FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2046161984> ?p ?o ?g. }

• W2046161984 endingPage "12380" @default.
• W2046161984 startingPage "12374" @default.
• W2046161984 abstract "The physiological role of TFIIA was investigated by analyzing transcription in a yeast strain that contains a TATA-binding protein (TBP) mutant (N2–1) defective for interacting with TFIIA. In cells containing N2–1, transcription from a set of artificial his3 promoters dependent on different activators is generally reduced by a similar extent, indicating that TFIIA function is largely nonselective for activators. In addition, TATA element utilization, a core promoter function, is altered athis3 promoters dependent on weak activators. Genomic expression analysis reveals that 3% of the genes are preferentially affected by a factor of 4 or more. Chimeras of affected promoters indicate that the sensitivity to the TFIIA-TBP interaction can map either to the upstream or core promoter region. Unlike wild-type TBP or TFIIA, the N2–1 derivative does not activate transcription when artificially recruited to the promoter via a heterologous DNA binding domain, indicating that TFIIA is important for transcription even in the absence of an activation domain. Taken together, these results suggest that TFIIA plays an important role in both activator-dependent and core promoter functions in vivo. Further, they suggest that TFIIA function may not be strictly related to the recruitment of TBP to promoters but may also involve a step after TBP recruitment. The physiological role of TFIIA was investigated by analyzing transcription in a yeast strain that contains a TATA-binding protein (TBP) mutant (N2–1) defective for interacting with TFIIA. In cells containing N2–1, transcription from a set of artificial his3 promoters dependent on different activators is generally reduced by a similar extent, indicating that TFIIA function is largely nonselective for activators. In addition, TATA element utilization, a core promoter function, is altered athis3 promoters dependent on weak activators. Genomic expression analysis reveals that 3% of the genes are preferentially affected by a factor of 4 or more. Chimeras of affected promoters indicate that the sensitivity to the TFIIA-TBP interaction can map either to the upstream or core promoter region. Unlike wild-type TBP or TFIIA, the N2–1 derivative does not activate transcription when artificially recruited to the promoter via a heterologous DNA binding domain, indicating that TFIIA is important for transcription even in the absence of an activation domain. Taken together, these results suggest that TFIIA plays an important role in both activator-dependent and core promoter functions in vivo. Further, they suggest that TFIIA function may not be strictly related to the recruitment of TBP to promoters but may also involve a step after TBP recruitment. polymerase TATA-binding protein green fluorescent protein Initiation of RNA polymerase (pol)1 II transcription requires the assembly of a large complex of proteins that must interact at the promoter in a productive manner (1.Roeder R.G. Trends Biochem. Sci. 1996; 21: 327-335Abstract Full Text PDF PubMed Scopus (718) Google Scholar, 2.Orphanides G. Lagrange T. Reinberg D. Genes Dev. 1996; 10: 2657-2683Crossref PubMed Scopus (844) Google Scholar). Formation of this complex is accelerated by activators that bind to the promoter and aid in recruitment of the components in the complex. The first step in promoter recognition is binding of TFIID to the TATA element. TFIID is a multiprotein complex containing TATA-binding protein (TBP) and TBP-associated factors (3.Burley S.K. Roeder R.G. Annu. Rev. Biochem. 1996; 65: 769-799Crossref PubMed Scopus (621) Google Scholar). TFIIA stabilizes the TBP-TATA interaction (4.Buratowski S. Hahn S. Guarente L. Sharp P.A. Cell. 1989; 56: 549-561Abstract Full Text PDF PubMed Scopus (679) Google Scholar, 5.Lee D.K. Dejong J. Hashimoto S. Horikoshi M. Roeder R.G. Mol. Cell. Biol. 1992; 12: 5189-5196Crossref PubMed Scopus (102) Google Scholar, 6.Imbalzano A.N. Zaret K.S. Kingston R.E. J. Biol. Chem. 1994; 269: 8280-8286Abstract Full Text PDF PubMed Google Scholar, 7.Kang J.J. Auble D.T. Ranish J.A. Hahn S. Mol. Cell. Biol. 1995; 15: 1234-1243Crossref PubMed Google Scholar) by interacting directly with the TBP and DNA flanking the TATA element (8.Geiger J.H. Hahn S. Lee S. Sigler P.B. Science. 