FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2047572414> ?p ?o ?g. }

• W2047572414 endingPage "22999" @default.
• W2047572414 startingPage "22992" @default.
• W2047572414 abstract "We have probed the structural/functional relationship of key residues in human placental alkaline phosphatase (PLAP) and compared their properties with those of the corresponding residues in Escherichia coli alkaline phosphatase (ECAP). Mutations were introduced in wild-type PLAP,i.e. [E429]PLAP, and in some instances also in [G429]PLAP, which displays properties characteristic of the human germ cell alkaline phosphatase isozyme. All active site metal ligands, as well as residues in their vicinity, were substituted to alanines or to the homologous residues present in ECAP. We found that mutations at Zn2 or Mg sites had similar effects in PLAP and ECAP but that the environment of the Zn1 ion in PLAP is less affected by substitutions than that in ECAP. Substitutions of the Mg and Zn1 neighboring residues His-317 and His-153 increasedk cat and increased K m when compared with wild-type PLAP, contrary to what was predicted by the reciprocal substitutions in ECAP. All mammalian alkaline phosphatases (APs) have five cysteine residues (Cys-101, Cys-121, Cys-183, Cys-467, and Cys-474) per subunit, not homologous to any of the four cysteines in ECAP. By substituting each PLAP Cys by Ser, we found that disrupting the disulfide bond between Cys-121 and Cys-183 completely prevents the formation of the active enzyme, whereas the carboxyl-terminally located Cys-467-Cys-474 bond plays a lesser structural role. The substitution of the free Cys-101 did not significantly affect the properties of the enzyme. A distinguishing feature found in all mammalian APs, but not in ECAP, is the Tyr-367 residue involved in subunit contact and located close to the active site of the opposite subunit. We studied the A367 and F367 mutants of PLAP, as well as the corresponding double mutants containing G429. The mutations led to a 2-fold decrease ink cat, a significant decrease in heat stability, and a significant disruption of inhibition by the uncompetitive inhibitors l-Phe and l-Leu. Our mutagenesis data, computer modeling, and docking predictions indicate that this residue contributes to the formation of the hydrophobic pocket that accommodates and stabilizes the side chain of the inhibitor during uncompetitive inhibition of mammalian APs. We have probed the structural/functional relationship of key residues in human placental alkaline phosphatase (PLAP) and compared their properties with those of the corresponding residues in Escherichia coli alkaline phosphatase (ECAP). Mutations were introduced in wild-type PLAP,i.e. [E429]PLAP, and in some instances also in [G429]PLAP, which displays properties characteristic of the human germ cell alkaline phosphatase isozyme. All active site metal ligands, as well as residues in their vicinity, were substituted to alanines or to the homologous residues present in ECAP. We found that mutations at Zn2 or Mg sites had similar effects in PLAP and ECAP but that the environment of the Zn1 ion in PLAP is less affected by substitutions than that in ECAP. Substitutions of the Mg and Zn1 neighboring residues His-317 and His-153 increasedk cat and increased K m when compared with wild-type PLAP, contrary to what was predicted by the reciprocal substitutions in ECAP. All mammalian alkaline phosphatases (APs) have five cysteine residues (Cys-101, Cys-121, Cys-183, Cys-467, and Cys-474) per subunit, not homologous to any of the four cysteines in ECAP. By substituting each PLAP Cys by Ser, we found that disrupting the disulfide bond between Cys-121 and Cys-183 completely prevents the formation of the active enzyme, whereas the carboxyl-terminally located Cys-467-Cys-474 bond plays a lesser structural role. The substitution of the free Cys-101 did not significantly affect the properties of the enzyme. A distinguishing feature found in all mammalian APs, but not in ECAP, is the Tyr-367 residue involved in subunit contact and located close to the active site of the opposite subunit. We studied the A367 and F367 mutants of PLAP, as well as the corresponding double mutants containing G429. The mutations led to a 2-fold decrease ink cat, a significant decrease