FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2047560376> ?p ?o ?g. }

• W2047560376 endingPage "32956" @default.
• W2047560376 startingPage "32944" @default.
• W2047560376 abstract "Perturbations in neuregulin-1 (NRG1)/ErbB4 function have been associated with schizophrenia. Affected patients exhibit altered levels of these proteins and display hypofunction of glutamatergic synapses as well as altered neuronal circuitry. However, the role of NRG1/ErbB4 in regulating synapse maturation and neuronal process formation has not been extensively examined. Here we demonstrate that ErbB4 is expressed in inhibitory interneurons at both excitatory and inhibitory postsynaptic sites. Overexpression of ErbB4 postsynaptically enhances size but not number of presynaptic inputs. Conversely, knockdown of ErbB4 using shRNA decreases the size of presynaptic inputs, demonstrating a specific role for endogenous ErbB4 in synapse maturation. Using ErbB4 mutant constructs, we demonstrate that ErbB4-mediated synapse maturation requires its extracellular domain, whereas its tyrosine kinase activity is dispensable for this process. We also demonstrate that depletion of ErbB4 decreases the number of primary neurites and that stimulation of ErbB4 using a soluble form of NRG1 results in exuberant dendritic arborization through activation of the tyrosine kinase domain of ErbB4 and the phosphoinositide 3-kinase pathway. These findings demonstrate that NRG1/ErbB4 signaling differentially regulates synapse maturation and dendritic morphology via two distinct mechanisms involving trans-synaptic signaling and tyrosine kinase activity, respectively. Perturbations in neuregulin-1 (NRG1)/ErbB4 function have been associated with schizophrenia. Affected patients exhibit altered levels of these proteins and display hypofunction of glutamatergic synapses as well as altered neuronal circuitry. However, the role of NRG1/ErbB4 in regulating synapse maturation and neuronal process formation has not been extensively examined. Here we demonstrate that ErbB4 is expressed in inhibitory interneurons at both excitatory and inhibitory postsynaptic sites. Overexpression of ErbB4 postsynaptically enhances size but not number of presynaptic inputs. Conversely, knockdown of ErbB4 using shRNA decreases the size of presynaptic inputs, demonstrating a specific role for endogenous ErbB4 in synapse maturation. Using ErbB4 mutant constructs, we demonstrate that ErbB4-mediated synapse maturation requires its extracellular domain, whereas its tyrosine kinase activity is dispensable for this process. We also demonstrate that depletion of ErbB4 decreases the number of primary neurites and that stimulation of ErbB4 using a soluble form of NRG1 results in exuberant dendritic arborization through activation of the tyrosine kinase domain of ErbB4 and the phosphoinositide 3-kinase pathway. These findings demonstrate that NRG1/ErbB4 signaling differentially regulates synapse maturation and dendritic morphology via two distinct mechanisms involving trans-synaptic signaling and tyrosine kinase activity, respectively. Although central nervous system synapses utilize a variety of brain-specific molecules to mediate contact formation and maturation, some of the proteins implicated in this process are also major players in neuromuscular junction development. Among these shared molecules are NRG1 3The abbreviations used are: NRG, neuregulin; PDZ, PDS-95/Dlg/ZO-1; PI3K, phosphoinositide 3-kinase; EGF, epidermal growth factor; PSD-95, postsynaptic density protein 95; HA, hemagglutinin; NL1, neuroligin-1; GFP, green fluorescent protein; VGLUT1, vesicular glutamate transporter-1; VGAT, vesicular GABA transporter; GABA, γ-aminobutyric acid; GAD, glutamic acid decarboxylase; SYN, synaptophysin; MAP2, microtubule-associated protein 2; MAPK, mitogen-activated protein kinase; DIV, days in vitro; KD, kinase dead; shRNA, short hairpin RNA. 3The abbreviations used are: NRG, neuregulin; PDZ, PDS-95/Dlg/ZO-1; PI3K, phosphoinositide 3-kinase; EGF, epidermal growth factor; PSD-95, postsynaptic density protein 95; HA, hemagglutinin; NL1, neuroligin-1; GFP, green fluorescent protein; VGLUT1, vesicular glutamate transporter-1; VGAT, vesicular GABA transporter; GABA, γ-aminobutyric acid; GAD, glutamic acid decarboxylase; SYN, synaptophysin; MAP2, microtubule-associated protein 2; MAPK, mitogen-activated protein kinase; DIV, days in vitro; KD, kinase dead; shRNA, short hairpin RNA. and its receptor, ErbB4, which are expressed in both the developing and adult brain. Neuregulins comprise a family of four related genes (nrg1-4), each producing a large number of isoforms via differential promoter usage and alternative splicing (1Buonanno A. Fischbach G.D. Curr. Opin. Neurobiol. 