicks J.W. Szymkowski D.E. Kim Y.S. Biochem. Biophys. Res. Commun. 2002; 291: 466-475Crossref PubMed Scopus (167) Google Scholar) screened the public GenBank™ data base and the proprietary Lifeseq Gold data base (Incyte Genomics, Inc., Palo Alto, CA) and identified the 59-amino acid tandem repeat downstream sequence. The authors reported a partial cDNA fragment of 3,803 bp (accession number AF430017) composed of five repetitions of a 177-bp motif upstream of a non-repetitive sequence. The deduced amino acid sequence presented characteristics of membrane-bound mucin with the presence of five repetitions of the 59-amino acid residue motif, followed by two EGF-like domains, an/a SEA domain, a hydrophobic transmembrane domain, and an 80-amino acid long cytoplasmic tail. The new mucin gene, called MUC17, was localized to chromosome locus 7q22 along with MUC3A/B and MUC11/12.Herein, we report the complete characterization of the MUC17 gene and its transcripts along with the deduced structural organization of the protein. Our study shows that MUC17 is expressed in at least two alternatively spliced forms encoding for membrane-bound and -secreted forms. Moreover, inter-individual VNTR polymorphism is also observed, giving rise to three allelic forms. Furthermore, we report that the intergenic region (1146 bp) between MUC12 and MUC17 possesses both basic and enhancer regulatory elements and may be responsible for cell-specific regulation of MUC17. A differential expression profile of MUC17 was observed in pancreatic tumors compared with the normal pancreas.MATERIALS AND METHODSTissue Specimens and Cell Lines—A total of 24 established cancer cell lines (pancreas, colon, and breast) were used as sources of genomic DNA. Additionally, four genomic DNA samples were extracted from peripheral blood mononuclear cells of healthy individuals to validate the results obtained using the cancer cell lines. Samples were collected under protocol approved by the Institutional Review Board at the University of Nebraska Medical Center, Omaha, NE. Informed consent was obtained from all subjects.5′-Rapid Amplification of cDNA Ends PCR—The 5′-RACE kit (Roche Applied Science) was used to synthesize first-strand cDNA from total AsPC-1 cell line RNA (2 μg) with specific MUC17 primer (RACE 171, GTGATAGCCTCTGAACTGGCC). Terminal transferase was used to add a poly(dA) tail to the 5′-end of the cDNA. RACE-PCR experiments were performed in 50-μl reaction volumes containing 5 μl of 10× buffer (100 mm Tris/HCl/15 mm MgCl2/500 mm KCl, pH 8.3), 5 μl of 10 mm deoxynucleoside triphosphates, 5 μl of poly(dA)-tailed cDNA, 0.2 μm of each primer (MUC17-specific RACE 172, CATGGTGCTGGCAGGCATACT), oligo(dT)-anchor primer (provide by the RACE Kit supplier), and 2 units of Taq DNA polymerase (MBI Fermentas, Hanover, MD). The mixture was denatured at 94 °C for 2 min, followed by 30 cycles at 94 °C for 30 s, 60 °C for 1 min, and 72 °C for 2 min. The final elongation step was a 15-min extension. A 1-μl amplification product was further amplified by a second PCR reaction using a MUC17-specific nested primer (RACE 173, GTAGGAGATGAACTTGCCTGA) and the PCR anchor primer (provided by the supplier). PCR products were electrophoretically resolved on 1% agarose gels and stained with ethidium bromide. Photographs were taken under UV light, using the GelExpert software (Nucleotech, San Carlos, CA). Amplification products were excised and purified with the QIAquick® gel extraction kit (Qiagen, Valencia, CA), cloned into pCR®2.1 vector (Invitrogen), and sequenced.Expand Long Template PCR—To identify potential MUC17 splice variants in the 3′-extremity, an RT-PCR reaction was performed using the Expand Long Template PCR system (Roche Applied Science) with sense (5′-CTGTGCCAAGAACCACAACAT-3′) and antisense primers (5′-CTCCTCACTCCCAGACTTCTC-3′). Expand Long Template PCR was performed in 50-μl reaction volumes containing 5 μl of AsPC-1 cDNA, 5 μl of 10× buffer 3, 2.5 μl of 40 mm deoxynucleoside triphosphates, 0.2 μm of each primer, 0.75 mm MgCl2, and 2.5 units of polymerase mixture (Roche Applied Science). The reaction mixture was denatured at 94 °C for 2 min, followed by 30 cycles at 94 °C for 30 s, 60 °C for 1 min, and 68 °C for 4 min with the elongation time of the last 20 cycles extended 40 s for