in heat stability, and a significant disruption of inhibition by the uncompetitive inhibitors l-Phe and l-Leu. Our mutagenesis data, computer modeling, and docking predictions indicate that this residue contributes to the formation of the hydrophobic pocket that accommodates and stabilizes the side chain of the inhibitor during uncompetitive inhibition of mammalian APs. alkaline phosphatase placental alkaline phosphatase Escherichia coli alkaline phosphatase tissue-nonspecific alkaline phosphatase intestinal alkaline phosphatase wild-type 4-(aminosulfonyl)-7-fluoro-2,1,3-benzoxadiazole Alkaline phosphatases (APs1; EC 3.1.3.1) are a family of dimeric metalloenzymes catalyzing the hydrolysis of monoesters of phosphoric acid (1McComb R.B. Bowers G.N. Posen S. Alkaline Phosphatases. Plenum Press, New York1979Crossref Google Scholar). APs also catalyze a transphosphorylation reaction in the presence of large concentrations of phosphate acceptors. APs occur widely in nature and are found in many organisms from Escherichia coli to man. APs are homodimeric enzymes, and each catalytic site contains three metal ions (two Zn ions and one Mg ion) that are necessary for enzymatic activity (2Kim E.E. Wyckoff H.W. J. Mol. Biol. 1991; 218: 449-464Crossref PubMed Scopus (940) Google Scholar). Whereas the main features of the catalytic mechanism are conserved between mammalian APs and the E. coli enzyme, there are important differences. Mammalian APs (a) have higher specific activity and K m values, (b) have a more alkaline pH optimum, (c) are inhibited byl-amino acids and peptides through an uncompetitive mechanism, and (d) display lower heat stability. These properties, however, differ noticeably within the group of mammalian AP isozymes. Many of the isozyme-specific properties have been attributed to a flexible loop region or “crown” domain of the molecule (3Bossi M. Hoylaerts M.F. Millán J.L. J. Biol. Chem. 1993; 268: 25409-25416Abstract Full Text PDF PubMed Google Scholar, 4Le Du M.H. Stigbrand T. Taussig M.J. Menez A. Stura E.A. J. Biol. Chem. 2001; 276: 9158-9165Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar). Some mammalian APs, such as the human intestinal isozyme, are activated by magnesium ions, whereas the human placental AP is more similar to the E. coli enzyme in that its activity is not enhanced by the addition of magnesium (1McComb R.B. Bowers G.N. Posen S. Alkaline Phosphatases. Plenum Press, New York1979Crossref Google Scholar). For many years, E. coli AP (ECAP) was the only source of structural information on APs (2Kim E.E. Wyckoff H.W. J. Mol. Biol. 1991; 218: 449-464Crossref PubMed Scopus (940) Google Scholar), but now the three-dimensional structure of the first mammalian AP, i.e. human placental alkaline phosphatase (PLAP), has been solved (4Le Du M.H. Stigbrand T. Taussig M.J. Menez A. Stura E.A. J. Biol. Chem. 2001; 276: 9158-9165Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar). As had been predicted from sequence comparisons (5Kim E.E. Wyckoff H.W. Clin. Chim. Acta. 1990; 186: 175-187Crossref PubMed Scopus (170) Google Scholar), the central core of PLAP, consisting of an extended β-sheet and flanking α-helices, is very similar to that of ECAP. The same is true in the immediate vicinity of the three catalytic ions. However, a number of distinctive features, including a different positioning of the amino-terminal segment of the molecule and the expanded top loop or “crown” domain, are now apparent (4Le Du M.H. Stigbrand T. Taussig M.J. Menez A. Stura E.A. J. Biol. Chem. 2001; 276: 9158-9165Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar). An additional noncatalytic metal-binding site not present in ECAP was uncovered, which appears to be occupied by calcium (4Le Du M.H. Stigbrand T. Taussig M.J. Menez A. Stura E.A. J. Biol. Chem. 2001; 276: 9158-9165Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar, 6Mornet E. Stura E. Lia-Baldini A.S. Stigbrand T. Menez A. Le Du M.H. J. Biol. Chem. 2001; 276: 31171-31178Abstract Full Text Full Text PDF PubMed Scopus (166) Google Scholar). ECAP has four cysteine residues that are all involved in disulfide bond formation (7Sone M. Kishigami S. Yoshihisa T. Ito K. J. Biol. Chem. 1997; 272: 6174-6178Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar), whereas PLAP has five nonhomologous residues. Furthermore, whereas ECAP is located in the periplasmic space of the bacterium, PLAP is an ectoenzyme bound to the plasma membrane via a glycosyl-phosphatidylinositol anchor (8Micanovic R. Brink B.L. Gerber L. Pan Y.