2001; 11: 287-296Crossref PubMed Scopus (422) Google Scholar, 2Mei L. Xiong W.C. Nat. Rev. Neurosci. 2008; 9: 437-452Crossref PubMed Scopus (764) Google Scholar). NRGs contain EGF-like repeats, which enable them to bind to and activate EGF family receptors (ErbB2-4). Previous studies showed that NRG1 is initially synthesized as a transmembrane protein, which then undergoes proteolytic processing, whereby the extracellular EGF-containing fragment is released into the extracellular environment. The remaining intracellular fragment has been shown to translocate into the nucleus, where it regulates neuronal survival and transcription of PSD-95 (3Bao J. Wolpowitz D. Role L.W. Talmage D.A. J. Cell Biol. 2003; 161: 1133-1141Crossref PubMed Scopus (206) Google Scholar, 4Bao, J., Lin, H., Ouyang, Y., Lei, D., Osman, A., Kim, T.-W., Mei, L., Dai, P., Ohlemiller, K. K., and Ambron, R. T. (2004) 7, 1250–1258Google Scholar). Proteolytic processing of NRG1 is also regulated by neuronal activity and by interaction with ErbB receptors (3Bao J. Wolpowitz D. Role L.W. Talmage D.A. J. Cell Biol. 2003; 161: 1133-1141Crossref PubMed Scopus (206) Google Scholar, 5Ozaki M. Itoh K. Miyakawa Y. Kishida H. Hashikawa T. J. Neurochem. 2004; 91: 176-188Crossref PubMed Scopus (71) Google Scholar). NRG1 is widely expressed throughout development and adulthood, with the highest expression in nervous tissue (6Corfas G. Rosen K.M. Aratake H. Krauss R. Fischbach G.D. Neuron. 1995; 14: 103-115Abstract Full Text PDF PubMed Scopus (209) Google Scholar) and is essential for survival. In the central nervous system NRG1 is also required for differentiation, migration, and development of neurons and glia as well as for axonal myelination and pathfinding, dendritic development, and neurotransmitter receptor maintenance. During development, NRG1-ErbB signaling mediates radial glia maintenance and elongation, whereas glial-derived NRG1 directs the migration of cortical and cerebellar neurons (7Anton E. Marchionni M. Lee K. Rakic P. Development. 1997; 124: 3501-3510Crossref PubMed Google Scholar, 8Rio C. Rieff H.I. Qi P. Khurana T.S. Corfas G. Neuron. 1997; 19: 39-50Abstract Full Text Full Text PDF PubMed Scopus (327) Google Scholar). Moreover, NRG1-ErbB4 signaling is required to direct axons of thalamocortical projections to their targets (9Lopez-Bendito G. Cautinat A. Sanchez J.A. Bielle F. Flames N. Garratt A.N. Talmage D.A. Role L.W. Charnay P. Marin O. Garel S. Cell. 2006; 125: 127-142Abstract Full Text Full Text PDF PubMed Scopus (297) Google Scholar). In the brain and spinal cord, NRG1 regulates oligodendrocyte differentiation, and in spinal cord explants from NRG1-/- mice, oligodendrocytes fail to develop (10Calaora V. Rogister B. Bismuth K. Murray K. Brandt H. Leprince P. Marchionni M. Dubois-Dalcq M. J. Neurosci. 2001; 21: 4740-4751Crossref PubMed Google Scholar, 11Canoll P.D. Musacchio J.M. Hardy R. Reynolds R. Marchionni M.A. Salzer J.L. Neuron. 1996; 17: 229-243Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar, 12Vartanian T. Fischbach G. Miller R. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 731-735Crossref PubMed Scopus (139) Google Scholar). NRG1 signaling is mediated through its receptors; that is, the ErbB family of proteins. There are four members in the ErbB family, named one through four. However, ErbB1 specifically binds EGF and does not respond to NRG1. ErbB2 contains the functional kinase domain but is unable to bind NRG1 (13Klapper L.N. Glathe S. Vaisman N. Hynes N.E. Andrews G.C. Sela M. Yarden Y. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 4995-5000Crossref PubMed Scopus (359) Google Scholar). ErbB3 on the other hand binds NRG1 but is unable to propagate the signal to the cells because of lack of kinase activity (14Guy P.M. Platko J.V. Cantley L.C. Cerione R.A. Carraway III, K.L. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8132-8136Crossref PubMed Scopus (586) Google Scholar). ErbB4 is a single-pass, 160-kDa transmembrane protein with extra- and intracellular regions of approximately equal size (15Carpenter G. Exp. Cell Res. 2003; 284: 66-77Crossref PubMed Scopus (201) Google Scholar, 16Plowman G.D. Culouscou J.M. Whitney G.S. Green J.M. Carlton G.W. Foy L. Neubauer M.G. Shoyab M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1746-1750Crossref PubMed Scopus (675) Google Scholar). A kinase domain is located within the intracellular region of ErbB4, which also contains a PDZ binding motif at the C terminus, enabling ErbB4 to interact with PDZ-domain containing proteins such as PSD-95 (17Huang Y.Z. Won S. Ali D.W. Wang Q. Tanowitz M. Du Q.S. Pelkey K.A. Yang D.J. Xiong W.C. Salter M.W. Mei L. Neuron. 2000; 26: 443-455Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar, 18Garcia R.A.G. Vasudevan K. Buonanno A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 3596-3601Crossref PubMed Scopus (243) Google Scholar). Several isoforms of ErbB4 occur due to alternative splicing of the gene: juxtamembrane-a and -b (JM-a and JM-b) isoforms differ in their sensitivity to proteolytic cleavage by TACE (tumor necrosis factor-α-converting enzyme) metalloprotease, with only the JM-a isoform being sensitive to this cleavage (19Rio C. Buxbaum J.D. Peschon J.J. Corfas G. J. Biol. Chem. 2000; 275: 10379-10387Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar). The CYT-1 isoform differs from CYT-2 in that it contains a PI3K binding region (15Carpenter G. Exp. Cell Res. 2003; 284: 66-77Crossref PubMed Scopus (201) Google Scholar). The presence of multiple ErbB4 isoforms and their differential distribution may contribute to the diversity of ErbB4 signaling. Although the function of the soluble extracellular fragment is unknown, it raises the possibility of retrograde signaling (15Carpenter G. Exp. Cell Res. 2003; 284: 66-77Crossref PubMed Scopus (201) Google Scholar). The intracellular fragment that remains after cleavage has been shown to act as a constitutive kinase (20Linggi B. Cheng Q.C. Rao A.R. Carpenter G. Oncogene. 2006; 25: 160-163Crossref PubMed Scopus (49) Google Scholar) and propagate signaling from the cell surface. ErbB4 interacts with PSD-95, SAP102, and b2-syntrophin, proteins enriched at the postsynaptic density (17Huang Y.Z. Won S. Ali D.W. Wang Q. Tanowitz M. Du Q.S. Pelkey K.A. Yang D.J. Xiong W.C. Salter M.W. Mei L. Neuron. 2000; 26: 443-455Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar, 18Garcia R.A.G. Vasudevan K. Buonanno A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 3596-3601Crossref PubMed Scopus (243) Google Scholar, 21Huang Y.Z. Wang Q. Won S. Luo Z.G. Xiong W.C. Mei L. Int. J. Dev. Neurosci. 2002; 20: 173-185Crossref PubMed Scopus (28) Google Scholar). Interestingly, the interaction between ErbB4 and PSD-95 is regulated by neuronal activity (22Xie F. Padival M. Siegel R.E. J. Neurochem. 2007; 100: 62-72Crossref PubMed Scopus (18) Google Scholar), and the increased interaction between these proteins is detected in brain lysates from schizophrenia patients (23Hahn C.G. Wang H.Y. Cho D.S. Talbot K. Gur R.E. Berrettini W.H. Bakshi K. Kamins J. Borgmann-Winter K.E. Siegel S.J. Gallop R.J. Arnold S.E. Nat. Med. 2006; 12: 824-828Crossref PubMed Scopus (479) Google Scholar). Moreover, previous findings showed that ErbB receptor-mediated NRG1 signaling modulates N-methyl-d-aspartate receptor (NMDAR) function (24Gu Z. Jiang Q. Fu A.K.Y. Ip N.Y. Yan Z. J. Neurosci. 2005; 25: 4974-4984Crossref PubMed Scopus (186) Google Scholar), indicating that NMDARs constitute an immediate target of NRG1/ErbB4 signaling. At the synapse, ErbB4 also interacts with and regulates activation of two non-receptor protein kinases, Fyn and pyk2. These molecules have been implicated in regulation of N-methyl-d-aspartate receptor phosphorylation and long term potentiation induction (25Bjarnadottir M. Misner D.L. Haverfield-Gross S. Bruun S. Helgason V.G. Stefansson H. Sigmundsson A. Firth D.R. Nielsen B. Stefansdottir R. Novak T.J. Stefansson K. Gurney M.E. Andresson T. J. Neurosci. 