FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2046890979> ?p ?o ?g. }

• W2046890979 endingPage "25352" @default.
• W2046890979 startingPage "25345" @default.
• W2046890979 abstract "The Saccharomyces cerevisiaenucleolar protein Nop4p is necessary for processing of rRNA and assembly of 60 S ribosomal subunits. Nop4p is unusual in that it contains four RNA recognition motifs (RRMs) including one noncanonical RRM, as well as several auxiliary motifs, two acidic regions between the RRMs, and a carboxyl-terminal domain rich in lysines and arginines. To examine the functional importance of these motifs, we isolated random and site-directed mutations in NOP4 and assayed Nop4p function in vivo. Our results indicate that each RRM is essential for Nop4p function; mutations in conserved aromatic residues of Nop4p cause a temperature-sensitive lethal phenotype and diminished 60 S ribosomal subunit production. The carboxyl-terminal 68 amino acids are important but apparently not essential; carboxyl-terminal truncation of Nop4p causes slow growth, decreased ribosome production, and mislocalization of Nop4p. Deletion of both acidic motifs is lethal but replacement of most of the acidic residues with alanine has no apparent phenotype. These acidic residues may serve as spacers or tethers to separate the RRMs. The Saccharomyces cerevisiaenucleolar protein Nop4p is necessary for processing of rRNA and assembly of 60 S ribosomal subunits. Nop4p is unusual in that it contains four RNA recognition motifs (RRMs) including one noncanonical RRM, as well as several auxiliary motifs, two acidic regions between the RRMs, and a carboxyl-terminal domain rich in lysines and arginines. To examine the functional importance of these motifs, we isolated random and site-directed mutations in NOP4 and assayed Nop4p function in vivo. Our results indicate that each RRM is essential for Nop4p function; mutations in conserved aromatic residues of Nop4p cause a temperature-sensitive lethal phenotype and diminished 60 S ribosomal subunit production. The carboxyl-terminal 68 amino acids are important but apparently not essential; carboxyl-terminal truncation of Nop4p causes slow growth, decreased ribosome production, and mislocalization of Nop4p. Deletion of both acidic motifs is lethal but replacement of most of the acidic residues with alanine has no apparent phenotype. These acidic residues may serve as spacers or tethers to separate the RRMs. Eukaryotic ribosomes are synthesized in the nucleolus, the nuclear subcompartment where rRNA is transcribed, modified, and processed during assembly with ribosomal proteins. The 18 S, 5.8 S, and 25–28 S rRNAs are produced in the nucleolus from a 35–40 S pre-rRNA by exo- and endonucleolytic processing at sites within the 5′ and 3′ external transcribed spacers and the two internal spacers of the pre-rRNA (1Raué H.A. Planta R.J. Gene Expr. 1995; 5: 71-77PubMed Google Scholar, 2van Nues R.W. Venema J. Rientjes J.M.J. Dirks-Mulder A. Raué H.A. Biochem. Cell Biol. 1995; 73: 789-801Crossref PubMed Scopus (60) Google Scholar, 3Venema J. Tollervey D. Yeast. 1995; 11: 1629-1650Crossref PubMed Scopus (188) Google Scholar). 5 S rRNA is transcribed from separate genes. A number of yeast and metazoan small nucleolar RNAs and associated proteins have been identified that are necessary for rRNA processing and ribosome assembly (3Venema J. Tollervey D. Yeast. 1995; 11: 1629-1650Crossref PubMed Scopus (188) Google Scholar, 4Maxwell E.S. Fournier M.J. Annu. Rev. Biochem. 1995; 35: 897-934Crossref Scopus (548) Google Scholar, 5Mélèse T. Xue Z. Curr. Opin. Cell Biol. 1995; 7: 319-324Crossref PubMed Scopus (241) Google Scholar, 6Shaw P.J. Jordan E.G. Annu. Rev. Cell. Dev. Biol. 1995; 11: 93-121Crossref PubMed Scopus (409) Google Scholar). Some of the snoRNAs, 1The abbreviations used are: sno, small nucleolar; RNP, ribonucleoprotein particle(s); RRM, RNA recognition motif(s); PCR, polymerase chain reaction; Ts, temperature-sensitive; Cs, cold-sensitive; hn, human. present in ribonucleoprotein particles (snoRNPs), are thought to function in concert in a multi-snoRNP complex called the processome (3Venema J. Tollervey D. Yeast. 1995; 11: 1629-1650Crossref PubMed Scopus (188) Google Scholar, 7Allmang C. Henry Y. Morrissey J.P. Wood H. Petfalski E. Tollervey D. RNA ( NY ). 