FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2047644930> ?p ?o ?g. }

• W2047644930 endingPage "21115" @default.
• W2047644930 startingPage "21110" @default.
• W2047644930 abstract "Cells store lipids in droplets. Studies addressing how mammals control lipid-based energy homeostasis have implicated proteins of the PAT domain family, such as perilipin that surrounds the lipid droplets. Perilipin knock-out mice are lean and resistant to obesity. Factors that mediate lipid storage in fungi are still unknown. Here we describe a gene (Mpl1) in the economically important insect fungal pathogen Metarhizium anisopliae that has structural similarities to mammalian perilipins. Consistent with a role in lipid storage, Mpl1 is predominantly expressed when M. anisopliae is engaged in accumulating lipids and ectopically expressed green fluorescent protein-tagged MPL1 (Metarhizium perilipin-like protein) localized to lipid droplets. Mutant M. anisopliae lacking MPL1 have thinner hyphae, fewer lipid droplets, particularly in appressoria (specialized infection structures at the end of germ tubes), and a decrease in total lipids. Mpl1 therefore acts in a perilipin-like manner suggesting an evolutionary conserved function in lipid metabolism. However, reflecting general differences between animal and fungal lineages, these proteins have also been selected to cope with different tasks. Thus, turgor generation by ΔMpl1 appressoria is dramatically reduced indicating that lipid droplets are required for solute accumulation. This was linked with the reduced ability to breach insect cuticle so that Mpl1 is a pathogenicity determinant. Blast searches of fungal genomes revealed that perilipin homologs are found only in pezizomycotinal ascomycetes and occur as single copy genes. Expression of Mpl1 in yeast cells, a fungus that lacks a perilipin-like gene, blocked their ability to mobilize lipids during starvation conditions. Cells store lipids in droplets. Studies addressing how mammals control lipid-based energy homeostasis have implicated proteins of the PAT domain family, such as perilipin that surrounds the lipid droplets. Perilipin knock-out mice are lean and resistant to obesity. Factors that mediate lipid storage in fungi are still unknown. Here we describe a gene (Mpl1) in the economically important insect fungal pathogen Metarhizium anisopliae that has structural similarities to mammalian perilipins. Consistent with a role in lipid storage, Mpl1 is predominantly expressed when M. anisopliae is engaged in accumulating lipids and ectopically expressed green fluorescent protein-tagged MPL1 (Metarhizium perilipin-like protein) localized to lipid droplets. Mutant M. anisopliae lacking MPL1 have thinner hyphae, fewer lipid droplets, particularly in appressoria (specialized infection structures at the end of germ tubes), and a decrease in total lipids. Mpl1 therefore acts in a perilipin-like manner suggesting an evolutionary conserved function in lipid metabolism. However, reflecting general differences between animal and fungal lineages, these proteins have also been selected to cope with different tasks. Thus, turgor generation by ΔMpl1 appressoria is dramatically reduced indicating that lipid droplets are required for solute accumulation. This was linked with the reduced ability to breach insect cuticle so that Mpl1 is a pathogenicity determinant. Blast searches of fungal genomes revealed that perilipin homologs are found only in pezizomycotinal ascomycetes and occur as single copy genes. Expression of Mpl1 in yeast cells, a fungus that lacks a perilipin-like gene, blocked their ability to mobilize lipids during starvation conditions. Eukaryotic cells contain droplets of triglycerides encased in phospholipid membranes. These lipid droplets (LDs) 3The abbreviations used are: LDs, lipid droplets; PAT, perilipin, adipocyte differentiation-related protein and TIP47; TAG, triacylglycerol; OA, oleic acid; PBS, phosphate-buffered saline; RT, reverse transcription; GFP, green fluorescent protein; PDA, potato dextrose agar; NR, Nile Red; WT, wild type; PEG, polyethylene glycol; Per A, perilipin A. 3The abbreviations used are: LDs, lipid droplets; PAT, perilipin, adipocyte differentiation-related protein and TIP47; TAG, triacylglycerol; OA, oleic acid; PBS, phosphate-buffered saline; RT, reverse transcription; GFP, green fluorescent protein; PDA, potato dextrose agar; NR, Nile Red; WT, wild type; PEG, polyethylene glycol; Per A, perilipin A. were once considered to be just inert storage vessels for energy-rich fat, but recent studies have shown they have additional roles in maintaining membranes and moving components around cells. The lipid droplets have also been implicated in lipid diseases, inflammation, diabetes, cardiovascular disease, and liver disease (1Beckman M. Science. 