each cycle. The final elongation step was extended for an additional 30-min period. The amplification product was directly cloned into the pCR®2.1 vector (Invitrogen), amplified, and sequenced.In Vitro Transcription and Translation Assays—An amplification product was generated using forward primer 5′-GCCAGCTCCTCTGGGGTGAC-3′ and reverse primer RACE 171 (described previously). The product was cloned in pCR®2.1 under control of the T7 promoter. The DNA contained a coding region for a peptide with a predicted size of 36 kDa preceded by a putative Kozak sequence, followed by an ATG as well as 25-residue N-terminal signal sequence. Transcription and translation experiments were performed with the TnT® Quick Coupled Transcription/Translation System (Promega, Madison, WI) according to the manufacturer's instructions. The amino acid mixture containing [35S]methionine (1000 Ci/mmol) was used for in vitro translation, and the product was analyzed by SDS-PAGE. Negative controls consisted of a MUC17 sequence cloned in the opposite direction and an empty vector. The β-lactamase gene was used as a positive control as recommended by the supplier.Southern Blot Analysis—Genomic DNA, isolated from the 24 human tumor cell lines and peripheral blood mononuclear cells, from four healthy individuals, was digested with EcoRI and HindIII restriction endonucleases. Digested products were resolved by electrophoresis in 0.8% agarose gels and transferred to nylon membranes. Membranes were hybridized with a MUC17 tandem repeat probe. The probe (3 kb) was generated by PCR amplification using the MUC17-TR forward: GATATGAGCACACCTCTGACC and MUC17-TR reverse: ATGTTGTGGTTCTTGGCACAG primers, cloned in pCR®2.1, and sequenced before use. The probe was radiolabeled using the Random Primers DNA Labeling System (Invitrogen) and α-[32P]dCTP (MP Biomedicals, Irvine, CA).Assay of Transcriptional and Enhancer Activities—Transient transfections of MUC17 promoter/enhancer luciferase reporter constructs were performed using the pGL3-basic and -enhancer vectors (Promega). Five constructs overlapping exon 11 of MUC12 to the MUC17 5′-untranslated region were prepared using AsPC-1 DNA. For transfections, cells were seeded into 6-well plates, in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. Transfections were carried out using Lipofectamine (Invitrogen) according to the manufacturer's instructions. Transfection conditions were optimized for each cell line. Cells were co-transfected with pSV-βGal vector (Promega) to control for variation in the transfection efficiency by assaying and normalizing data for β-galactosidase activity. After 2 days, cell lysates were made in reporter lysis buffer (Promega), and luciferase activity was determined using a Luciferase Reporter Assay System (Promega). Results were presented as -fold changes in luciferase activity as compared with the empty vector-transfected control cells.RESULTSIdentification and Characterization of the Central Repetitive Domain of MUC17—To extend the MUC17 sequence toward its 5′-extremity, the known repeated 177-bp motif (characteristic of the tandem repeat array of MUC17), was positioned on the sequence corresponding to the chromosomal locus 7q22 using the map viewer interface of the human genome resources data base (National Center of Biotechnology Information, Bethesda, MD). The MUC17 sequence was localized to the BAC clone RP11–395B7 (accession number AC105446). Altogether, the RP11–395B7 clone contained 60 repetitions of the 177-bp motif, directly downstream of 600 bp of degenerated repetitive sequence.The characteristics of MUC17 central domain i.e. length and VNTR polymorphism, were investigated by Expand Long RT-PCR and Southern blot analysis. Expand Long PCR that allows amplification of a large DNA fragment (up to 30 kb) was performed on AsPC-1 cDNA using sense and antisense primers that recognize both extremities of the MUC17 tandem-repeat domain (Fig. 1A). The amplification product was resolved on a 0.8% agarose gel. Numerous amplification products were detected ranging from 1.5 to 8 kb (Fig. 1B), which were expected due to the repetitive nature of the amplified sequence. The largest amplification product detected, with a molecular size of 8 kb, should represent 45 repetitions of the 177-bp motif. No