1996; 2: 63-73PubMed Google Scholar). This complex might function analogously to spliceosomes containing small nuclear RNPs assembled on pre-mRNAs, to direct proper folding of rRNA necessary for its processing or assembly with ribosomal proteins and nonribosomal nucleolar proteins. In addition to snoRNP proteins, other nucleolar proteins necessary for ribosome biogenesis have been identified, especially using genetic schemes in yeast (1Raué H.A. Planta R.J. Gene Expr. 1995; 5: 71-77PubMed Google Scholar, 3Venema J. Tollervey D. Yeast. 1995; 11: 1629-1650Crossref PubMed Scopus (188) Google Scholar, 6Shaw P.J. Jordan E.G. Annu. Rev. Cell. Dev. Biol. 1995; 11: 93-121Crossref PubMed Scopus (409) Google Scholar). These include the endonucleases MRP RNase and RNase III (Rnt1p), exonucleases Rat1p, Xrn1p, and Rrp4p, putative RNA-dependent ATPases/helicases Spb4p, Drs1p, Rrp3p, and Dbp3p, the rRNA methylase Dim1p, the putative shuttling protein Nsr1p, and the prolyl-peptidyl cis-trans-isomerase Npi46p/Fpr3p. Nop4p/Nop77p is a yeast nucleolar protein that was identified both by screening an expression library with a monoclonal antibody specific for a yeast nucleolar antigen and independently in a screen for mutants synthetically lethal in combination with a nop1 mutation (8Berges T. Petfalski E. Tollervey D. Hurt E.C. EMBO J. 1994; 13: 3136-3148Crossref PubMed Scopus (100) Google Scholar,9Sun C. Woolford Jr., J.L. EMBO J. 1994; 13: 3127-3135Crossref PubMed Scopus (86) Google Scholar). Depletion of Nop4p impairs production of 25 S rRNA and causes a deficit of 60 S ribosomal subunits. Nop4p contains five motifs that potentially bind RNA: four RNA recognition motifs (RRMs) (10Bandziulis R.J. Swanson M.S. Dreyfuss G. Genes Dev. 1989; 3: 431-437Crossref PubMed Scopus (490) Google Scholar, 11Birney E. Kumar S. Krainer A.R. Nucleic Acids Res. 1993; 21: 5803-5816Crossref PubMed Scopus (589) Google Scholar, 12Burd C.G. Dreyfuss G. Science. 1994; 265: 615-621Crossref PubMed Scopus (1734) Google Scholar) plus a carboxyl terminus rich in lysine and arginine residues. In addition, there are two regions in Nop4p rich in acidic residues, one between RRM1 and RRM2 and a second between RRM2 and RRM3 (Fig. 1 A). Acidic domains are frequently found in nucleolar proteins and have been suggested to interact with other proteins, for example with basic regions of ribosomal proteins (13Xue Z. Mélèse T. Trends Cell Biol. 1994; 4: 414-417Abstract Full Text PDF PubMed Scopus (51) Google Scholar). Understanding the role of Nop4p in ribosome biogenesis will be facilitated by analysis of the structural features of Nop4p that are necessary for its functions. To initiate a structural and functional analysis of Nop4p, we constructed site-directed mutations in each of the above-mentioned motifs of Nop4p and isolated random mutations in the NOP4 gene. We assayed the effect of these mutations on Nop4p function in vivo. We found that each RRM is essential and that the carboxyl-terminal charged domain is important for function of Nop4p. However, most of the glutamic or aspartic residues in the acidic motifs can be deleted or replaced with alanine residues without affecting function or nucleolar localization of Nop4p. Yeast strains used in this study are described in Table I. Yeast were grown in YEPD (1% yeast extract, 2% peptone, 2% glucose) or synthetic medium (14Sherman F. Fink G.R. Hicks J.B. Methods in Yeast Genetics: A Laboratory Course Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1986Google Scholar) containing glucose as a carbon source. Yeast were transformed with DNA using the lithium acetate method (15Ito H. Fukuda Y. Murata K. Kimura A. J. Bacteriol. 