2007; 27: 4519-4529Crossref PubMed Scopus (153) Google Scholar). Here we examine the role of ErbB4 in synapse maturation and neuronal morphology in primary hippocampal cultures by overexpressing wild-type and mutant forms of ErbB4, knocking down endogenous protein, and/or treating cells with NRG1. We show that, although ErbB4 is not sufficient to induce presynaptic differentiation in neuron-COS7 cell co-cultures, ectopic expression of ErbB4 in dissociated hippocampal neurons enhances the size of presynaptic terminals contacting ErbB4-expressing cells. Furthermore, knockdown of endogenous ErbB4 results in a decrease in the size of presynaptic protein clusters. Interestingly, the number of presynaptic terminals is unchanged in cells with altered ErbB4 expression, highlighting a trans-synaptic role for ErbB4 in synapse maturation but not initial formation. Finally, we show that stimulation of ErbB4 signaling by NRG1 alters process outgrowth via activation of the PI3K signaling pathway. cDNA Cloning and Mutagenesis—The original full-length ErbB4 (JM-a, CYT-2 isoform) cDNA and ErbB4 shRNA constructs were gifts from Dr. Lin Mei. HA-tagged transmembrane isoform of neuregulin-1 (HA-NRG1) was a gift from Dr. Jianxin Bao (Medical College of Georgia, Augusta, Georgia). The HA tag (YPYDVPDYA) was inserted after amino acid 997. HA-tagged wild type NL1 amplified from mouse cerebellum was a gift from Dr. Peter Scheiffele (Columbia University). GFP transfections were carried out using pEGFP-C1 plasmid (Clontech). The generation of ErbB4-HA, ErbB4-HA ΔPDZb, and ErbB4-HA ΔNT, was carried out by PCR subcloning in two steps. First, a construct that contains the ErbB4 signal sequence followed by the HA tag (ss-HA) was generated by PCR using oligonucleotides containing AflII and XbaI restriction sites followed by subcloning the resulting fragment into the pCDNA3.1(+) vector (Invitrogen). Generation of the deletion mutants was carried out by PCR using oligonucleotides with the following restriction sites: ErbB4-HA ΔNT-NotI/XbaI (forward, ggactcGCGGCCGCCATTCCACTTTACCACAACATG; reverse, GGGCCCTCTAGATTACACCACAGTATTCC) and subcloning amplified fragments into the ss-HA construct. Finally, ErbB4-HA ΔPDZb was made by amplification of the intracellular region of ErbB4 using oligonucleotides containing KpnI and XbaI restriction sites (forward, GTATTTGGGTACCTGAAGGAG; reverse, GGGCCCTCTAGATTACCGGTGTCTGTAAGGTGG) and subcloning the resulting fragment into the ErbB4-HA ΔCT construct, restoring the full sequence of ErbB4 lacking only the last four amino acids. A single point mutation in the ErbB4 kinase domain (K751R) was introduced using the QuikChange site-directed mutagenesis kit (Stratagene). Briefly, the entire plasmid was amplified by PCR using oligonucleotides containing one base substitution (AAG → AGG) (GTGAAGATTCCTGTGGCTATTAGGATTCTTAATGAGACAACTGG), the template methylated strand was destroyed enzymatically with Dpn1, and purified construct was transformed into bacteria and verified by direct sequencing. All constructs were verified by direct sequencing. To suppress the expression of endogenous ErbB4, the pFUGW vectors expressing short hairpin RNAs specifically directed against rat ErbB4 (26Li B. Woo R.S. Mei L. Malinow R. Neuron. 2007; 54: 583-597Abstract Full Text Full Text PDF PubMed Scopus (283) Google Scholar) were transfected into hippocampal neurons using Lipofectamine 2000 (Invitrogen) 3 or 5 days before. The target sequences of two short hairpin RNAs for erbB4 are 5′-CCAGACTACCTGCAGGAATAC-3′ (hp2) and 5′-GCCCGCAATGTGTTGGTGAAA-3′ (hp3). A vector expressing GFP was used as a control. Cell Culture and Mixed Culture Assay—Dissociated primary neuronal cultures were prepared from hippocampi of embryonic day 18/19 Wistar rats. Cells were dissociated by papain digestion followed by brief mechanical trituration and plated on poly-d (or l)-lysine (Sigma)-treated coverslips at a density of 105 per 8-mm glass coverslip in minimal essential medium (Invitrogen) supplemented with 10% fetal bovine serum (Hyclone), glucose (Sigma), sodium pyruvate, GlutaMAX, and penicillin/streptomycin (Invitrogen). After 2 h the medium was replaced with NeuroBasal medium (Invitrogen) supplemented with B-27, GlutaMAX, and penicillin/streptomycin (Invitrogen) as previously described (27Brewer G.J. Torricelli J.R. Evege E.K. Price P.J. J. Neurosci. Res. 1993; 35: 567-576Crossref PubMed Scopus (1883) Google Scholar). Every 3-4 days, half of the volume of maintenance medium was taken out and replaced with fresh solution. Cultures were transfected by lipid-mediated gene transfer using Lipofectamine 2000 