-C. Hulmes J.D. Udenfriend S. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 1398-1402Crossref PubMed Scopus (62) Google Scholar, 9Ogata S. Hayashi Y. Takami N. Ikehara Y. J. Biol. Chem. 1988; 263: 10489-10494Abstract Full Text PDF PubMed Google Scholar). In the present paper, we embarked on a wide-range mutagenesis study on structure-function relationships in mammalian APs, using the PLAP structure as a paradigm. The aim was to pinpoint the features of PLAP responsible for the specific properties of this AP isozyme, as well as the properties of mammalian APs in general. The active site metal ligand residues were mutated to alanines or to the analogous residues in the structure of ECAP, and cysteines were mutated to serines. Furthermore, Tyr-367 is conserved in all mammalian APs and occupies a unique position in the PLAP structure, serving as a bridge from one subunit in the dimer to the active site of another subunit. We mutagenized the Tyr-367 residue to Ala and Phe. Mutations were studied individually as well as in combination with the E429G substitution because this change has been shown to significantly affect many of the enzymatic properties of PLAP by conferring germ cell alkaline phosphatase characteristics to the resulting mutant enzyme (10Hoylaerts M.F. Millán J.L. Eur. J. Biochem. 1991; 202: 605-616Crossref PubMed Scopus (44) Google Scholar, 11Hummer C. Millán J.L. Biochem. J. 1991; 274: 91-95Crossref PubMed Scopus (40) Google Scholar, 12Watanabe T. Wada N. Kim E.E. Wyckoff H.W. Chou J.Y. J. Biol. Chem. 1991; 266: 21174-21178Abstract Full Text PDF PubMed Google Scholar, 13Hoylaerts M.F. Manes T. Millán J.L. Biochem. J. 1992; 286: 23-30Crossref PubMed Scopus (77) Google Scholar). The present analysis of structurally and catalytically important residues in PLAP has identified critical positions serving a different structural role in mammalian and bacterial alkaline phosphatases. We have also defined the location of the hydrophobic pocket that participates in stabilizing the side chains of uncompetitive inhibitors in the immediate vicinity of the active site of mammalian alkaline phosphatases. Site-directed mutagenesis was performed by PCR with mutated oligonucleotide primers. The strategy involves the introduction of restriction sites for enzymes that cut at a distance from their recognition sites (BsaI, BspMI,Alw26I, and EarI) or the use of endogenous restriction enzyme sites. Either the PLAP-FLAG/pcDNA3 or PLAP/pSVT7 plasmid was used as a template in PCR reactions. PCR products were subcloned into a pCR2.1 or PCRII-TOPO cloning vector (Invitrogen), and the mutations were confirmed by sequencing. The restriction fragments were then cut and ligated with the fragments of PLAP-FLAG/pcDNA3 and pcDNA3 plasmid (Invitrogen). All final constructs were verified by restriction enzyme analysis and sequencing. Plasmid DNA was prepared by the alkaline lysis procedure. Sequencing was performed using Sequenase according to the manufacturer's protocol (AmershamBiosciences). The sequences of the oligonucleotide primers used for amplifying the site-directed mutagenized fragments in the case of the active site metal ligands are described in this section. The name of the primer (all are shown 5′ to 3′) is given first, followed by the sequence (positions that denote the mutation are underlined): D42A, GCG-GTC-TCC-TGG-GCG-CTG-GGA-TGG-G; 42−, ATG-GTC-TCG-CCC-AGG-AAG-ATG-ATG-AG; H153A, CCG-GTC-TCG-TGC-AGG-CCG-CCT-CGC-CAG-CCG; H153D, CCG-GTC-TCG-TGC-AGG-ACG-CCT-CGC-CAG-CCG; S155A, CCG-GTC-TCG-TGC-AGC-ACG-CCG-CGC-CAG-CCG; S155T, CCG-GTC-TCG-TGC-AGG-CCG-CCA-CGC-CAG-CCG 153155−, GCG-GTC-TCC-TGC-ACT-CGT-GTG-GTG-GT; E311A, CCC-CGC-GGC-TTC-TTC-CTC-TTC-GTG-GCG-GGT-GGT; D316A, AGG-GTC-TCC-GCA-TCG-CCC-ATG-GTC-ATC-AT; H317K, AGG-GTC-TCC-GCA-TCG-ACA-AAG-GTC-ATC-AT; 316317−, CCG-GTC-TCG-ATG-CGA-CCA-CCC-TCC-AC; H320A, GCG-GTC-TCC-ATG-GTC-ATG-CTG-GAA-AGC-AGG; 320−, TCG-GTC-TCA-CCA-TGG-TCG-ATG-CGA-CC; D357A, GCG-GTC-TCA-CTG-CCG-CCC-ACT-CCC-ACG-TC; H358A, GCG-GTC-TCA-CTG-CCG-ACG-CCT-CCC-ACG-TC; H360A, GCG-GTC-TCA-CTG-CCG-ACC-ACT-CCG-CCG-TC; 