1983; 153: 163-168Crossref PubMed Google Scholar).Table IYeast strains used in this studyStrainGenotypeSourceJWY4917MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1pRS316NOP4This studyJWY4967MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 ade2–101 can1 nop4::TRP1 pRS316NOP4This studyJWY5081MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1 pRS315nop4–1This studyJWY5082MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1 pRS315nop4–2This studyJWY5083MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1 pRS315nop4–3This studyJWY5084MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1 pRS315nop4–4This studyJWY5085MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1 pRS315nop4–5This studyJWY4995MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 ade2–101 can1 nop4::TRP1pRS315nop4–6This studyJWY5064MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1pRS315nop4–8This studyJWY5063MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1pRS315nop4–9This studyJWY5065MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1pRS315nop4–10This studyJWY5046MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1pRS315nop4–11This studyJWY4972MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1pRS315nop4–12This studyJWY4970MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1pRS315nop4–13This studyJWY5077MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1pRS315nop4–14This studyJWY5074MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1pRS315nop4–16This studyJWY5076MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1pRS315nop4–17This studyJWY5086MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1pRS315nop4–18This studyJWY5087MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1pRS315nop4–19This studyJWY5093MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1pRS315nop4–20This studyJWY5092MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1pRS315nop4–21This studyJWY5096MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-Δ200 nop4::TRP1pRS315nop4–22This studyJWY4985MATa ura3–52 trp1-Δ101 lys2–801 leu2-Δ1 his3-D200 ade2–101 can1 nop4::TRP1 pRS315nop4–7This study Open table in a new tab Random mutations in the NOP4gene were generated by PCR coupled with in vivo gap repair (16Muhlrad D. Hunter R. Parker R. Yeast. 1992; 8: 79-82Crossref PubMed Scopus (416) Google Scholar). PCR amplification was done under conditions predicted to cause misincorporation of nucleotides (17Leung D.W. Chen E. Goeddei D.V. BioTechniques. 1989; 1: 11-15Google Scholar, 18Zhou Y. Zhang X. Elbright R.H. Nucleic Acids Res. 1991; 19: 6052Crossref PubMed Scopus (204) Google Scholar). The wild type NOP4gene used for generating gaps and as a substrate of PCR in this experiment is a 3.2-kilobase pair PstI/SmaI fragment cloned in a modified pRS315 plasmid (JW3434) that hasSpeI and XbaI sites in the polylinker destroyed by SpeI/XbaI double digestion and religation. The yeast strain used for transformation and the subsequent mutant screen is JWY4961, which has the chromosomal copy of NOP4 disrupted with the TRP1 sequence, and bears a wild typeNOP4 on plasmid pUN65. Four different gaps on theNOP4 gene were generated individually by digestion with different pairs of enzymes, each of which recognizes a single site in the gene or plasmid backbone. Gap 1 was created bySpeI/NcoI double digestion; it spans nucleotides 250–754, corresponding to the amino-terminal region of Nop4p including the RRM1 and the first 7 amino acid residues of RRM2. Gap 2 was created by NcoI/BlnI digestion, which removes sequences between nucleotides 754 and 1494, encoding RRM2 and RRM3. Gap 3 was created by BlnI/AatII digestion, which deletes sequences between nucleotides 1494 and 2103, corresponding to RRM4 and the linker region between RRM3 and RRM4. Gap 4 was generated byAatII/BamHI digestion, which removes sequences between nucleotides 2103 and 2469 that encode the 81 amino acid long carboxyl-terminal region of Nop4p. To use the NcoI site at nucleotide 754, the NcoI site at nucleotide 114 was destroyed in plasmid JW3434 by partial digestion and end-filling with Klenow enzyme, resulting in plasmid JW3435. The sequences of the oligonucleotides used in the PCR mutagenesis experiment are presented in Table II.Table IIOligonucleotides used in this studyNameSequencesCSPCR1GACGTTGTGGATATCTAGCCSPCR2CCATCACGCTTCCTTGGCS6CTAAGGCCAGAAAGACCCS7CTCCATGTCAGTGTTGGCSPCR4GGTGATGATGTCATGCCCSPCR5CGGATTCTCCGACATCTCCCSPCR3GTCATGCCGTTACCTCCGM13 −20 primerGTAAAACGACGGCCAGTNOPSTOP1CCCTTCTTCTCTTATACGACGTTAGAGNOPACIDELGAAGCTTGATCTACTTGTCTATTTCCTGACTCGTTATCATCNOPACIDEL 2CGGTTTACCTTTTAGCATGGAATTGTTCTGGCCCGTTATTTTCTCAGSITEMUT2GCCAAATTTACTGAAGTGCGGAGCCSitemut 1CCTTTCTACCATCAATTTTCNOPG152CCATGGCATATTTCCGATAATTAATTTCGGTTTACCNOPL310GCTGCCAAATTTACTGAGGTGCGGAGCCRRM1MUTCAGCAAAACTAACGAGCCCGAGGCCCCTGGACCRRM2MUT1CTTCATAGTAACAAGCGCAAATCCACACRRM3MUT1GGTCTTTGAAGGCTACAAGGGCCGTACCTTTAGCCRNP2 