amplification product was, however, detected with a size of 10.8 kb, which is the expected size for the full-length tandem repeat domain.Analysis of the BAC RP11–395B7 sequence suggested the presence of a HindIII site at 5434 bp upstream of the tandem repeat array and an EcoRI site at 1128 bp downstream of the repetitive sequence, encompassing a fragment of 17.4 kb (Fig. 1A).Genomic DNA, purified from 24 cancer cell lines (pancreas, colon, and breast) and from four healthy individuals, was digested with Hin-dIII and EcoRI endonucleases and probed with a MUC17 tandem repeat-specific probe. The 3-kb amplification product shown in Fig. 1B was cloned in PCR2.1 vector, sequenced, and used as a probe in Southern blot analysis on 28 genomic DNA samples. The probe contained 17 repetitions of the 177-bp motif. A low degree of VNTR polymorphism was observed, with only three bands detected with an approximate size of 17 kb (Fig. 1C). The size of the bands detected was consistent with the size of tandem repeats observed in the BAC clone (RP11–395B7) sequence which contained 60 repetitions of the 177-bp motif. These three bands were considered to result from various allelic forms of MUC17 (alleles A, B, and C), exhibiting VNTR polymorphism. Of the 24 cancer cell lines and 4 control DNA samples, 22 were homozygous for MUC17. Two cell lines have the allelic form A (higher molecular weight), whereas the remaining 20 cell lines have the allelic form B (intermediate molecular weight). None of the cell lines have the allelic form C. Of the remaining six samples heterozygous for MUC17, allelic form B was common in all samples. Four of six samples were heterozygous with the allelic forms A and B, whereas the two other samples were heterozygous with the allelic forms B and C (lower molecular weight). The frequency of the allelic forms was 14.3% for the allele A, 82.1% for the allele B, and 3.6% for the allele C.The average size of each allelic form (∼17.0 kb) made it difficult to precisely measure which one is composed of 60 repetitions of the 177-bp motif. To answer this question, sequences within the NCBI, ENSEMBL, and USCS browser were analyzed. The MUC17 sequence reported in both NCBI and ENSEMBL browsers are based on the RP11–395B7 BAC clone. The USCS MUC17 sequence is based on the sequence with accession number AJ606307 as referred to in the current report. Therefore, we cannot precisely assign one of the three allelic forms to the allele containing the 60 repetitions of 177 bp.Identification and Characterization of the 5′-Extremity and Genomic Organization of MUC17—Combining the information deduced from the BAC clone RP11–395B7 sequence and the partial cDNA sequence of MUC17 (AF430017), the MUC17 gene was precisely located at chromosome 7 in the region q22.1, oriented from centromere to telomere, between the MUC12 and the SERPINE1 (serine proteinase inhibitor) genes (Fig. 2A). The 5′-RACE-PCR was performed on total RNA from AsPC-1, a pancreatic adenocarcinoma cell line that expresses a high level of MUC17, using three antisense primers localized in the degenerate sequence upstream of the tandem repeat array (sequence given under “Materials and Methods”). Several amplification products were detected with size varying from 100 to 1000 bp for the first PCR, and from 200 to 700 bp after nested PCR (Fig. 3A). The detection of several amplification products during the 5′-RACE-PCR was expected for two main reasons. First, the MUC17-specific primers were localized in the degenerate sequence upstream of the tandem repeat array. Second, the size of the amplification products is directly dependent on the reverse transcription efficiency that gives rise to a multitude of cDNAs (partial or full copy of the mRNAs). Of these fragments, the largest cloned cDNA fragment (653 bp size) was sequenced. Its 3′-end overlapped the 5′-extremity of the degenerate repetition located upstream of the tandem repeat array. Comparison of the 5′-end of the RACE-PCR product with sequence of the BAC RP11–395B7 clone led to the identification of two new exons. The compiled nucleotide sequences of the RACE-PCR clone, the 177-bp tandem repeat of the BAC RP11–395B7, and the sequence identified and characterized by Gum et al. (AF430017) (5Gum Jr., J.R. Crawley S.C. Hicks J.W. Szymkowski D.E. Kim Y.S. Biochem. Biophys. Res. Commun. 