357358360−, GAG-GTC-TCG-GCA-GTG-ACG-AGG-CTC-AG; H432A, GCC-GCG-CGC-GAA-CAC-CGC-CAC-GTC-CTC-GCC-TGC-GGC-GGT-CTC-TTC; 317−, ATG-GGT-CTC-GTC-GAT-GCG-ACC-ACC-CTC; PLAPFLAG, TCA-CTT-GTC-ATC-GTC-GTC-CTT-GTA-GTC-GGT-GGT-GCC-GGC-GGG-GGG-CGC; H317A, TTC-CTC-TTC-GTG-GAG-GGT-GGT-CGC-ATC-GAC-GCT-GGT-CAT; H319A, TTC-CTC-TTC-GTG-GAG-GGT-GGT-CGC-ATC-GAC-CAT-GGT-GCT-CAT-GA; and E429G(−), GCC-GCG-CGC-GAA-CAC-CGC-CAC-GTC-CTC-GCC-TGC-GTG-GGT-CTC-ACC-GTC. pSVT7 PLAP was used as the template in PCR reactions with the following primer pairs: 1, T7 and 42−; 2, D42A and 153155−; 3, H153A and 316317−; 4, H153D and 316317−; 5, S155A and 316317−; 6, S155T and 316317−; 7, E311A and H432A; 8, D316A and H432A; 9, H317K and H432A; 10, H320A and H432A; 11, D357A and H432A; 12, H358A and H432A; 13, H360A and H432A; 14, S155A and 357358360−; 15, S155A and 320−; and 16, D357A and PLAP-FLAG. PCR products were subcloned and sequenced to verify sequence integrity, and then the following fragments were isolated and combined with fragments from pSVT7 PLAP to produce the indicated PLAP mutants in pSVT7: 1/HindIII-BsaI and 2/Bsa BamHI for D42A; 2/BamHI-BsaI and 3/BsaI-SacI for H153A; 2/BamHI-BsaI and 4/BsaI-SacI for H153D; 2/BamHI-BsaI and 5/BsaI-SacI for S155A; 2/BamHI-BsaI and 6/BsaI-SacI for S155T; 7/SacII-SacI for E311A; 4,5,6/SacII-BsaI and 8/BsaI-SacI for D316A; 4,5,6/SacII-BsaI and 9/BsaI-SacI for H317K; 15/SacII-BsaI and 10/BsaI-SacI for H320A; 14/SacII-BsaI and 11/BsaI-SacI for D357A; 14/SacII-BsaI and 12/BsaI-SacI for H358A; 14/SacII-BsaI and 13/BsaI-SacI for H360A; and 11/EagI-BssHII for H432A.HindIII-SacII from H153D andSacII-BssHII from H317K were combined to construct [D153, K317]PLAP. PLAP residues past 483 were replaced by the 8-amino acid FLAG epitope by ligating wtEcoRI-BssHII with 16/BssHII-Xba into pcDNA3 (Invitrogen).HindIII-BssHII fragments for all the pSVT7 PLAP mutants were subcloned with theBssHII-XbaPLAP-FLAG fragment into pcDNA3 to create constructs encoding carboxyl-terminal FLAG epitope-tagged secreted APs. For other active site area mutations, PLAP-FLAG/pcDNA3 was used as template in the following PCR reactions: 317–44, H317A and E429G(−); 319–44, H319A and E429G(−); and 429, H357A and E429G(−). After PCR products were subcloned, the following restriction fragments were cut and ligated together with PLAP-FLAG/pcDNA3 fragments to give final constructs: 429/SacI-PauI for E429G; 317–44/EarI-SacI for H317A; 319–44/EarI–SacI for H319A; 317–44/EarI-SacI and 429/SacI-PauI for H317A and E429G; and 319–44/EarI-SacI and 429/SacI-PauI for the double H319A + E429G mutation. The fragments XbaI-BsmBI from the H153A final construct and BsmBI-XbaI from the E429G final construct were combined to prepare [A153, G429]PLAP. To prepare the cysteine mutants, the following PCR primers were used: F101, ACA-GCC-GGT-CTC-TAC-CTG-AGC-GGG-GTC-AAG-GGC; R101, CTT-GAC-GGT-CTC-CAG-GTA-GGC-CGT-GGC-TGT; F121, GCA-GCC-GGT-CTC-TTT-AAC-CAG-AGC-AAC-ACG-ACA-CGC; R121, CGT-GTT-GGT-CTC-GTT-AAA-GCG-GGC-GGC-TGC; F183, GCC-TCG-ACC-TGC-CAG-GAG-GGG-TCC-CAG-GAC; R183, AGC-GAT-ACC-TGC-GCA-CCC-CTC-CTG-GCG-GGC; C467S, GGG-GCG-CCA-GGT-CGC-AGG-CGG-TGT-AGG-GCT-CCA-GGG-AGG-CGG; C474S, GGG-GCG-CCA-GGT-CGG-AGG-CGG-TGT-AGG-GCT-CCA-GGC-AGG-CGG; SSR, GGC-GGT-CTC-GGG-CTC-CAG-GGA-GGC-GGC-GAA; ALW, GCC-GCC-CGT-CTC-GAG-CCC-TAC-ACC-GCC-TCC-GAC-CT; T7, TAA-TAC-GAC-TCA-CTA-TAA-GGG; and SP6, ATT-TAG-GTG-AGA-CTA-TAG. The products of the PCR reactions (CYS1, F101 and R183; CYS2, R101 and T7; CYS3, F121 and R183; CYS4, R121 and T7; CYS5, R183 and T7; CYS6, F183 and SP6; CYS7, D357A and C467S; CYS8, D357A and C474S; CYS9, D357A and SSR; and CYS10, ALW and SP6) were isolated and subcloned into the pCR2.1 vector. The following restriction fragments were cut and ligated with the fragments of PLAP-FLAG/pcDNA3 to make the final constructs: CYS1/BsaI-BstEII and CYS2/EcoRI-BsaI for the C101S mutant; CYS3/BsaI-BstEII and CYS4/EcoRI-BsaI for C121S; CYS5/EcoRI-BspMI and CYS6/BspMI-XbaI for C183S; CYS7/PauI-KasI for C467S; CYS8/PauI-KasI for C474S; and CYS9/PauI-Alw26I and CYS10/Alw26I-XbaI for the double S467 + S474 mutation. All final constructs were verified by restriction enzyme analysis and sequencing. The following PCR primers were used: Y367A(R), CGAAGATGGAGCTCCCTCGCAGGGGGGCGCCTCC; Y367F(R), CGAAGATGGAGCTCCCTCGCAGGGGGAAGCCTCC; in