4GCTTCAATCTCATCTGGACCCAAGTTGCCAACGAACAGCTTTGTAGATCTGATAATCTCNOPL514GGACCCATGAACTTGAGTTTTTCCTTTGTAGATCTGAscan1GCATGGAGTCTTCACCATCAGCAGCGGCCGCAGCTGCATTGTTCTGGCCCGAscan 2GTCTATCTTCCTCTTCATTTGCAGCTGCTGCGGCCGCATGGTTTTCTTCAGCATCTTCAscan 3CGGTTTACCTTTTAGCATGGAGGCTGCAGCAGCAGCAGCGGCCGCAGC Open table in a new tab The PCR products were purified by phenol extraction and transformed together with gel-purified gapped NOP4 plasmids into yeast cells. Conditional lethal nop4 mutants were identified by assaying the inability of cells to lose the NOP4 SUP11 URA3plasmid, indicated by either a color sectoring phenotype or by sensitivity to 5-fluoroorotic acid at nonpermissive temperatures, and by direct assays of Ts−/Cs− phenotypes on YEPD medium after loss of the URA3-bearing plasmid on 5-fluoroorotic acid plates. Yeast transformants were replica-plated to medium that contained 0.01% 5-fluoroorotic acid and 0.1% proline as the only nitrogen source (19McCusker J.H. Davis R.W. Yeast. 1991; 7: 607-608Crossref PubMed Scopus (36) Google Scholar). After incubation for 3–4 days, plates were then replicated on YEPD medium and incubated at 13, 23, 30, and 37 °C. Colonies that could not grow at high or low temperatures were identified and patched on YEPD plates and confirmed by going through another round of plate replication and temperature sensitivity tests. The mutants were then subjected to a plasmid shuffling test to determine whether the mutant phenotype was due to mutations in the plasmid-borne NOP4 gene. By this means 30 temperature-sensitive (Ts−) but no cold-sensitive (Cs−) nop4 mutants were identified. Plasmids to be mutagenized were transformed into Escherichia coli strain CJ236, and single-stranded DNA was prepared from the transformants. Site-directed mutagenesis reactions were carried out as described by Kunkel et al. (20Kunkel T.A. Roberts J.D. Zakour R.A. Methods Enzymol. 1987; 154: 367-382Crossref PubMed Scopus (4560) Google Scholar). The mutation in each of the mutant genes was confirmed by sequencing NOP4. The sequences of the oligonucleotides used for mutagenesis are listed in Table II. Indirect immunofluorescence microscopy was performed on cells grown in YEPD, as described by Copeland and Snyder (21Copeland C. Snyder M. Yeast. 1993; 9: 235-249Crossref PubMed Scopus (19) Google Scholar). A modified scheme was established to use two mouse monoclonal antibodies directed against different yeast nucleolar proteins in the same experiment. Yeast cells were fixed at room temperature for 1 h with an equal volume of 7.4% formaldehyde prepared freshly from paraformaldehyde, and cell walls were removed by digestion with Zymolase 100-T (Seikagaku Corp.) at a concentration of 10 μg/ml and glucuronidase (Sigma) at a concentration of 40 μl/ml for 1 h at 30 °C. Approximately 1.5 × 107 cells were added to each well of a polylysine-coated glass slide; unattached cells were washed away by repeatedly adding buffer to the wells and aspirating with vacuum. Approximately 10 μl of the first primary antibody (anti-Nop1p) was applied to each well and incubated at 4 °C overnight. Cy3-conjugated goat anti-mouse Fab (Jackson ImmunoResearch) was used at 50 × dilution and incubated for 2 h at room temperature. The free Cy3 Fabs were then washed away by adding sorbitol buffer and 0.1% bovine serum albumin protein to the wells and aspirating with vacuum. Approximately 10 μl of the partially purified 28.3a (anti-Nop4p) at a concentration of 7 mg/ml was added to each well and incubated for 2 h at room temperature. After washing away the unbound 28.3a antibodies, the Cy5-conjugated goat anti-mouse IgG (Jackson ImmunoResearch) was applied to slides. Incubation proceeded at room temperature for 1 h before an extensive wash to remove the free Cy5 secondary antibody. A control experiment without application of the 28.3a antibody was included to ensure that the first primary antibody was saturated by the Cy3-conjugated Fab. To determine whether each of the four RRMs in Nop4 protein (Fig. 1 A) is important for its function, we assayed the effects of mutations inNOP4 predicted to compromise RNA binding of each RRM. X-ray diffraction and NMR spectroscopic studies of several RRM-containing proteins indicated that the RRM consists of four anti-parallel β-strands forming a β-sheet and two α-helices. Solvent exposed aromatic side chains in the most conserved RNP-1 and RNP-2 domains of the β-sheet form ring stacking interactions with RNA bases (12Burd C.G. Dreyfuss G. Science. 