2002; 291: 466-475Crossref PubMed Scopus (167) Google Scholar) allowed us to establish the complete organization of MUC17 (Fig. 2, B and C). This sequence has been deposited in EMBL (European Molecular Biology Laboratorie's Heidelberg, Germany) data base (AJ606307).FIGURE 2MUC17 structural organization. A, MUC17 is clustered with MUC3, MUC11, and MUC12 on chromosome 7 in the region q22. MUC17 is oriented from centromere to telomere, following MUC3 and MUC12. B, MUC17 encompasses 13 exons and is localized to a 39-kb genomic DNA fragment between MUC12 and SER-PINE1. Its first exon is located 1146 bp from the last exon of MUC12. The black triangle, positioned in exon 7, denotes its alternative splice site. C, MUC17 mRNA is 14,221 bp long and codes for a membrane-bound mucin. Its central domain contains 60 repetitions of a 59-amino acid motif repeated in tandem with residues rich in serine, threonine, and proline. A 25-amino acid signal peptide is found in the N-terminal extremity. The middle part of C presents the different sequences that were aligned to get the full-length sequence of MUC17. D, an alternative splice event occurs and skips exon 7 coding for a secreted form of MUC17, MUC17/SEC. MUC17/SEC lacks the MUC17 non-repetitive sequence located just upstream of the second EGF-like domain, as well as the second EGF-like domain, transmembrane domain, and cytoplasmic tail. The last 21 residues of the splice variant are specific to MUC17/SEC.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 3Characterization of MUC17 N-terminal sequence and the alternatively spliced form. A, AsPC-1 RNA was reverse-transcribed using RACE171 primer and was 5′-poly(dA)-tailed using terminal transferase. Amplification used MUC17-specific primers and oligo(dT)-anchor primer as described under “Materials and Methods.” The 5′-RACE and nested RACE-PCR products were run on 1% agarose gels. Amplification products ranging from 100 to 1000 bp were detected. The most intense product was subcloned in the PCR®2.1 vector. An insert of 653 bp was obtained and consisted of two exons, coding for the leader sequence and the N-terminal domain of MUC17. B, the 5′-extremity of MUC17 was cloned in the PCR®2.1 vector, placing the MUC17 Kozak and ATG sequences downstream of the T7 promoter. A transcription and translation assay was carried out using the TnT® Quick Coupled Transcription/Translation System (Promega) with negative controls (MUC17 sequence cloned in the opposite direction and an empty vector). The β-lactamase gene was used as a positive control as recommended by the supplier. An expected 36-kDa fragment was detected for the MUC17 sequence cloned in the proper orientation. C, the full-length 3′-extremity of MUC17 was amplified by PCR on AsPC-1 cDNA. Two bands were detected; the higher molecular weight band corresponded to the full-length MUC17 sequence, whereas the lower one corresponded to a newly alternatively spliced form that lacks the second EGF domain, the transmembrane domain, and cytoplasmic tail (MUC17/SEC).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Altogether, the MUC17 gene (39 kb) encodes an mRNA of up to 14,221 bp in size (due to the VNTR polymorphism) after splicing of 13 exons ranging in size from 61 to 12,185 bp (Table 1). The size of the introns ranges from 121 to 10,902 bp. The largest exon, E3, encodes the central domain and is composed of 60 repetitions of a 177-bp tandemly repeated motif. This exon codes for the main O-glycosylated domain of MUC17. Exon 1 (E1) of MUC17 is located 1,146 bp downstream of the 3′-extremity of the last MUC12 exon. The position of MUC17 E1 was further confirmed by PCR amplification on AsPC-1 genomic DNA using a forward primer located in the MUC12 last exon and a reverse primer located in the first MUC17 exon (data not shown). The similar amplification performed on AsPC-1 RNA (cDNA) did not allow us to detect any amplification product, showing that MUC12 and MUC17 genes are transcriptionally independent. Exon1 of MUC17 contains the 5′-untranslated region and sequence coding for the MUC17 signal peptide.TABLE 1Characteristics of the exon-intron junctions of the MUC17 geneProtein domainExon5′-Splice donorIntron3′-Splice acceptorNo.SizeNamePositionSizeClassbpbp5′-UTR, leader