PCR reactions. For PCR reaction 367A/ we used primers H153A andY367A(R), whereas for reaction 367F/ the primers H153A and Y367F(R) were used. Restriction fragments were then cut and combined with fragments from PLAP-FLAG/pCDNA3 to make the final constructs (for the [A367]PLAP or [F367]PLAP mutants, BsmBI-SacI from 367A or 367F, respectively; for the [A367, G429]PLAP or [F367, G429]PLAP mutants, SacI-XbaI from [E429G]PLAP andBsmBI-SacI from A367 or F367, respectively). PLAP-FLAG constructs were transfected into COS-1 cells for transient expression by the DEAE-dextran- or calcium phosphate-mediated method. Three and 6 days after transfection, conditioned media were collected and concentrated about 10 times by ultrafiltration on 50 Centricon columns (Amicon Inc., Beverly, MA). PLAP-FLAG proteins were purified by affinity chromatography with anti-FLAG M2 antibody gel (Sigma) according to the manufacturer's instructions. To measure relative specific activities, microtiter plates were coated with 2 μg/ml M2 anti-FLAG monoclonal antibody (Sigma). After the addition of recombinant APs, the activity of the bound enzymes was measured as the change in absorbance at 405 nm over time at 37 °C upon the addition of 20 mm p-nitrophenylphosphate as substrate in 1.0 mdiethanolamine buffer (pH 9.8), 1 mm MgCl2, and 20 μm ZnCl2. PLAP-FLAG served as a reference for each microtiter plate. The p-nitrophenol concentration formed was calculated using an extinction coefficient of 10,080 liter × mole−1 × cm−1. To calculateK m , substrate concentration was varied between 0.2 and 1.6 mm p-nitrophenylphosphate, and the initial reaction rate was measured at 37 °C over a time interval of 5 min. Results were fit by nonlinear regression to the Michaelis-Menten equation using GraphPad Prism version 3.02 (GraphPad Software, San Diego, CA). AP pH/activity profiles were done using 20 mm p-nitrophenylphosphate as substrate in 50 mmbuffer with 1 mm MgCl2 and 20 μmZnCl2; bis-tris propane for pH range 6.5–9.5, and 2-amino-2-methyl-1-propanol for pH range 9.5–11. The pH was checked after dissolving the substrate. The 50 mm3-(cyclohexylaminol)-1-propanesulfonic acid buffer proved to be inhibitory to PLAP but not ECAP activity. The carboxyl-terminal FLAG fusion protein of ECAP (Eastman Kodak Co.) was used for comparison. The heat stability of PLAP mutants was studied by incubating the enzyme samples in 1 m diethanolamine buffer, pH 9.8, containing 1 mm MgCl2 and 20 μmZnCl2. After a 10-min incubation at a given temperature, the samples were placed on ice. Residual activities were then measured in duplicate with 10 mm p-nitrophenylphosphate at pH 9.8 in the same buffer. The cysteine-specific probe 4-(aminosulfonyl)-7-fluoro-2,1,3-benzoxadiazole (ABD-F; Molecular Probes Inc., Eugene, OR) was used to label wild-type PLAP (not modified with FLAG peptide). Free ABD-F shows no fluorescence but can form fluorescent adducts with protein thiol groups with an excitation maximum at 390 nm and an emission maximum at about 500–520 nm. In a modification reaction, 20-μl aliquots of 50 mm ABD-F solution in Me2SO were added to 1-ml samples of PLAP solution (0.4 μm/liter) in 0.1 m Tris-HCl buffer, pH 7.6, either at nondenaturing conditions or in the presence of denaturant (4 m guanidine hydrochloride), reducing agent (1 mm tris-(2-carboxylethyl)phosphine; Molecular Probes Inc), or both. The samples were then incubated for 3 h at 37 °C while protected from light. Fluorescence spectra were measured with a FluoroMax-2 fluorometer with excitation at 390 nm. The binding of inhibitors l-Leu andl-Phe to the PLAP molecule was modeled using the flexible ligand docking program FlexX (14Rarey M. Kramer B. Lengauer T. Klebe G. J. Mol. Biol. 1996; 261: 470-489Crossref PubMed Scopus (2376) Google Scholar). The active site of PLAP was defined as a sphere of 9 Å around the Zn1 atom. The phosphate ion present in the enzyme structure was included in the receptor model. Ligands were prepared in the SYBYL mol2 format, in energy-minimized form, with all hydrogens added and formal charges assigned. The amino groups ofl-Leu and l-Phe were left unprotonated. The manual “base fragment” selection (14Rarey M. Kramer B. Lengauer T. Klebe G. J. Mol. Biol. 1996; 261: 470-489Crossref