1996; 272: 830-836Crossref PubMed Scopus (237) Google Scholar, 9.Tan S. Hunziker Y. Sargent D.F. Richmond T.J. Nature. 1996; 381: 127-134Crossref PubMed Scopus (257) Google Scholar). TFIIA also counteracts several negative regulators of transcription that specifically target TBP. It inhibits the abilities of Mot1 and NC2 to dissociate TBP from the TATA element (10.Auble D.T. Hansen K.E. Mueller C.G.F. Lane W.S. Thorner J. Hahn S. Genes Dev. 1994; 8: 1920-1934Crossref PubMed Scopus (275) Google Scholar, 11.Goppelt A. Stelzer G. Lottspeich F. Meisterernst M. EMBO J. 1996; 15: 3105-3116Crossref PubMed Scopus (129) Google Scholar, 12.Mermelstein F. Yeung K. Cao J. Inostroza J.A. Erdjument-Bromage H. Eagelson K. Landsman D. Levitt P. Tempst P. Reinberg D. Genes Dev. 1996; 10: 1033-1048Crossref PubMed Scopus (113) Google Scholar, 13.Kim J. Parvin J.D. Shykind B.M. Sharp P.A. J. Biol. Chem. 1996; 271: 18405-18412Abstract Full Text Full Text PDF PubMed Scopus (19) Google Scholar), and it blocks the inhibition of TBP binding to the TATA element by the N-terminal domain of TBP-associated factor 130 (14.Kokubo T. Swanson M.J. Nishikawa J.I. Hinnebusch A.G. Nakatani Y. Mol. Cell. Biol. 1998; 18: 1003-1012Crossref PubMed Scopus (101) Google Scholar). Thus, there are several mechanisms by which TFIIA functions at core promoters in vitro. Although TFIIA is not required for in vitro transcription using highly purified components, activated transcription is often stimulated by TFIIA. This is in accord with the observations that TFIIA can interact directly with activation domains in vitro(15.Ozer J. Moore P.A. Bolden A.H. Lee A. Rosen C.A. Lieberman P.M. Genes Dev. 1994; 8: 2324-2335Crossref PubMed Scopus (133) Google Scholar, 16.Kobayashi N. Boyer T.G. Berk A.J. Mol. Cell. Biol. 1995; 15: 6465-6473Crossref PubMed Scopus (134) Google Scholar, 17.Clemens K.E. Piras G. Radonovich M.F. Choi K.S. Duvall J.F. DeJong J. Roeder R. Brady J.N. Mol. Cell. Biol. 1996; 16: 4656-4664Crossref PubMed Scopus (47) Google Scholar) and that TFIIA is required for activator-dependent stabilization of the TFIID·TATA complex (16.Kobayashi N. Boyer T.G. Berk A.J. Mol. Cell. Biol. 1995; 15: 6465-6473Crossref PubMed Scopus (134) Google Scholar, 18.Lieberman P.M. Berk A.J. Genes Dev. 1994; 8: 995-1006Crossref PubMed Scopus (192) Google Scholar, 19.Damania B. Lieberman P. Alwine J.C. Mol. Cell. Biol. 1998; 18: 3926-3935Crossref PubMed Scopus (25) Google Scholar, 20.Ranish J.A. Yudkovsky N. Hahn S. Genes Dev. 1999; 13: 49-63Crossref PubMed Scopus (204) Google Scholar). A simple model is that the activator-dependent TFIID·TFIIA complex is formed rapidly and stably on the TATA element, thereby serving as an efficient scaffold for the remainder of the initiation complex. Alternatively, TFIIA could act as a coactivator, conveying information between the activator and TBP. In this regard, in vitrocross-linking of an activator to TBP bound at a promoter is inhibited by TFIIA (21.Emili A. Ingles C.J. J. Biol. Chem. 1995; 270: 13674-13680Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar), suggesting that TFIIA is positioned between the activator and TBP. However, other biochemical experiments suggest that simple recruitment of the TFIID·TFIIA complex is not sufficient for activated transcription (22.Shykind B.M. Kim J. Sharp P.A. Genes Dev. 1995; 9: 1354-1365Crossref PubMed Scopus (130) Google Scholar, 23.Chi T. Carey M. Genes Dev. 1996; 10: 2540-2550Crossref PubMed Scopus (118) Google Scholar). TFIIA may alter the conformation of TFIID such that either TFIID or the TFIIA·TFIID complex is a target for the remainder of the initiation machinery. It should be noted that the functional interaction between an activator and TFIIA need not be direct, and biochemical studies have identified coactivator proteins that interact with the activator and TFIIA (24.Ge H. Roeder R.G. Cell. 1994; 78: 513-523Abstract Full Text PDF PubMed Scopus (307) Google Scholar). The physiological relevance of these observations and implied mechanisms remains to be established. Several studies have addressed the role of TFIIA in vivo, but the results do not establish whether the functions of TFIIAin vivo are related to the activator, the core promoter, or both. Previously, we showed that a yeast TBP mutant (termed N2–1) defective for interacting with TFIIA impairs the response to acidic activators but does not generally affect pol II transcription (25.Stargell L.A. Struhl K. Science. 