sequence1136ACAAGGgtgagtgacc1136-137109023tctctttcagACCTCAN-terminal2101GGACAGgtaaggcaac2237-2383792tcttaaacagGTTCTGCentral312,185CAACATgtaagtgatt312456-1245741632ttccacagagGCTTTGEGF14132ACATAGgtgagtgcaa412587-125887292cccgcctcagGGCCACEGF1, SEA5129GAACAGgtaagtctgg512715-127163511tgcctttcagATGAATSEA661GCTACGgtaagtgtct5′12775-1277611013ccctcttcagTCTTGGSEA7153GCTCAGgtgaactctg612927-129289772tctttcacagACATGASEA, EGF2870CTGAAGgtaggtgata712996-129971212cccccaccagAGGACTEGF29160GTGCCTgtgagtgctc813156-1315710233cccatctcagCTGCGTTransmembrane sequence10163GAAACGgtgagcgagc913318-133191913ccatcactagGCAAAACytoplasmic tail1199GCCAAGgtattggcct1013416-1341727572cctccacaagATGATGCytoplasmic tail1277ACAAAGgtaagaaggg1113492-1349317301ctcttttcagATCCGACytoplasmic tail, 3′-UTR13755 Open table in a new tab Full-length Coding Sequence of MUC17—The translation initiation codon is located at position 54 in the sequence (AJ606307) and is preceded by non-consensus Kozak (18Kozak M. Nucleic Acids Res. 1987; 15: 8125-8148Crossref PubMed Scopus (4151) Google Scholar) sequence (AGAGCTCCGATG). A Kyte-Doolittle (19Kyte J. Doolittle R.F. J. Mol. Biol. 1982; 157: 105-132Crossref PubMed Scopus (16999) Google Scholar) hydropathy plot of the N-terminal extremity of MUC17 shows that the initial 25 residues encoded by exon 1 are very hydrophobic. Analysis using SignalP V1.1 software from the Center for Biological Sequence Analysis (Technical University of Denmark) predicted the presence of a signal peptide of 25 amino acids with a cleavage site located between positions 25 and 26 (AAAEQ). Fig. 2C shows a schematic representation of the MUC17 deduced amino acid sequence.To confirm the functionality of the potential translation initiation site, the region upstream of the tandem repeat of MUC17 was amplified by PCR and subcloned in sense orientation downstream of the T7 promoter. The resulting construct was used for an in vitro transcription/translation assay (Fig. 3B). An expected 36-kDa protein corresponding to the MUC17 N-terminal region was detected. No protein product was detected for both negative controls. As a positive control, the N-terminal extremity of the β-lactamase gene was used (provided by supplier), which produced an expected 30-kDa protein. The structure of the 5′-extremity of human MUC17 is similar to the structure of rodent Muc3 (20Shekels L.L. Ho S.B. Biochim. Biophys. Acta. 2003; 1627: 90-100Crossref PubMed Scopus (25) Google Scholar). However, the N-terminal domain for MUC17 is coded by two exons, whereas for MUC3, it is coded by a single exon. Gum et al. (5Gum Jr., J.R. Crawley S.C. Hicks J.W. Szymkowski D.E. Kim Y.S. Biochem. Biophys. Res. Commun. 2002; 291: 466-475Crossref PubMed Scopus (167) Google Scholar) showed that the degree of sequence homology between the carboxylextremity of MUC17 and mMuc3 was higher than between MUC3 and mMUC3. It is suggested that MUC17 is the structural homologue of mMuc3. Fig. 4 presents an alignment of the N termini of MUC17, MUC3, and mMuc3. No similarity was detected between MUC3 and mMuc3, but a high degree of identity exists between MUC17 and mMuc3. Their similar structural organization and high degree of identity show that MUC17 is the human homologue of mMuc3.FIGURE 4Alignment of the N-terminal sequences of human MUC17, MUC3, and mouse mMuc3 genes. Identical amino acid residues are indicated in white letters on the black background. The black ar" @default.
• W2045971982 created "2016-06-24" @default.
• W2045971982 creator A5000959667 @default.
• W2045971982 creator A5019398592 @default.
• W2045971982 creator A5027230278 @default.
• W2045971982 creator A5062913518 @default.
• W2045971982 creator A5085256777 @default.
• W2045971982 date "2006-08-01" @default.
• W2045971982 modified "2023-10-14" @default.
• W2045971982 title "Characterization of Human Mucin MUC17" @default.
• W2045971982 cites W1496993956 @default.
• W2045971982 cites W1504831414 @default.
• W2045971982 cites W1546570611 @default.
• W2045971982 cites W1548284679 @default.
• W2045971982 cites W1962959036 @default.
• W2045971982 cites W1966864407 @default.
• W2045971982 cites W1967744862 @default.
• W2045971982 cites W1970810019 @default.
• W2045971982 cites W1975304761 @default.
• W2045971982 cites W1976105576 @default.