PubMed Scopus (2376) Google Scholar) option was used, and either the carboxylic, amino, or hydrophobic groups of the ligand were chosen as the base fragment. To pinpoint the residues important for catalysis and stability of human PLAP, we constructed and characterized 23 individual site-directed mutants of PLAP (Fig. 1) as well as 7 double mutations. Residues serving as ligands to catalytically important metal ions, i.e. Asp-42, His-153, Ser-155, Glu-311, Asp-316, His-320, Asp-357, His-358, His-360, and His-432, were mutagenized into Ala. Two residues in the vicinity of the Mg-binding site in PLAP that are not conserved in ECAP, i.e.His-153 and His-317, were mutagenized into Ala or to Asp and Lys, respectively. Some active site mutations were studied in the context of both wild-type PLAP, i.e. [E429]PLAP, and [G429]PLAP because this substitution has been shown to have profound influences on the behavior of the enzyme by conferring upon it germ cell alkaline phosphatase characteristics (11Hummer C. Millán J.L. Biochem. J. 1991; 274: 91-95Crossref PubMed Scopus (40) Google Scholar), i.e. [H153A, E429G], [H317A, E429G], and [H319A, E429G]. Furthermore, the mammalian APs have 5 cysteine residues/monomer in positions that are not homologous to the 4 cysteines of ECAP (7Sone M. Kishigami S. Yoshihisa T. Ito K. J. Biol. Chem. 1997; 272: 6174-6178Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar), and we mutagenized each of these 5 cysteines of PLAP to Ser and also studied the [C467S, C474S] double mutant. In addition, mutagenesis of the Tyr-367 residue, a signature feature of mammalian APs, was also performed. To simplify the recovery and purification of the recombinant PLAP variants, the glycosylphosphatidylinositol anchoring sequence of PLAP was replaced by the FLAG octapeptide, and all mutants were expressed as secreted, epitope-tagged, enzymes. We had previously determined that the addition of the FLAG sequence does not interfere with the kinetic properties of the molecule (15Di Mauro, S., Manes, T., Hessle, H., Kozlenkov, A., Pizauro, J. M., Hoylaerts, M. F., and Millán, J. L. (2002)J. Bone Miner. Res., in pressGoogle Scholar). This strategy facilitated the production of large amounts of recombinant protein and enabled the fast and efficient isolation of each mutant AP using anti-FLAG affinity purification. Two substitutions resulted in mutant enzymes that did not have any AP activity over background levels in the culture media, i.e. C121S and C183S. We could not detect any FLAG-tagged protein in the media for these mutants by Western blot analysis, indicating that these mutations had severe adverse consequences on protein structure, proper folding, and/or secretion. Fig.2 shows a detailed comparison of the structure of the active site region of PLAP and ECAP including all the metal ligands that were mutagenized in this study. When substituting the Zn1 ligands in PLAP, i.e. Asp-316, His-320, and His-432, two of the three mutants, i.e. [A316]PLAP and [A432]PLAP, retained significant activity (TableI). The k cat andK m of [A316]PLAP showed a 2.8- and 2.25-fold decrease relative to wt PLAP. Thus, the catalytic efficiency (k cat/K m ) of the [A316]PLAP mutant remains comparable to that of wt PLAP. Thek cat of [A432]PLAP was also reduced 2.7-fold, but its K m increased 3.7-fold for a resulting 5.8-fold reduction in catalytic efficiency. In contrast, the introduction of the H320A mutation reduced the specific activity of PLAP by >200-fold. Saturation of each of the mutants with Zn2+ concentrations of up to 10 mm did not result in any increase in activity. It should be noted that analogous mutations in ECAP were reported to have very different consequences. Notably, the D327A substitution in ECAP (analogous to Asp-316 in PLAP) resulted in a 3000-fold decrease in k cat and a 2000-fold increase in K m for a 107-fold decrease in catalytic efficiency that was not reversible by the addition of Zn2+ (16Xu X. Kantrowitz E.R. J. Biol. Chem. 1992; 267: 16244-16251Abstract Full Text PDF PubMed Google Scholar). In contrast, the activity of the H412A mutant in ECAP (analogous to H432A in PLAP) was responsive to 0.2 mm Zn2+, reaching k catand K m values only 2-fold lower that those of wt ECAP (17Ma L. Kantrowitz E.R. J. Biol. Chem. 1994; 269: 