1995; 269: 75-78Crossref PubMed Scopus (99) Google Scholar). However, human TBP mutants severely defective for interacting with TFIIA are generally incompetent for transcription in transiently transfected mammalian cells (26.Bryant G.O. Martel L.S. Burley S.K. Berk A.J. Genes Dev. 1996; 10: 2491-2504Crossref PubMed Scopus (99) Google Scholar). On the other hand, mutants of the Toa2 subunit of yeast TFIIA that weaken TFIIA-TBP·TATA complex formation confer selective transcriptional effects (27.Ozer J. Lezina L.E. Ewing J. Audi S. Lieberman P.M. Mol. Cell. Biol. 1998; 18: 2559-2570Crossref PubMed Scopus (43) Google Scholar). Interpretation of these results is complicated because the various mutations might differentially affect the quality of the TFIIA-TBP interaction and because potential functions of TFIIA that are unrelated to interactions with TBP are not addressed. In complementary experiments, reduction of intracellular TFIIA levels caused a broad, but quantitatively modest, effect on transcription (7.Kang J.J. Auble D.T. Ranish J.A. Hahn S. Mol. Cell. Biol. 1995; 15: 1234-1243Crossref PubMed Google Scholar), but these results were limited by the partial nature of the TFIIA depletion and the lack of experiments involving activator-dependent transcription. In this report, we extend our analysis of the N2–1 derivative of TBP by systematically examining its ability to respond to a large number of activators, by determining the regions of promoters that are responsible for altered transcription in the N2–1 strain, and by performing artificial recruitment experiments. Our results indicate that TFIIA plays an important role in both activator-dependent and core promoter functions in vivo, and they suggest that TFIIA functions, at least in part, in a step after TBP is recruited to the promoter. To analyze transcriptional stimulation by different yeast activators, we started with a set of 13 strains described previously (28.Iyer V. Struhl K. Mol. Cell. Biol. 1995; 15: 7059-7066Crossref PubMed Scopus (66) Google Scholar) that contain derivatives of the his3 promoter in which the natural enhancer region located upstream of the noncanonical (TC) and canonical (TR)his3 TATA elements is replaced with a specific activator binding site. After transformation of these 13 strains with aURA3 centromeric plasmid expressing wild-type TBP, the chromosomal TBP locus was replaced by a derivative in which the TBP protein coding sequence was replaced by the LEU2 gene. Finally, derivatives of these strains expressing wild-type TBP or the N2–1 derivative as the sole source of TBP (on TRP1centromeric plasmids) were generated by plasmid shuffling. To analyze the ability of TBP and the N2–1 derivative to mediate the response to the various activators, cells were grown under appropriate conditions for the various activators, exactly as described previously (28.Iyer V. Struhl K. Mol. Cell. Biol. 1995; 15: 7059-7066Crossref PubMed Scopus (66) Google Scholar). Levels of his3 transcription were determined by quantitative S1 analyses using hybridization reactions containing 20–40 μg of RNA and his3 and ded1 32P-labeled oligonucleotide probes as described previously (29.Iyer V. Struhl K. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5208-5212Crossref PubMed Scopus (145) Google Scholar). Yeast strains MMY101 and MMY102 (generated and kindly provided by Mario Mencia) were derived from ZMY117 (30.Moqtaderi Z. Keaveney M. Struhl K. Mol. Cell. 1998; 2: 675-682Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar) by LEU2 disruption of the genomic copy of TBP in the presence of wild-type TBP on a URA3centromeric plasmid. TRP1 centromeric plasmids expressing wild-type TBP (for MMY101) or N2–1 (for MMY102) were introduced into this background by plasmid shuffling. Cells of each strain were cultured in synthetic medium at 30 °C to anA 600 of 1, collected by centrifugation, and frozen in liquid nitrogen. Total cellular RNA was isolated by hot acid phenol extraction (29.Iyer V. Struhl K. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5208-5212Crossref PubMed Scopus (145) Google Scholar), and poly(A)-containing RNA was purified using Qiagen oligotex resin. Oligo(dT)-primed double-stranded cDNA was derived from this poly(A)-containing RNA, and 1 μg of the product was transcribed in vitro to generate internally biotin-labeled complementary RNA (31.Wodicka L. Dong H. Mittman M. Ho M.H. Lockhart D.J. Nature Biotech. 1997; 15: 1359-1367Crossref PubMed Scopus (856) Google Scholar). The biotin-labeled RNA probes were fragmented, hybridized to half a set of Affymetrix yeast gene chip arrays (chips C and D, representing ∼3200 open reading frames from chromosomes IX to XVI), fluorescently labeled, and analyzed on a Molecular Dynamics confocal scanner (31.Wodicka L. Dong H. Mittman M. Ho M.H. Lockhart D.J. Nature Biotech. 1997; 15: 1359-1367Crossref PubMed Scopus (856) Google Scholar). The results for the two strains were analyzed and compared using Affymetrix GeneChip software. For the comparison of expression results from the two strains, the data were normalized by two different methods: in the first, the overall hybridization intensity of the N2–1 sample was set equal to that of the wild-type sample for a given chip; and in the second, the data were normalized to set the hybridization intensities of both samples to the actin open reading frame (present on both C and D chips) at parity. The two methods of normalization yielded similar results, although there were minor variations in the fold change, and thus the rank order, of the open reading frames exhibiting changed expression. The genome microarray results for several representative RNAs were confirmed by quantitative S1 nuclease protection assays. Based on the results of genome-wide analysis of transcription in the N2–1 strain, four genes were selected for analysis of their promoter sequences:CTR1 and PUT1, which are down-regulated in the N2–1 background, and ERG3 and CYC1, which are up-regulated in the N2–1 strain. All promoter fragments were produced by polymerase chain reaction using oligonucleotide primers that contain a restriction site at the 5′-end of the primer (an artificialBamHI site, which adds 6 base pairs to each promoter between the upstream and core promoter regions). Upstream promoter fragments are 750 base pairs in length, and the core promoter regions span from the distal end of the TATA box to the +7 site relative to the A of the start codon. The hybrid promoter constructs were cloned in frame with the gene encoding a modified version of green fluorescent protein (GFP, a gift from Pam Silver). The resulting chimeras were linearized withEcoRV and integrated at the ura3-52 locus of the TBP or N2–1 strains used for the genome microarray analysis. Quantitative S1 nuclease protection assays were performed as described (29.Iyer V. Struhl K. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5208-5212Crossref PubMed Scopus (145) Google Scholar) on RNA harvested from each strain. The sequence of the 55 base GFP probe is CCGTATGTTGCATCACCTTCACCCTCTCCACTGACAGAAAATTTGTGCCCTAATT, and S1 nuclease digestion of the hybrid between yeast RNA and this probe yields a product of 50 bases. LexA fusion constructs were tested in strain FT4, which contains a LexA operator 45 base pairs upstream of the his3 TATA element and structural gene (32.Tzamarias D. Struhl K. Nature. 1994; 369: 758-761Crossref PubMed Scopus (282) Google Scholar). To generate molecules expressing LexA-TBP derivatives, the region encoding Cyc8 of YCp91-LexA-CYC8 (32.Tzamarias D. Struhl K. Nature. 1994; 369: 758-761Crossref PubMed Scopus (282) Google Scholar) was replaced with the structural gene of wild-type TBP and the N2–1 derivative. The resulting molecule contains a 1.5-kilobase fragment of theADH promoter driving expression of a hybrid protein consisting of the 202 amino acid coding sequence for LexA, the HA1 epitope, the SV40 nuclear localization signal, and the TBP derivative. YCp22 (the TRP1 vector) and molecules expressing LexA and the LexA-TBP derivatives were transformed into strain FT4, andhis3 expression was monitored by spotting 104cells on plates lacking histidine, containing either 0 or 20 mm aminotriazole, a competitive inhibitor ofhis3. LexA-TBP fusions were detected by immunoblot analyses of 100 μg of whole cell extracts using a polyclonal antibody to LexA and chemiluminescent detection. Gal4 fusion constructs were tested in the strain MAV103, which contains the Gal4 UAS fused to the his3 TATA element and structural gene (33.Vidal M. Brachmann R.K. Fattaey A. Harlow E. Boeke J.D. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 10315-10320Crossref PubMed Scopus (361) Google Scholar). Polymerase chain reaction was used to amplify the open reading frames of Toa1 and TBP, and these were cloned into pPC97, which contains the Gal4 DNA binding domain (residues 1–147) on a CEN,TRP1-marked plasmid (33.Vidal M. Brachmann R.K. Fattaey A. Harlow E. Boeke J.D. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 10315-10320Crossref PubMed Scopus (361) Google Scholar). Molecules expressing these Gal4 derivatives were transformed into strain MAV103, and his3expression was monitored by spotting 104 cells on plates lacking histidine, containing either 0 or 20 mmaminotriazole. In yeast and other eukaryotic cells, core promoters containing TATA and initiator elements are essentially inactive, indicating that transcription of essentially all genes requires activator proteins (34.Struhl K. Ann. Rev. Biochem. 1989; 58: 1051-1077Crossref PubMed Scopus (204) Google Scholar, 35.Struhl K. Cell. 1999; 98: 1-4Abstract Full Text Full Text PDF PubMed Scopus (368) Google Scholar). Previously, we showed that the N2–1 derivative of TBP was defective for transcription of genes responding to three different acidic activators, Gal4, Gcn4, and Ace1, and was defective in vitro for interaction with TFIIA (25.Stargell L.A. Struhl K. Science. 1995; 269: 75-78Crossref PubMed Scopus (99) Google Scholar). The growth and transcriptional phenotypes conferred by N2–1, but not by other TBP mutants, were suppressed by fusion to the Toa2 subunit of TFIIA, demonstrating that the defective TFIIA-TBP interaction is responsible for the phenotypes in vivo (25.Stargell L.A. Struhl K. Science. 1995; 269: 75-78Crossref PubMed Scopus (99) Google Scholar, 36.Stargell L.A. Struhl K. Mol. Cell. Biol. 1996; 16: 4456-4464Crossref PubMed Scopus (51) Google Scholar). Although it is impossible to exclude the possibility that the N2–1 derivative might have other defects aside from its inability to interact with TFIIA, such additional defects do not account for the growth and transcriptional phenotypes. Interestingly, transcription of a number of other genes appeared unaffected in the N2–1 strain. This suggests that activators responsible for transcription of the unaffected genes should function normally in the N2–1 strain. To test this hypothesis, we analyzed the role of the TFIIA-TBP interaction in 13 strains, each of which possesses a binding site for a different activator located upstream of the his3 TATA and initiator elements (28.Iyer V. Struhl K. Mol. Cell. Biol. 1995; 15: 7059-7066Crossref PubMed Scopus (66) Google Scholar). These sites include those recognized by acidic activators or by activators with unclassified activation domains, as well as a poly(dA·dT) element that stimulates transcription via its inherent effect on chromatin structure (37.Iyer V. Struhl K. EMBO J. 1995; 14: 2570-2579Crossref PubMed Scopus (347) Google Scholar). Unexpectedly, in almost all cases, his3 transcription is lower in the N2–1 strain than in the corresponding strain expressing wild-type TBP (Fig.1). In the exceptional case of the activator Ppr1, transcriptional output is unaffected or slightly enhanced in the N2–1 strain. Thus, most of the activators tested are unable to support maximal levels of his3 transcription in the N2–1 strain. Interestingly, the transcriptional defect is quantitatively similar (2–3-fold) in essentially all cases examined, indicating that the TFIIA-TBP interaction is largely nonselective for activator function. The his3 promoter contains a noncanonical TATA-like element (TC) that is responsible for initiation at the +1 position and a consensus TATA element (TR) that is responsible for initiation at +13 (28.Iyer V. Struhl K. Mol. Cell. Biol. 1995; 15: 7059-7066Crossref PubMed Scopus (66) Google Scholar, 38.Struhl K. Mol. Cell. Biol. 1986; 6: 3847-3853Crossref PubMed Scopus (117) Google Scholar, 39.Chen W. Struhl K. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 2691-2695Crossref PubMed Scopus (159) Google Scholar, 40.Mahadevan S. Struhl K. Mol. Cell. Biol. 1990; 10: 4447-4455Crossref PubMed Scopus (47) Google Scholar). In accord with previous results (28.Iyer V. Struhl K. Mol. Cell. Biol. 1995; 15: 7059-7066Crossref PubMed Scopus (66) Google Scholar), strains containing wild-type TBP show a clear pattern of his3 TATA utilization depending on the quality of activator (Fig. 1 and TableI). Specifically, as defined by the ratio of +13 to +1 transcripts, weak activators stimulate transcription predominantly through TC , moderate activators stimulate transcription equally from TC andTR , and strong activators preferentially stimulate transcription through TR . This pattern was interpreted in terms of functional saturation ofTC (and other weak TATA elements) at low to moderate levels of transcriptional stimulation (28.Iyer V. Struhl K. Mol. Cell. Biol. 1995; 15: 7059-7066Crossref PubMed Scopus (66) Google Scholar).Table IDifferential usage of the two qualitatively distinct TATA elementsActivatorRatio of +13/+1 TranscriptionaThe ratio of +13 transcription to +1 transcription, which reflects utilization of T R orT C, respectively. A value of 1 represents equal initiation from +1 and +13, values of less than 1 indicate preferential initiation from the +1 start site (driven by T C), and values greater than 1 indicate preferential initiation from +13 (driven by T R).Wild-type TBPN2–1Hap10.490.92Leu30.501.3Rap10.751.1Reb10.581.4Abf10.591.8dAdT1.23.5Hap2–41.72.5Ppr11.97.0Put31.13.0Gcn45.34.9Ace15.96.1Gal47.28.0a The ratio of +13 transcription to +1 transcription, which reflects utilization of T R orT C, respectively. A value of 1 represents equal initiation from +1 and +13, values of less than 1 indicate preferential initiation from the +1 start site (driven by T C), and values greater than 1 indicate preferential initiation from +13 (driven by T R). Open table in a new tab As the wild-type pattern of his3 TATA utilization is governed specifically by the core promoter region and not the activator (28.Iyer V. Struhl K. Mol. Cell. Biol. 1995; 15: 7059-7066Crossref PubMed Scopus (66) Google Scholar), factors that alter this pattern do so by affecting core promoter function (30.Moqtaderi Z. Keaveney M. Struhl K. Mol. Cell. 1998; 2: 675-682Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 41.Collart M.A. Struhl K. EMBO J. 1993; 12: 177-186Crossref PubMed Scopus (86) Google Scholar, 42.Collart M.A. Mol. Cell. Biol. 1996; 16: 6668-6676Crossref PubMed Scopus (101) Google Scholar, 43.Moqtaderi Z. Bai Y. Poon D. Weil P.A. Struhl K. Nature. 1996; 382: 188-191Crossref Scopus (250) Google Scholar). In this regard, the corresponding strains containing the N2–1 derivative display a different pattern ofhis3 TATA element utilization (Table I). In promoters dependent on weak activators, a larger percentage of the total transcription is driven from TR , producing a +13 to +1 ratio of nearly 1 or greater. A similarly increased preference for TR and +13 initiation is also observed for moderate activators, including Ppr1. Importantly, increased utilization of TR in strains containing N2–1 is observed even though the overall level of transcription is lower; this contrasts with the situation in wild-type cells where increasedTR utilization is associated with an overall increase in his3 transcription levels (28.Iyer V. Struhl K. Mol. Cell. Biol. 1995; 15: 7059-7066Crossref PubMed Scopus (66) Google Scholar). Taken together, these results suggest that TC is saturating at a lower level of transcription in the N2–1 strain as compared with wild type strain and that noncanonical TATA elements depend on the TFIIA-TBP interaction to achieve maximal levels of transcription. Differential preference of his3 TATA elements is not observed for potent activators (Gcn4, Ace1, and Gal4), suggesting that a strong activator can bypass at least part of the defect associated with a defective TFIIA-TBP interaction. The observation that the N2–1 derivative alters the wild-type rules of his3 TATA element utilization provides evidence that TFIIA performs a function at core promoters. The modest defect in Gal4-dependent activation (Fig. 1) appears to conflict with our previous observation (25.Stargell L.A. Struhl K. Science. 