reagent following the manufacturer's protocol (Invitrogen) or by the calcium phosphate technique (Clontech) as previously described (28Jiang M. Deng L. Chen G. Gene Ther. 2004; 11: 1303-1311Crossref PubMed Scopus (50) Google Scholar). COS7 cells were grown in Dulbecco's modified Eagle medium (Invitrogen) supplemented with 10% fetal bovine serum (Hyclone), sodium pyruvate, and penicillin/streptomycin (Invitrogen). For protein expression cells were transfected with Lipofectamine 2000 reagent (Invitrogen) and collected/fixed 24-36 h later. Neuron-COS7 cell co-cultures were performed as previously described (29Graf E.R. Kang Y. Hauner A.M. Craig A.M. J. Neurosci. 2006; 26: 4256-4265Crossref PubMed Scopus (131) Google Scholar). Briefly, neurons were grown on glass coverslips suspended above a glial feeder layer in minimal essential medium with N2 supplements. COS7 cells were transfected with Lipofectamine 2000 (Invitrogen) and trypsinized 24 h later. Cells were washed twice with fetal bovine serum-supplemented Dulbecco's modified Eagle's medium and plated onto neurons that had been pre-grown for 9-10 days. COS7 cells were allowed to adhere and grow on neurons for 24 h before fixation. HEK293 cells were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum (Hyclone), sodium pyruvate, and penicillin/streptomycin (Invitrogen). For protein expression, cells were transfected with Lipofectamine 2000 reagent (Invitrogen) for 12 h, grown for an additional 6 h, collected, and resuspended in Dulbecco's modified Eagle's medium. To examine transcellular interaction between proteins, cells transfected with the appropriate constructs were co-cultured on 10-mm glass coverslips (Fisher) and allowed to grow for 24 h before fixation with 4% paraformaldehyde supplemented with 4% sucrose (Sigma). Immunocytochemistry and Reagents—Coverslips were fixed in −20 °C methanol for staining for synaptic proteins or in 4% paraformaldehyde with 4% sucrose (Sigma) and permeabilized with 0.3% Triton-X-100 in phosphate-buffered saline. The following primary antibody solutions were used: HA (mouse, 1:1000, Berkeley Antibody Co., Inc., and rat, 1:1000, Roche Applied Science), GFP (chicken, 1:1000, Abcam), synaptophysin (mouse, 1:1000, Sigma, and rabbit, 1:500, Pharmingen), VGLUT1 (rabbit, 1:1000, Synaptic Systems and guinea pig, 1:2000, Chemicon), VGAT (rabbit, 1:1000, Synaptic Systems and Chemicon), PSD-95 (mouse 1:500, Affinity BioReagents, and rabbit, custom made by Affinity BioReagents), gephyrin (mouse, 1:1000, Synaptic Systems), ErbB4 (mouse, 1:200, Neo-Markers, and rabbit, 1:200, Santa Cruz), MAP2 (mouse, 1:500, BD Pharmingen), and p-ErbB4 (mouse, Cell Signaling). Secondary antibodies were generated in goat and conjugated with Alexa 488 (1:1000), Alexa 568 (1:1000, Molecular Probes), or aminomethyl coumarin acetate (1:100, Jackson ImmunoResearch). All antibody reactions were performed in blocking solution containing 2% normal goat serum for 1 h at room temperature or overnight at 4 °C. Preparation and purification of the protein coding for the extracellular domain of ErbB4 fused to Fc (ecto-ErbB4) was previously described (30Woo R.S. Li X.M. Tao Y. Carpenter-Hyland E. Huang Y.Z. Weber J. Neiswender H. Dong X.P. Wu J. Gassmann M. Lai C. Xiong W.C. Gao T.M. Mei L. Neuron. 2007; 54: 599-610Abstract Full Text Full Text PDF PubMed Scopus (237) Google Scholar). Human recombinant NRG1 containing the EGF motif was purchased from R&D Systems (Minneapolis, MN), resuspended in phosphate-buffered saline with 0.1% bovine serum albumin at a concentration of 10 mg/ml, separated into aliquots, and stored at −20 °C. PI3K inhibitor (LY 294002) and MAPK inhibitor (PD 98059) were purchased from Calbiochem and resuspended in dimethyl sulfoxide at a concentration of 10 mm and 5 mg/ml, respectively, separated into aliquots, and stored at −20 °C. For tissue section immunohistochemistry, adult (postnatal day 120) female rat brains were rapidly extracted, embedded in OCT medium, and flash-frozen in isopentane cooled in liquid nitrogen. Sections were cut on a cryostat at thicknesses of 8 mm to allow detection of synaptic puncta. Sections were kept frozen until fixation in −20 °C methanol for 10 min. After thorough washing in phosphate-buffered saline, sections were incubated in blocking solution (2.5% bovine serum albumin, 0.1% Triton-X-100, 