31614-31619Abstract Full Text PDF PubMed Google Scholar). The H331A mutation (analogous to H320A in PLAP) has not been studied in ECAP. These results indicate that there are significant differences in the environment of Zn1 in the PLAP structure compared with the ECAP structure and that substitutions of the Zn1 ligands are better tolerated in PLAP than in ECAP. This may reflect the fact that the top flexible loop, or crown domain, that harbors E429 in PLAP appears to provide additional stabilization to the active site environment, so that Zn2+ cannot easily diffuse in or out of the PLAP molecule, as we have previously observed (18Hoylaerts M.F. Manes T. Millán J.L. J. Biol. Chem. 1997; 272: 22781-22787Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar). Thus, even though the state of coordination of Zn1 is affected by the mutations, the Zn2+ ion remains in place and is able to function in catalysis.Table IKinetic parameters of PLAP mutantsPLAP mutants k cat K m k cat/K m (s −1 ) (mm) (s −1 mm −1 wt PLAP460 ± 110.36 ± 0.031288 [G429]PLAP344 ± 140.10 ± 0.0053400Conserved active site residues [A42]PLAP6.4 ± 0.80.68 ± 0.049 [A155]PLAP5.1 ± 0.50.38 ± 0.0214 [T155]PLAP529 ± 370.18 ± 0.012813 [A311]PLAP2.8 ± 0.41.26 ± 0.082 [A316]PLAP193 ± 60.16 ± 0.011073 [A320]PLAP1.8 ± 0.9ND1-aND, not determined.ND [A357]PLAP18 ± 3.70.21 ± 0.0278 [A358]PLAP<1.0NDND [A432]PLAP170 ± 61.36 ± 0.18221Nonconserved active site residues [D153]PLAP313 ± 140.71 ± 0.03442 [A153]PLAP989 ± 531.22 ± 0.08825 [A153, G429]PLAP546 ± 350.31 ± 0.031761 [K317]PLAP906 ± 640.80 ± 0.031097 [A317]PLAP999 ± 311.13 ± 0.19884 [A317, G429]PLAP797 ± 380.25 ± 0.023188 [D153, K317]PLAP400 ± 181.2 ± 0.1340Active site neighboring residues [A319]PLAP6.5 ± 1.5NDND [A319, G429]PLAP12.8 ± 2.2NDND [A360]PLAP552 ± 231.4 ± 0.1608 [A367]PLAP195 ± 110.35 ± 0.02557 [F367]PLAP178 ± 140.27 ± 0.02659 [A367, G429]PLAP202 ± 60.22 ± 0.01918 [F367, G429]PLAP200 ± 110.17 ± 0.011176Cysteine residues [S101]PLAP489 ± 130.41 ± 0.051193 [S467]PLAP206 ± 150.36 ± 0.05572 [S474]PLAP221 ± 130.33 ± 0.03670 [S467, S474]PLAP244 ± 110.40 ± 0.04610 [S121]PLAP & [S183]PLAPNDNDND1-a ND, not determined. Open table in a new tab Alanine substitutions of the Zn2 ligands in PLAP, i.e.Asp-42, Asp-357, and His-358, resulted in significant decreases in specific activity, ranging from >25-fold (D357A) to undetectable levels (H358A). None of these values changed in response to the addition of Zn2+. Whereas the K m of [A42]PLAP nearly doubled, the K m of [A357]PLAP decreased slightly. Thus, the catalytic efficiencies of [A42]PLAP and [A357]PLAP were reduced by 130- and 16-fold, respectively. Whereas no studies have been performed in ECAP on residues analogous to Asp-357 and His-358, the [A51]ECAP mutant, analogous to [A42]PLAP, was shown to be >800-fold less active than the wt ECAP (19Tibbitts T.T. Murphy J.E. Kantrowitz E.R. J. Mol. Biol. 1996; 257: 700-715Crossref PubMed Scopus (33) Google Scholar). Ala-42 is a bidentate ligand, coordinating not only to Zn2 but also to Mg. Alanine substitution of the other two Mg ligands, i.e.Ser-155 and Glu-311, reduced the specific activity of PLAP ∼100- and 200-fold, respectively. The K m for [A155]PLAP did not change, but it increased about 4-fold for [A311]PLAP. A similar pattern was seen for the corresponding E322A mutation in ECAP (20Xu X. Kantrowitz E.R. Biochemistry. 1993; 32: 10683-10691Crossref PubMed Scopus (25) Google Scholar). Interestingly, the S155T substitution hardly affects the activity of the resulting mutant and even doubles its catalytic efficiency (TableI). Whereas most of the AP active site residues are perfectly conserved throughout evolution, some important differences exist in the neighborhood of the Mg ion (Fig. 2). His-153 and His-317 in PLAP are homologous to Asp-153 and Lys-328, respectively, in ECAP. The substitution of D153H and K328H in ECAP produced enzymes with kinetic properties similar to those of mammalian APs. For example, the D153H/K328H double ECAP mutant displayed a 5.6-fold higherk cat and a 30-fold higher K m , a decrease in heat stability, and a shift in pH optimum to alkaline pH values (21Murphy J.E. Ti" @default.
• W2047572414 created "2016-06-24" @default.
• W2047572414 creator A5006329944 @default.
• W2047572414 creator A5030109852 @default.