1994; 265: 615-621Crossref PubMed Scopus (1734) Google Scholar,22Nagai K. Oubridge C. Jessen T.H. Li J. Evans P.R. Nature. 1990; 348: 515-520Crossref PubMed Scopus (551) Google Scholar, 23Hoffman D.W. Query C.C. Golden B.L. White S.W. Keene J.D. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 2495-2499Crossref PubMed Scopus (166) Google Scholar, 24Gorlach M. Wittekind M. Beckman R.A. Mueller L. Dreyfuss G. EMBO J. 1992; 11: 3289-3295Crossref PubMed Scopus (162) Google Scholar, 25Garrett D.S. Lodi P.J. Shamoo Y. Williams K.R. Clore G.M. Gronenborn A.M. Biochemistry. 1994; 33: 2852-2858Crossref PubMed Scopus (46) Google Scholar, 26Howe P.W. Nagai K. Neuhaus D. Varanni G. EMBO J. 1994; 13: 3873-3881Crossref PubMed Scopus (67) Google Scholar, 27Lee A.L. Kanaar R. Rio D.C. Wemmer D.E. Biochemistry. 1994; 33: 13775-13786Crossref PubMed Scopus (60) Google Scholar, 28Nagai K. Oubridge C. Ito N. Avis J. Evans P. Trends Biochem. Sci. 1995; 20: 235-240Abstract Full Text PDF PubMed Scopus (202) Google Scholar, 29Nagai K. Mattaj I.W. RNA-Protein Interactions. IRL Press at Oxford University Press, Oxford1994: 150-177Google Scholar, 30Oubridge C. Ito N. Evans P.R. Teo C.-H. Nagai K. Nature. 1994; 372: 432-438Crossref PubMed Scopus (784) Google Scholar). Mutation of these aromatic residues disrupts RNA binding or otherwise inactivates RRM-containing proteins (22Nagai K. Oubridge C. Jessen T.H. Li J. Evans P.R. Nature. 1990; 348: 515-520Crossref PubMed Scopus (551) Google Scholar, 31Scherly D. Boelens W. van Venrooij W.J. Dathan N.A. Hamm J. Mattaj I.W. EMBO J. 1989; 8: 4163-4170Crossref PubMed Scopus (255) Google Scholar, 32Surowy C.S. van Santen V.L. Scheib-Wixted S.M. Spritz R.A. Mol. Cell. Biol. 1989; 9: 4179-4186Crossref PubMed Scopus (61) Google Scholar, 33Brennan C.A. Platt T. J. Biol. Chem. 1991; 266: 17296-17305Abstract Full Text PDF PubMed Google Scholar, 34Boelens W. Scherly D. Jansen E.J.R. Kolen K. Mattaj I.W. van Venrooij W.J. Nucleic Acids Res. 1991; 19: 4611-4618Crossref PubMed Scopus (31) Google Scholar, 35Jessen T.-H. Oubridge C. Teo C.H. Pritchard C. Nagai K. EMBO J. 1991; 10: 3447-3456Crossref PubMed Scopus (166) Google Scholar, 36Shannon K.W. Guthrie C. Genes Dev. 1991; 5: 773-785Crossref PubMed Scopus (106) Google Scholar, 37Cáceres J.F. Krainer A.R. EMBO J. 1993; 12: 4715-4726Crossref PubMed Scopus (218) Google Scholar, 38Liao X.C. Tang J. Rosbash M. Genes Dev. 1993; 7: 419-428Crossref PubMed Scopus (82) Google Scholar, 39Zuo P. Manley J.L. EMBO J. 1993; 12: 4727-4737Crossref PubMed Scopus (160) Google Scholar, 40Abovich N. Liao X.C. Rosbash M. Genes Dev. 1994; 8: 843-854Crossref PubMed Scopus (172) Google Scholar, 41Mayeda A. Munroe S.H. Cáceres J.F. Krainer A.R. EMBO J. 1994; 13: 5483-5495Crossref PubMed Scopus (280) Google Scholar, 42Lee M.S. Henry M. Silver P.A. Genes Dev. 1996; 10: 1233-1246Crossref PubMed Scopus (258) Google Scholar). We constructed site-directed mutations in the most conserved Phe residues of RNP-1 in RRM1, RRM2, and RRM3 of NOP4 as shown in Fig. 1 B. nop4-11 contains Phe-68 → Leu and Phe-70 → Leu mutations in RNP-1 of RRM1, nop4-18contains a Phe-192 → Leu mutation in RNP-1 of RRM2, andnop4-19 contains a Phe-335 → Leu mutation in RNP-1 of RRM3. nop4-3, which was recovered in a screen for conditional lethal nop4 alleles (see below), contains a Phe-557 → Leu mutation in RNP-1 of RRM4. The phenotype resulting from each of these mutations was assayed in strains containing a nop4::TRP1 genomic disruption and a low copy CEN plasmid bearing the mutantnop4 gene. Each of these nop4 mutants is temperature-sensitive for growth, i.e. grows well at 30 °C but is unable to grow at 37 °C. To ascertain whether these four Ts− nop4 mutants were defective in ribosome biogenesis, lysates were prepared from each strain grown at 30 °C or after shifting to 37 °C for 4 h and subjected to sucrose gradient centrifugation to display 40 S and 60 S ribosomal subunits, monoribosomes, and polyribosomes. As shown in Fig.2, each of the nop4 mutants is deficient in 60 S ribosomal subunits at 37 °C, as indicated by a decreased ratio of free 60 S ribosomal subunits to 40 S subunits compared with wild type NOP4 yeast, and accumulation of half-mer polyribosomes (9Sun C. Woolford Jr., J.L. EMBO J. 1994; 13: 3127-3135Crossref PubMed Scopus (86) Google Scholar, 43Rotenberg M.O. Moritz M. Woolford Jr., J.L. Genes Dev. 1988; 2: 160-172Crossref PubMed Scopus (121) Google Scholar, 44Moritz M. Paulovich A.G. Tsay T.