• W2045971982 cites W1987555268 @default.
• W2045971982 cites W1989686184 @default.
• W2045971982 cites W1994353048 @default.
• W2045971982 cites W1996758448 @default.
• W2045971982 cites W2000228858 @default.
• W2045971982 cites W2001805903 @default.
• W2045971982 cites W2014947083 @default.
• W2045971982 cites W2027666932 @default.
• W2045971982 cites W2033757431 @default.
• W2045971982 cites W2034188673 @default.
• W2045971982 cites W2037412915 @default.
• W2045971982 cites W2045348184 @default.
• W2045971982 cites W2052714233 @default.
• W2045971982 cites W2052884329 @default.
• W2045971982 cites W2053418558 @default.
• W2045971982 cites W2056189319 @default.
• W2045971982 cites W2059519258 @default.
• W2045971982 cites W2062480308 @default.
• W2045971982 cites W2063896912 @default.
• W2045971982 cites W2071549023 @default.
• W2045971982 cites W2074774097 @default.
• W2045971982 cites W2076370383 @default.
• W2045971982 cites W2083495092 @default.
• W2045971982 cites W2086142513 @default.
• W2045971982 cites W2090930451 @default.
• W2045971982 cites W2125713628 @default.
• W2045971982 cites W2146797845 @default.
• W2045971982 cites W2150312232 @default.
• W2045971982 cites W2171705091 @default.
• W2045971982 cites W2429848542 @default.
• W2045971982 doi "https://doi.org/10.1074/jbc.m600302200" @default.
• W2045971982 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16737958" @default.
• W2045971982 hasPublicationYear "2006" @default.
• W2045971982 type Work @default.
• W2045971982 sameAs 2045971982 @default.
• W2045971982 citedByCount "57" @default.
• W2045971982 countsByYear W20459719822012 @default.
• W2045971982 countsByYear W20459719822013 @default.
• W2045971982 countsByYear W20459719822014 @default.
• W2045971982 countsByYear W20459719822015 @default.
• W2045971982 countsByYear W20459719822016 @default.
• W2045971982 countsByYear W20459719822017 @default.
• W2045971982 countsByYear W20459719822018 @default.
• W2045971982 countsByYear W20459719822019 @default.
• W2045971982 countsByYear W20459719822020 @default.
• W2045971982 countsByYear W20459719822021 @default.
• W2045971982 countsByYear W20459719822023 @default.
• W2045971982 crossrefType "journal-article" @default.
• W2045971982 hasAuthorship W2045971982A5000959667 @default.
• W2045971982 hasAuthorship W2045971982A5019398592 @default.
• W2045971982 hasAuthorship W2045971982A5027230278 @default.
• W2045971982 hasAuthorship W2045971982A5062913518 @default.
• W2045971982 hasAuthorship W2045971982A5085256777 @default.
• W2045971982 hasBestOaLocation W20459719821 @default.
• W2045971982 hasConcept C171250308 @default.
• W2045971982 hasConcept C179264091 @default.
• W2045971982 hasConcept C185592680 @default.
• W2045971982 hasConcept C192562407 @default.
• W2045971982 hasConcept C2780841128 @default.
• W2045971982 hasConcept C55493867 @default.
• W2045971982 hasConcept C86803240 @default.
• W2045971982 hasConceptScore W2045971982C171250308 @default.
• W2045971982 hasConceptScore W2045971982C179264091 @default.
• W2045971982 hasConceptScore W2045971982C185592680 @default.
• W2045971982 hasConceptScore W2045971982C192562407 @default.
• W2045971982 hasConceptScore W2045971982C2780841128 @default.
• W2045971982 hasConceptScore W2045971982C55493867 @default.
• W2045971982 hasConceptScore W2045971982C86803240 @default.
• W2045971982 hasIssue "33" @default.
• W2045971982 hasLocation W20459719821 @default.
• W2045971982 hasOpenAccess W2045971982 @default.
• W2045971982 hasPrimaryLocation W20459719821 @default.
• W2045971982 hasRelatedWork W1531601525 @default.
• W2045971982 hasRelatedWork W2319480705 @default.
• W2045971982 hasRelatedWork W2384464875 @default.
• W2045971982 hasRelatedWork W2606230654 @default.
• W2045971982 hasRelatedWork W2607424097 @default.
• W2045971982 hasRelatedWork W2748952813 @default.

• next