• W2047572414 creator A5040021656 @default.
• W2047572414 creator A5057518270 @default.
• W2047572414 date "2002-06-01" @default.
• W2047572414 modified "2023-10-02" @default.
• W2047572414 title "Function Assignment to Conserved Residues in Mammalian Alkaline Phosphatases" @default.
• W2047572414 cites W1500563880 @default.
• W2047572414 cites W1502996412 @default.
• W2047572414 cites W1551021351 @default.
• W2047572414 cites W1597254873 @default.
• W2047572414 cites W160167131 @default.
• W2047572414 cites W1954690293 @default.
• W2047572414 cites W1982123565 @default.
• W2047572414 cites W1987500038 @default.
• W2047572414 cites W1990895351 @default.
• W2047572414 cites W1993165645 @default.
• W2047572414 cites W1999732796 @default.
• W2047572414 cites W2014957944 @default.
• W2047572414 cites W2019241316 @default.
• W2047572414 cites W2024469024 @default.
• W2047572414 cites W2029667189 @default.
• W2047572414 cites W2050836249 @default.
• W2047572414 cites W2068341540 @default.
• W2047572414 cites W2091983875 @default.
• W2047572414 cites W2100416885 @default.
• W2047572414 cites W2114779636 @default.
• W2047572414 cites W2157447886 @default.
• W2047572414 cites W2165613108 @default.
• W2047572414 doi "https://doi.org/10.1074/jbc.m202298200" @default.
• W2047572414 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11937510" @default.
• W2047572414 hasPublicationYear "2002" @default.
• W2047572414 type Work @default.
• W2047572414 sameAs 2047572414 @default.
• W2047572414 citedByCount "69" @default.
• W2047572414 countsByYear W20475724142012 @default.
• W2047572414 countsByYear W20475724142013 @default.
• W2047572414 countsByYear W20475724142014 @default.
• W2047572414 countsByYear W20475724142015 @default.
• W2047572414 countsByYear W20475724142016 @default.
• W2047572414 countsByYear W20475724142017 @default.
• W2047572414 countsByYear W20475724142019 @default.
• W2047572414 countsByYear W20475724142020 @default.
• W2047572414 countsByYear W20475724142021 @default.
• W2047572414 countsByYear W20475724142022 @default.
• W2047572414 countsByYear W20475724142023 @default.
• W2047572414 crossrefType "journal-article" @default.
• W2047572414 hasAuthorship W2047572414A5006329944 @default.
• W2047572414 hasAuthorship W2047572414A5030109852 @default.
• W2047572414 hasAuthorship W2047572414A5040021656 @default.
• W2047572414 hasAuthorship W2047572414A5057518270 @default.
• W2047572414 hasBestOaLocation W20475724141 @default.
• W2047572414 hasConcept C11960822 @default.
• W2047572414 hasConcept C14036430 @default.
• W2047572414 hasConcept C160160445 @default.
• W2047572414 hasConcept C178666793 @default.
• W2047572414 hasConcept C181199279 @default.
• W2047572414 hasConcept C185592680 @default.
• W2047572414 hasConcept C55493867 @default.
• W2047572414 hasConcept C86803240 @default.
• W2047572414 hasConcept C95444343 @default.
• W2047572414 hasConceptScore W2047572414C11960822 @default.
• W2047572414 hasConceptScore W2047572414C14036430 @default.
• W2047572414 hasConceptScore W2047572414C160160445 @default.
• W2047572414 hasConceptScore W2047572414C178666793 @default.
• W2047572414 hasConceptScore W2047572414C181199279 @default.
• W2047572414 hasConceptScore W2047572414C185592680 @default.
• W2047572414 hasConceptScore W2047572414C55493867 @default.
• W2047572414 hasConceptScore W2047572414C86803240 @default.
• W2047572414 hasConceptScore W2047572414C95444343 @default.
• W2047572414 hasIssue "25" @default.
• W2047572414 hasLocation W20475724141 @default.
• W2047572414 hasOpenAccess W2047572414 @default.
• W2047572414 hasPrimaryLocation W20475724141 @default.
• W2047572414 hasRelatedWork W1549790155 @default.
• W2047572414 hasRelatedWork W1969893516 @default.
• W2047572414 hasRelatedWork W1979712388 @default.
• W2047572414 hasRelatedWork W1982672009 @default.
• W2047572414 hasRelatedWork W2086239583 @default.
• W2047572414 hasRelatedWork W2089318461 @default.
• W2047572414 hasRelatedWork W2093784804 @default.
• W2047572414 hasRelatedWork W2102880558 @default.
• W2047572414 hasRelatedWork W2320589893 @default.
• W2047572414 hasRelatedWork W2335527559 @default.
• W2047572414 hasVolume "277" @default.
• W2047572414 isParatext "false" @default.
• W2047572414 isRetracted "false" @default.
• W2047572414 magId "2047572414" @default.
• W2047572414 workType "article" @default.