1995; 269: 75-78Crossref PubMed Scopus (99) Google Scholar) that the N2–1 derivative was completely unable to mediate activation by Gal4. This apparent discrepancy was resolved by analyzing the kinetics of Gal4-dependent activation of GAL1 transcription. The TBP-containing strain achieves maximal levels of activation by 30–60 min, with an increase in GAL1 RNA observed after only 10 min in galactose (Fig.2 A; data not shown). In contrast, the N2–1 strain requires 6 h for detectable induction and 12 h to reach maximum output. Although there is a substantial growth difference between the TBP and N2–1 strains (doubling times 85 min and 6 h, respectively), the slow induction of GAL1transcription is not explained simply by the altered growth rates. For example, at a time corresponding to half a generation (45 min and 3 h, respectively), GAL1 transcription is maximal in the strain containing wild-type TBP, whereas it is not detectable in the N2–1 strain. In the previously published experiment, which involved a different strain background, the doubling time for the N2–1 strain was 10 h, galactose induction was performed for 18 h, and GAL1 transcription was not detected. However, when the original strain is cultured for longer times, a slight Gal4-dependent response is observed at 24 h, and a response corresponding to 20–30% of the wild-type level is observed at 72 h (Fig. 2 B). Thus, in both the original and current strain backgrounds, the N2–1 derivative delays the induction of Gal4-dependent activation but only causes a mild (3–5 fold) defect in the maximal level of GAL1 transcription. To examine the global implications of an impaired TFIIA-TBP interaction, we compared the pattern of gene expression of N2–1 and wild-type cells using microarray technology (44.Lockhart D.J. Dong H. Byrne M.C. Follettie M.T. Gallo M.V. Chee M.S. Mittmann M. Wang C. Kobayashi M. Horton H. Brown E.L. Nature Biotechnol. 1996; 14: 1675-1680Crossref PubMed Scopus (2796) Google Scholar). Analysis of ∼3200 genes reveals that 42 (1.3%) are expressed at least 4-fold higher in the N2–1 strain than in the wild-type strain and that 47 (1.5%) are expressed at levels at least 4-fold lower in the N2–1 strain (Table II). If changes of at least 2-fold are considered, 9% of genes are expressed at higher levels in the N2–1 strain, and 8% are expressed at lower levels in the N2–1 strain relative to the strain containing wild-type TBP. This percentage of genes preferentially affected by at least 2-fold in the N2–1 strain is comparable to or higher than that caused by mutations in GCN5 (5% affected), SRB5 (16% affected), andSWI2 (6% affected) (45.Holstege F.C. Jennings E.G. Wyrick J.J. Lee T.I. Hengartner C.J. Green M.R. Golub T.R. Lander E.S. Young R.A. Cell. 1998; 95: 717-728Abstract Full Text Full Text PDF PubMed Scopus (1594) Google Scholar). With the exception of increased expression of several ribosomal protein genes in the N2–1 strain, we detected no obvious patterns in the genes with changed expression levels. The wide range and apparent unrelated nature of genes preferentially affected by the N2–1 mutation are consistent with the relative lack of activator specificity observed with the modifiedhis3 promoters.Table IIGenes that exhibit altered levels of expression in the N2–1 strainFold differenceLower in N2–1Higher in N2–1>10YNL157wYNL144cYNL195cTIS11YPR008wPUT16–7YMR316c-bRPL6B ex 1MSK1YMR318cYPL136wYNL057wYNR075wYPL142cYJL118w5YPT53YKL086wCTR1YLR435wYOR071cYLR376cYMR320wRPS33BYLR126cYPR064wYLR349wYPL205cYMR040wYPL148cBEM4YPL238cYPL278cYPL049cYPL200wYPR003c4YLR267wYMR269wYJR149wCIN5YAP3YMR303cYNL173cYPR044cCYC2YNR042wYOR019wYOR246cYKL165cRP23 cx 1YOR137cYMR294wYOR387cZDS1MLS1YLR265cYNL194cYLL012wMPD1DYN1YOR343cYLR068wYNL054wSPR40YOL031cYKR077wARE2YJL222wYMR313cCTK1YOR264wYKR024cYNL148cRPA12YPL222wERG3YMR085wYKL082cYLR231cCYC1YML132wYML023cYOR070cYJL148WYOR220wERG5YLR073CLTV1YMR095CYLR455w Open table in a new tab An important consideration in interpreting these genome-wide expression results is that equal amounts of wild-type and N2–1 mRNA samples were analyzed. For this reason, all changes caused by the defective TFIIA-TBP interaction (either positive or negative) are defined relativ" @default.
• W2046161984 created "2016-06-24" @default.
• W2046161984 creator A5006023220 @default.
• W2046161984 creator A5025953066 @default.
• W2046161984 creator A5070161142 @default.
• W2046161984 creator A5079075936 @default.
• W2046161984 creator A5083029357 @default.
• W2046161984 date "2000-04-01" @default.
• W2046161984 modified "2023-10-06" @default.
• W2046161984 title "TFIIA Has Activator-dependent and Core Promoter Functions in Vivo" @default.
• W2046161984 cites W1507254050 @default.