0.02% sodium azide) for 45 min followed by primary antibody diluted in blocking solution overnight at 4 °C. After washing, sections were incubated with Alexa-conjugated secondary antibodies (fluorescent immunohistochemistry; Molecular Probes) and mounted with Fluoromount-G (Southern Biotechnology Associates, Birmingham, AL). Western Blotting—To assess phosphorylation levels of ErbB4 deletion mutants, constructs were transfected into COS7 cells for 24 h, and proteins were analyzed by Western blot. COS7 cells were washed with ice-cold phosphate-buffered saline and resuspended in 500 μl of lysis buffer containing 20 mm HEPES, pH 7.0, 0.5% deoxycholic acid, 0.1% Nonidet P-40, 150 mm NaCl, 2 mm EDTA, 10 mm NaF, 2 mm sodium orthovanadate, 0.25 mm phenylmethylsulfonyl fluoride, and 1 protease inhibitor tablet/10 ml (Roche Applied Science). After extracting for 20 min at 4 °C, insoluble material was removed by centrifugation at 13,000 × g for 15 min at 4 °C. Samples were boiled for 3 min upon the addition of 4× SDS-PAGE sample buffer containing 10% β-mercaptoethanol and analyzed by SDS-PAGE. Nitrocellulose membranes were blocked in 1% bovine serum albumin or 5% milk and incubated with primary antibody solutions overnight at 4 °C. Western blot signals were detected with the Odyssey machine (Li-Cor) using infrared-conjugated antibodies as previously described (31Swayze R.D. Lise M.F. Levinson J.N. Phillips A. El-Husseini A. Neuropharmacology. 2004; 47: 764-778Crossref PubMed Scopus (48) Google Scholar) or by ECL (Amersham Biosciences). Imaging and Analysis—Images were acquired on a Zeiss Axiovert M200 motorized microscope with a 63 × 1.4 NA ACROMAT oil immersion lens and a monochrome 14-bit Zeiss Axiocam HR charge-coupled camera with 1300 × 1030 pixels. The exposure time was adjusted per individual experiment to achieve maximal brightness without saturation; for intensity measurement experiments, all pictures were taken at equal exposure for all experimental conditions. To correct for out-of focus areas within the field of view, focal plane (z) stacks were collected, and maximum intensity projections were compiled. Images were scaled to 16 bits and analyzed in Northern Eclipse (Empix Imaging Inc., Mississauga, ON, Canada) using custom written software routines as previously described (32Prange O. Wong T.P. Gerrow K. Wang Y.T. El-Husseini A. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 13915-13920Crossref PubMed Scopus (289) Google Scholar). In brief, images were processed at a constant threshold level (of 32,000 pixel values), and dendrites visualized by immunofluorescence signal were outlined. Only clusters with average pixel values three times greater than background (diffuse dendritic shaft pixel values) were selected for analysis. The number of dendritic clusters per unit length was measured as a function of dendritic length and normalized to controls. For intensity analysis, the average background intensity was subtracted from the average intensity of individual puncta and multiplied by the puncta area to obtain integrated intensity. For colocalization analysis, background-subtracted immunofluorescence clusters for all imaging channels (red, green, and blue) were correlated for overlapping signal. Colocalization was scored if clusters in two channels were overlapping by at least 1 pixel for a postsynaptic and presynaptic protein. Two-tailed Student's t test was performed to calculate the statistical significance of results between experimental groups. To quantify the extent of protein accumulation at the area of cell-cell contact in HEK cell experiments, a line was drawn through the area of contact, and pixel intensity was measured using ImageJ software. Average intensity was then normalized to the level of protein expression in the cell in question, which was determined by taking the average intensity along a line of equal length drawn through the cell body. To analyze the ability of ErbB4 expressed in heterologous cells to induce clustering of VGLUT1 and VGAT, a co-culture system was used. COS7 cells transfected with ErbB4 or NL1 were co-cultured with hippocampal neurons. Immunostaining for VGLUT1/PSD-95 and VGAT/gephyrin combinations was used to assess the induction of excitatory and inhibitory presynaptic terminals, respectively. Random ErbB4- or NL1-immunopositive COS cells showing contact with neuronal processes by phase contrast were classified as to whether they exhibited any associated clusters of VGLUT1 lacking PSD95 or VGAT lacking gephyrin (presumed induced clusters in the contacting axons). Localization of Endogenous ErbB4 at Excitatory and Inhibitory Synapses—Previous studies have demonstrated that ErbB4 expression is restricted to inhibitory GABAergic interneurons of the developing and adult cortex and hippocampus (33Flames N. Long J.E. Garratt A.N. Fischer T.M. Gassmann M. Birchmeier C. Lai C. Rubenstein J.L. Marin O. Neuron. 