-F. Woolford Jr., J.L. J. Cell Biol. 1990; 111: 2261-2274Crossref PubMed Scopus (97) Google Scholar). Most of these nop4mutants exhibit similar shortages of 60 S subunits 2 or 3 h after shifting to 37 °C, compared with 4 h post-shift, and some (nop4-3 and nop4-19) are moderately deficient in 60 S subunits even when grown at 30 °C (Fig. 2 and data not shown). The ribosome deficiency phenotype of nop4-3 containing a Phe-557 → Leu mutation in RNP-1 of RRM4 indicates that RRM4 is important for Nop4p function. However, RRM4 may be an atypical RRM; the sequence of the amino-terminal 30 residues of RRM4 does not match the RRM consensus (10Bandziulis R.J. Swanson M.S. Dreyfuss G. Genes Dev. 1989; 3: 431-437Crossref PubMed Scopus (490) Google Scholar, 11Birney E. Kumar S. Krainer A.R. Nucleic Acids Res. 1993; 21: 5803-5816Crossref PubMed Scopus (589) Google Scholar, 12Burd C.G. Dreyfuss G. Science. 1994; 265: 615-621Crossref PubMed Scopus (1734) Google Scholar). In particular there is not a canonical RNP-2 sequence, and none of the conserved hydrophobic residues in predicted helix 1 are present in RRM4 (Fig. 1 B). To further test the importance of RRM4, we mutated Tyr-514 to Leu (nop4-16). The position of this Tyr residue within RNP-2 of RRM4 is similar to that of the highly conserved Tyr implicated in RNA binding of canonical RRMs (12Burd C.G. Dreyfuss G. Science. 1994; 265: 615-621Crossref PubMed Scopus (1734) Google Scholar, 28Nagai K. Oubridge C. Ito N. Avis J. Evans P. Trends Biochem. Sci. 1995; 20: 235-240Abstract Full Text PDF PubMed Scopus (202) Google Scholar, 29Nagai K. Mattaj I.W. RNA-Protein Interactions. IRL Press at Oxford University Press, Oxford1994: 150-177Google Scholar). The nop4-16 mutant containing the Tyr-514 → Leu mutation has a pronounced shortage of 60 S ribosomal subunits and accumulates half-mer polyribosomes at 37 °C (Fig. 4) but is not Ts− for growth (Fig.3). In summary, in vivophenotypes caused by these mutations in RRM1–RRM4 of Nop4p suggest that each of the four RRMs is important for Nop4p function.Figure 3Mutations in two RRMs cause a slightly more severe Ts− growth phenotype than single mutations in each RRM of Nop4p. Ten-fold serial dilutions of cultures were spotted on YEPD medium and incubated 2 days at 30 or 37 °C.View Large Image Figure ViewerDownload Hi-res image Download (PPT) We generated a set of temperature-sensitive nop4 mutants to further investigate functional domains of Nop4p. Thirty Ts− nop4 mutants were generated by PCR amplification and gap repair of NOP4. Six of these mutants,nop4-1–nop4-6, were chosen for further study. Analysis of these nop4 mutants as well as other site-directed nop4 mutants further indicates the necessity of the RRMs for Nop4p function. nop4-1 contains two mutations, Arg-170 → Gly in RRM2 and Phe-310 → Leu in a conserved Phe residue in RRM3 (Fig. 1 B). Thenop4-1 mutant is Ts− for growth and for accumulation of 60 S ribosomal subunits (Figs. 3 and4). To determine the significance of each individual amino acid change in nop4-1, mutants containing each of the single mutations were constructed by site-directed mutagenesis. nop4-8 contains Phe-310 → Leu andnop4-9 contains Arg-170 → Gly. Like the nop4-1mutant,nop4-8 and nop4-9 mutants are deficient in 60 S ribosomal subunits. The nop4-8 mutant is Ts− for growth, and nop4-9 shows a very leaky Ts− phenotype. The nop4-8 mutant exhibits more extreme Ts− and 60 S ribosomal subunit deficiency phenotypes than nop4-9 but is still less pronounced than those of the nop4-1 double mutant (Figs. 3 and 4), indicating that mutations in RRM2 and RRM3 may cause an additive phenotype in the double mutant. The nop4-2 mutant contains an Arg-152 → Gly mutation in RNP-2 of RRM2 and a Glu-214 → Asp mutation in the carboxyl terminus of RRM2 (Fig. 1). nop4-10, which contains the single Arg-152 → Gly mutation, was constructed by site-directed mutagenesis. nop4-10 and nop4-2have similar