• W2046161984 cites W1514721350 @default.
• W2046161984 cites W1539101364 @default.
• W2046161984 cites W1543188612 @default.
• W2046161984 cites W1564217760 @default.
• W2046161984 cites W1716734578 @default.
• W2046161984 cites W1742557797 @default.
• W2046161984 cites W1832650535 @default.
• W2046161984 cites W1852931409 @default.
• W2046161984 cites W1881561702 @default.
• W2046161984 cites W1900026445 @default.
• W2046161984 cites W1914623489 @default.
• W2046161984 cites W1971545282 @default.
• W2046161984 cites W1974551833 @default.
• W2046161984 cites W1975620486 @default.
• W2046161984 cites W1976363969 @default.
• W2046161984 cites W1983222844 @default.
• W2046161984 cites W1989932051 @default.
• W2046161984 cites W1996973347 @default.
• W2046161984 cites W1999138582 @default.
• W2046161984 cites W1999854384 @default.
• W2046161984 cites W2006998897 @default.
• W2046161984 cites W2009523975 @default.
• W2046161984 cites W2011789522 @default.
• W2046161984 cites W2019348861 @default.
• W2046161984 cites W2025485946 @default.
• W2046161984 cites W2025995971 @default.
• W2046161984 cites W2026238009 @default.
• W2046161984 cites W2036580178 @default.
• W2046161984 cites W2038067224 @default.
• W2046161984 cites W2040249554 @default.
• W2046161984 cites W2048901942 @default.
• W2046161984 cites W2052093902 @default.
• W2046161984 cites W2053330245 @default.
• W2046161984 cites W2064498148 @default.
• W2046161984 cites W2069271664 @default.
• W2046161984 cites W2070159701 @default.
• W2046161984 cites W2071475568 @default.
• W2046161984 cites W2071842411 @default.
• W2046161984 cites W2075570601 @default.
• W2046161984 cites W2084295961 @default.
• W2046161984 cites W2085949412 @default.
• W2046161984 cites W2093944632 @default.
• W2046161984 cites W2098919421 @default.
• W2046161984 cites W2100144286 @default.
• W2046161984 cites W2101510684 @default.
• W2046161984 cites W2101691594 @default.
• W2046161984 cites W2104159099 @default.
• W2046161984 cites W2107624922 @default.
• W2046161984 cites W2108552134 @default.
• W2046161984 cites W2110829136 @default.
• W2046161984 cites W2130819113 @default.
• W2046161984 cites W2135037886 @default.
• W2046161984 cites W2141870042 @default.
• W2046161984 cites W2148682967 @default.
• W2046161984 cites W2155719842 @default.
• W2046161984 cites W2164154631 @default.
• W2046161984 cites W2165537875 @default.
• W2046161984 cites W2171158788 @default.
• W2046161984 cites W250625372 @default.
• W2046161984 cites W4232123327 @default.
• W2046161984 cites W4233751608 @default.
• W2046161984 cites W4239029175 @default.
• W2046161984 cites W4244288506 @default.
• W2046161984 cites W4247420482 @default.
• W2046161984 doi "https://doi.org/10.1074/jbc.275.17.12374" @default.
• W2046161984 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10777519" @default.
• W2046161984 hasPublicationYear "2000" @default.
• W2046161984 type Work @default.
• W2046161984 sameAs 2046161984 @default.
• W2046161984 citedByCount "28" @default.
• W2046161984 countsByYear W20461619842014 @default.
• W2046161984 countsByYear W20461619842017 @default.
• W2046161984 countsByYear W20461619842018 @default.
• W2046161984 countsByYear W20461619842019 @default.
• W2046161984 countsByYear W20461619842021 @default.
• W2046161984 countsByYear W20461619842023 @default.
• W2046161984 crossrefType "journal-article" @default.
• W2046161984 hasAuthorship W2046161984A5006023220 @default.
• W2046161984 hasAuthorship W2046161984A5025953066 @default.
• W2046161984 hasAuthorship W2046161984A5070161142 @default.
• W2046161984 hasAuthorship W2046161984A5079075936 @default.
• W2046161984 hasAuthorship W2046161984A5083029357 @default.
• W2046161984 hasBestOaLocation W20461619841 @default.
• W2046161984 hasConcept C101762097 @default.
• W2046161984 hasConcept C104317684 @default.
• W2046161984 hasConcept C150194340 @default.
• W2046161984 hasConcept C185592680 @default.

• next