2004; 44: 251-261Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar, 34Fox I.J. Kornblum H.I. J. Neurosci. Res. 2005; 79: 584-597Crossref PubMed Scopus (85) Google Scholar, 35Yau H.J. Wang H.F. Lai C. Liu F.C. Cereb. Cortex. 2003; 13: 252-264Crossref PubMed Scopus (169) Google Scholar). Consistent with this, ErbB4 expression in dissociated hippocampal neurons at DIV 14 demonstrated a punctate pattern of immunostaining in neurons positive for the inhibitory neuronal markers, VGAT and GAD65 (the GABA synthesizing enzyme), with no signal detectable in GAD65-negative cells (Fig. 1A and data not shown). Other studies have demonstrated that ErbB4 clusters at synaptic sites and colocalizes with a number of markers for excitatory synapses, including the NR1 subunit of N-methyl-d-aspartate receptors and PSD-95 (17Huang Y.Z. Won S. Ali D.W. Wang Q. Tanowitz M. Du Q.S. Pelkey K.A. Yang D.J. Xiong W.C. Salter M.W. Mei L. Neuron. 2000; 26: 443-455Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar). As inhibitory neurons receive both excitatory and inhibitory inputs, we assessed the distribution of ErbB4 at excitatory and inhibitory synapses. Hippocampal neurons were double-labeled with ErbB4 and either VGLUT1 or VGAT, markers for excitatory or inhibitory presynaptic terminals, respectively (Fig. 1A). Consistent with previous findings, a significant proportion of ErbB4 clusters (64 ± 3%) was associated with VGLUT1-positive puncta (Fig. 1B). However, a smaller proportion of ErbB4 clusters (32 ± 6%) were apposed to VGAT puncta (Fig. 1B), indicating that ErbB4 is present not only at excitatory but also at a subset of inhibitory postsynaptic sites. Together these results indicate that ErbB4 is expressed in inhibitory GABAergic hippocampal interneurons and is localized largely at the postsynaptic compartment of excitatory synapses, with a smaller proportion found at inhibitory contacts. To confirm that the localization of ErbB4 at inhibitory contacts is not an artifact of the culture system, we immunostained adult rat brain sections for ErbB4 and the inhibitory postsynaptic marker, gephyrin. In the cortex and hippocampus, expression of ErbB4 was limited to GABAergic interneurons (data not shown). A proportion of ErbB4 clusters was colocalized with gephyrin, consistent with the localization of a subset of ErbB4 at inhibitory synapses (Fig. 1C). ErbB4 Overexpression Enhances the Maturation of Presynaptic Terminals—To determine the role of ErbB4 at the synapse at early stages of neuronal development, we generated an HA-tagged version of full-length ErbB4, placing the tag immediately after the tyrosine kinase domain to avoid interference with PDZ-dependent interactions (see Fig. A) (17Huang Y.Z. Won S. Ali D.W. Wang Q. Tanowitz M. Du Q.S. Pelkey K.A. Yang D.J. Xiong W.C. Salter M.W. Mei L. Neuron. 2000; 26: 443-455Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar). This construct was then expressed in dissociated embryonic hippocampal neurons at DIV 5-6 followed by fixation at DIV 10-11, a period at which synaptogenesis occurs. Levels of ectopic ErbB4 expression in excitatory neurons were comparable with endogenous ErbB4 levels observed in inhibitory neurons (supplemental Fig. 1). Synapses were visualized by immunostaining cultures with the presynaptic terminal marker, synaptophysin (SYN) (Fig. 2A). Analysis revealed an increase" @default.
• W2047560376 created "2016-06-24" @default.
• W2047560376 creator A5004457437 @default.
• W2047560376 creator A5028582943 @default.
• W2047560376 creator A5037736308 @default.
• W2047560376 creator A5041209867 @default.
• W2047560376 creator A5048422098 @default.
• W2047560376 creator A5063001738 @default.
• W2047560376 creator A5063642770 @default.
• W2047560376 creator A5065412838 @default.