phenotypes, both are tight Ts− mutants, exhibit moderate deficiencies of 60 S ribosomal subunits at 30 °C, and have more pronounced shortages of 60 S ribosomal subunits at 37 °C (Figs. 3 and 4). Three of the Ts− nop4 mutants examined,nop4-4, nop4-5, and nop4-6, contain single missense mutations in the interval between RRM3 and RRM4, indicating that the linker region between RRM3 and RRM4 is also important for Nop4p function. Each of these mutants is Ts− for growth and for 60 S ribosomal subunit biogenesis (data not shown). To examine whether the observed nop4 mutant phenotypes described above simply result from decreased amounts of Nop4p, cell lysates were prepared from wild type and mutant strains at 30 °C and 3 h after shifting to 37 °C. Nop4p levels were examined by Western immunoblot analysis. The levels of mutant Nop4p were not significantly decreased compared with wild type protein, exceptnop4-10 and nop4-11 proteins (Fig.5). This suggests that, in most cases, Nop4p degradation is not the primary cause of the ribosome biogenesis defects observed in these mutants. The mutant phenotype of the alleles might result from mislocalization of the protein either as a result of inactivation of a nuclear localization sequence or as an indirect result of loss of binding to a nucleolar ligand. A nuclear localization sequence co-localizes with an RRM sequence in the U1 70K protein; mutations in an RRM prevent nuclear export of Npl3p and cause mislocalization of an Nsr1-β-gal fusion protein (42Lee M.S. Henry M. Silver P.A. Genes Dev. 1996; 10: 1233-1246Crossref PubMed Scopus (258) Google Scholar, 45Scherly D. Dathan N.A. Boelens W. van Venrooij W.J. Mattaj I.W. EMBO J. 1990; 9: 3675-3681Crossref PubMed Scopus (79) Google Scholar, 46Yan C. Mélèse T. J. Cell Biol. 1993; 123: 1081-1091Crossref PubMed Scopus (58) Google Scholar). To test these possibilities, the intracellular localization of the mutant Nop4 proteins encoded by nop4-1and nop4-3 was examined by indirect immunofluorescence microscopy. Localization of the nucleolar protein Nop1p was included as a control for nucleolar structure and for accessibility of individual cells to antibodies. Mutants were examined at 30 °C and 3 h after shifting to 37 °C when ribosome deficiency phenotypes are more severe. Each mutant protein is localized to the nucleolus at both temperatures (Fig. 6 B and data not shown), identical to wild type Nop4p (Fig. 6 A). Nucleolar structure is not detectably perturbed in thesenop4 mutants, as both anti-Nop1p and anti-Nop4p antibodies stained an identical crescent-shaped pattern, as seen in wild type cells. Thus, mislocalization of Nop4p is not apparent as a result of mutations in the RRMs. The importance of the two acidic domains of Nop4p between RRM1 and RRM2 and between RRM2 and RRM3 was tested by assaying the effects of deleting portions of either or both domains or replacing residues within each with alanine. Deletion of residues 131–140, eight of which are Asp or Glu (nop4-14 mutation), or deletion of amino acids 250–267, 14/18 of which are Asp or Glu (nop4-13), does not cause any discernible effect on growth or ribosome biogenesis (data not shown). However, deletion of both acidic motifs (nop4-15) is lethal. The acidic domains may play critical but redundant roles; alternatively, lethality of the double deletion may be caused by disruption of Nop4p structure. To test these possibilities and to discern the minimal length of acidic peptide sufficient for essential Nop4p function, additional deletion and alanine replacement mutations were constructed in which most of the acidic residues in one of the two acidic domains were deleted, and many of the acidic residues in the other motif were changed to alanine. Thenop4-20 mutation contains the Δ250–267 deletion and residues 131–135 (EDEDD) are changed to alanine. nop4-21contains the Δ131–140 deletion, and residues 250–256 (EDAEENH) are changed to ala" @default.
• W2046890979 created "2016-06-24" @default.
• W2046890979 creator A5049547809 @default.
• W2046890979 creator A5088881927 @default.
• W2046890979 date "1997-10-01" @default.
• W2046890979 modified "2023-09-27" @default.
• W2046890979 title "The Yeast Nucleolar Protein Nop4p Contains Four RNA Recognition Motifs Necessary for Ribosome Biogenesis" @default.
• W2046890979 cites W107010543 @default.
• W2046890979 cites W1421420331 @default.
• W2046890979 cites W1529739927 @default.
• W2046890979 cites W1552234482 @default.
• W2046890979 cites W1555039620 @default.
• W2046890979 cites W1563142811 @default.
• W2046890979 cites W1688901160 @default.
• W2046890979 cites W1699218328 @default.
• W2046890979 cites W1966123525 @default.
• W2046890979 cites W1967554461 @default.
• W2046890979 cites W1973782344 @default.
• W2046890979 cites W1975593876 @default.
• W2046890979 cites W1987336694 @default.
• W2046890979 cites W1990301074 @default.
• W2046890979 cites W1993926172 @default.
• W2046890979 cites W1998029045 @default.
• W2046890979 cites W2010216951 @default.
• W2046890979 cites W2013094037 @default.
• W2046890979 cites W2013399419 @default.
• W2046890979 cites W2013446898 @default.
• W2046890979 cites W2027726125 @default.
• W2046890979 cites W2027999077 @default.
• W2046890979 cites W2031750036 @default.
• W2046890979 cites W2034890717 @default.
• W2046890979 cites W2036116609 @default.
• W2046890979 cites W2040321397 @default.
• W2046890979 cites W2041815688 @default.
• W2046890979 cites W2044050650 @default.
• W2046890979 cites W2052800266 @default.
• W2046890979 cites W2063887644 @default.
• W2046890979 cites W2072174598 @default.
• W2046890979 cites W2075988374 @default.
• W2046890979 cites W2076849957 @default.
• W2046890979 cites W2079169227 @default.
• W2046890979 cites W2084813596 @default.
• W2046890979 cites W2097054401 @default.
• W2046890979 cites W2097343134 @default.
• W2046890979 cites W2097436619 @default.
• W2046890979 cites W2101679570 @default.
• W2046890979 cites W2106767328 @default.
• W2046890979 cites W2109422606 @default.
• W2046890979 cites W2122538520 @default.
• W2046890979 cites W2125383490 @default.
• W2046890979 cites W2126139416 @default.
• W2046890979 cites W2146024983 @default.
• W2046890979 cites W2162093038 @default.
• W2046890979 cites W2165543326 @default.
• W2046890979 cites W2262520941 @default.
• W2046890979 cites W2297933289 @default.
• W2046890979 cites W230451612 @default.
• W2046890979 cites W235098460 @default.
• W2046890979 cites W268783301 @default.
• W2046890979 cites W2888511473 @default.
• W2046890979 cites W4235578231 @default.
• W2046890979 cites W4251695548 @default.
• W2046890979 cites W77934935 @default.
• W2046890979 doi "https://doi.org/10.1074/jbc.272.40.25345" @default.
• W2046890979 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9312154" @default.
• W2046890979 hasPublicationYear "1997" @default.
• W2046890979 type Work @default.
• W2046890979 sameAs 2046890979 @default.
• W2046890979 citedByCount "28" @default.
• W2046890979 countsByYear W20468909792012 @default.
• W2046890979 countsByYear W20468909792014 @default.
• W2046890979 countsByYear W20468909792015 @default.
• W2046890979 countsByYear W20468909792016 @default.
• W2046890979 countsByYear W20468909792017 @default.
• W2046890979 countsByYear W20468909792021 @default.
• W2046890979 crossrefType "journal-article" @default.
• W2046890979 hasAuthorship W2046890979A5049547809 @default.
• W2046890979 hasAuthorship W2046890979A5088881927 @default.
• W2046890979 hasBestOaLocation W20468909791 @default.
• W2046890979 hasConcept C104317684 @default.
• W2046890979 hasConcept C105580179 @default.
• W2046890979 hasConcept C131934819 @default.
• W2046890979 hasConcept C149364088 @default.
• W2046890979 hasConcept C2779222958 @default.
• W2046890979 hasConcept C2779419633 @default.
• W2046890979 hasConcept C41282012 @default.
• W2046890979 hasConcept C54355233 @default.
• W2046890979 hasConcept C67705224 @default.
• W2046890979 hasConcept C70721500 @default.
• W2046890979 hasConcept C86803240 @default.
• W2046890979 hasConcept C88478588 @default.
• W2046890979 hasConcept C95444343 @default.
• W2046890979 hasConceptScore W2046890979C104317684 @default.
• W2046890979 hasConceptScore W2046890979C105580179 @default.
• W2046890979 hasConceptScore W2046890979C131934819 @default.
• W2046890979 hasConceptScore W2046890979C149364088 @default.
• W2046890979 hasConceptScore W2046890979C2779222958 @default.
• W2046890979 hasConceptScore W2046890979C2779419633 @default.

• next