• W2047560376 creator A5069578522 @default.
• W2047560376 creator A5070827663 @default.
• W2047560376 creator A5074670767 @default.
• W2047560376 date "2008-11-01" @default.
• W2047560376 modified "2023-10-17" @default.
• W2047560376 title "ErbB4-Neuregulin Signaling Modulates Synapse Development and Dendritic Arborization through Distinct Mechanisms" @default.
• W2047560376 cites W1487695731 @default.
• W2047560376 cites W1502719441 @default.
• W2047560376 cites W1973310884 @default.
• W2047560376 cites W1980073907 @default.
• W2047560376 cites W1987932743 @default.
• W2047560376 cites W1994124220 @default.
• W2047560376 cites W2001837017 @default.
• W2047560376 cites W2006376420 @default.
• W2047560376 cites W2011818792 @default.
• W2047560376 cites W2014111401 @default.
• W2047560376 cites W2016500240 @default.
• W2047560376 cites W2016717347 @default.
• W2047560376 cites W2019184486 @default.
• W2047560376 cites W2019797166 @default.
• W2047560376 cites W2020237866 @default.
• W2047560376 cites W2020748502 @default.
• W2047560376 cites W2023368138 @default.
• W2047560376 cites W2023673693 @default.
• W2047560376 cites W2026238257 @default.
• W2047560376 cites W2026376328 @default.
• W2047560376 cites W2034802813 @default.
• W2047560376 cites W2043345702 @default.
• W2047560376 cites W2043467783 @default.
• W2047560376 cites W2046165746 @default.
• W2047560376 cites W2047007360 @default.
• W2047560376 cites W2048202372 @default.
• W2047560376 cites W2054235364 @default.
• W2047560376 cites W2055142305 @default.
• W2047560376 cites W2061684042 @default.
• W2047560376 cites W2064313800 @default.
• W2047560376 cites W2065725389 @default.
• W2047560376 cites W2067245921 @default.
• W2047560376 cites W2073382375 @default.
• W2047560376 cites W2074320983 @default.
• W2047560376 cites W2076682664 @default.
• W2047560376 cites W2080399383 @default.
• W2047560376 cites W2081695461 @default.
• W2047560376 cites W2083616536 @default.
• W2047560376 cites W2084200464 @default.
• W2047560376 cites W2089762801 @default.
• W2047560376 cites W2103245406 @default.
• W2047560376 cites W2104948489 @default.
• W2047560376 cites W2106584815 @default.
• W2047560376 cites W2106951973 @default.
• W2047560376 cites W2116323570 @default.
• W2047560376 cites W2116774419 @default.
• W2047560376 cites W2120598509 @default.
• W2047560376 cites W2122788299 @default.
• W2047560376 cites W2125705356 @default.
• W2047560376 cites W2128960139 @default.
• W2047560376 cites W2131192891 @default.
• W2047560376 cites W2131545168 @default.
• W2047560376 cites W2140486223 @default.
• W2047560376 cites W2157007804 @default.
• W2047560376 cites W2171641108 @default.
• W2047560376 cites W4321429485 @default.
• W2047560376 doi "https://doi.org/10.1074/jbc.m800073200" @default.
• W2047560376 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/5395083" @default.
• W2047560376 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18819924" @default.
• W2047560376 hasPublicationYear "2008" @default.
• W2047560376 type Work @default.
• W2047560376 sameAs 2047560376 @default.
• W2047560376 citedByCount "103" @default.
• W2047560376 countsByYear W20475603762012 @default.
• W2047560376 countsByYear W20475603762013 @default.
• W2047560376 countsByYear W20475603762014 @default.
• W2047560376 countsByYear W20475603762015 @default.
• W2047560376 countsByYear W20475603762016 @default.
• W2047560376 countsByYear W20475603762017 @default.
• W2047560376 countsByYear W20475603762018 @default.
• W2047560376 countsByYear W20475603762019 @default.
• W2047560376 countsByYear W20475603762020 @default.
• W2047560376 countsByYear W20475603762021 @default.
• W2047560376 countsByYear W20475603762022 @default.
• W2047560376 countsByYear W20475603762023 @default.
• W2047560376 crossrefType "journal-article" @default.
• W2047560376 hasAuthorship W2047560376A5004457437 @default.
• W2047560376 hasAuthorship W2047560376A5028582943 @default.
• W2047560376 hasAuthorship W2047560376A5037736308 @default.
• W2047560376 hasAuthorship W2047560376A5041209867 @default.
• W2047560376 hasAuthorship W2047560376A5048422098 @default.
• W2047560376 hasAuthorship W2047560376A5063001738 @default.

• next