2006; 311: 1232-1234Crossref PubMed Scopus (80) Google Scholar). Consistent with fat droplets being metabolically active, the membranes encasing them have proteins with wide ranging biochemical activities. The best studied are mammalian proteins of the perilipin family (also called the PAT family) such as perilipin, adipocyte differentiation-related protein, and TIP47. These proteins have a characteristic series of hydrophobic sequences (the PAT domain) that facilitate their localization to the surface of lipid droplets. By coating droplets, perilipin forms a barrier that restricts the access of cytosolic lipases. During food deprivation, perilipin is phosphorylated by protein kinase A; the barrier function of perilipin is attenuated, and lipolysis increases (2Marcinkiewicz A. Gauthier D. Garcia A. Brasaemle D.L. J. Biol. Chem. 2006; 281: 11901-11909Abstract Full Text Full Text PDF PubMed Scopus (184) Google Scholar). In comparison with normal mice, perilipin-deficient mice have less fat, more muscle, a higher metabolic rate, and are resistant to diet-induced and genetic obesity (3Martinez-Botas J. Anderson J.B. Tessier D. Lapillonne A. Chang B.H. Quast M.J. Gorenstein D. Chen K.H. Chan L. Nat. Genet. 2000; 26: 474-479Crossref PubMed Scopus (488) Google Scholar, 4Tansey J.T. Sztalryd C. Gruia-Gray J. Roush D.L. Zee J.V. Gavrilova O. Reitman M.L. Deng C.X. Li C. Kimmel A.R. Londos C. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 6494-6499Crossref PubMed Scopus (601) Google Scholar, 5Tansey J.T. Sztalryd C. Hlavin E.M. Kimmel A.R. Londos C. IUBMB Life. 2004; 56: 379-385Crossref PubMed Scopus (190) Google Scholar). The effects of perilipin have also been studied in Drosophila where the lack of the perilipin homolog results in flies with less fat (6Teixeira L. Rabouille C. Rorth P. Ephrussi A. Vanzo N.F. Mech. Dev. 2003; 120: 1071-1081Crossref PubMed Scopus (115) Google Scholar). For perilipin-free animals, fat storage is a losing battle because hormone-sensitive lipase metabolizes fat as soon as it is made. Not surprisingly therefore, human perilipin variants are also associated with obesity or leanness (7Qi L. Corella D. Sorli J.V. Portoles O. Shen H. Coltell O. Godoy D. Greenberg A.S. Ordovas J.M. Clin. Genet. 2004; 66: 299-310Crossref PubMed Scopus (90) Google Scholar).The proteins that mediate lipid storage in fungi are still unknown. In this study we show that the ascomycete Metarhizium anisopliae, a ubiquitous insect pathogen and biocontrol agent (8Blanford S. Chan B.H.K. Jenkins N. Sim D. Turner R.J. Read A.F. Thomas M.B. Science. 2005; 308: 1638-1641Crossref PubMed Scopus (257) Google Scholar), produces a single mammalian perilipin homolog we designated as Mpl1 for Metarhizium perilipin-like protein. To demonstrate possible conserved functions, we characterized the Mpl1 gene, asked whether its product participates in the regulation of lipid storage, and investigated its influence on fungal processes such as pathogenicity. Our data suggest that M. anisopliae represents a tractable new model system to study the functions of LDs and identify the components and mechanisms of energy homeostasis.EXPERIMENTAL PROCEDURESGene Cloning and Deletion—Our EST analysis identified a high frequency contig (CN808339, 1.5% of transcripts) when the fungus was grown in insect hemolymph (9Wang C. Hu G. St. Leger R.J. Fungal Genet. Biol. 2005; 42: 704-718Crossref PubMed Scopus (123) Google Scholar). A BLAST search showed that it has a high similarity with the virulence factor CAP20 of plant fungal pathogen Colletotrichum gloeosporioides (10Hwang C.S. Flaishman M.A. Kolattukudy P.E. Plant Cell. 1995; 7: 183-193PubMed Google Scholar). To study its potential function in M. anisopliae, a full cDNA sequence was cloned, and the genomic DNA with flanking sequences was obtained by primer walking (DNA Walking Speedup™ kit, Seegene Inc.). Gene deletion was conducted using the plasmid pGPS3Bar as described before (11Wang C. St. Leger R.J. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 6647-6652Crossref PubMed Scopus (214) Google Scholar). The detailed procedure is provided in supplemental Fig. S1.GFP Fusion Constructs and Expression—Full-length cDNA of Mpl1 was amplified from a library of genes expressed by M. anisopliae in insect hemolymph (9Wang C. Hu G. St. Leger R.J. Fungal Genet. Biol. 2005; 42: 704-718Crossref PubMed Scopus (123) Google Scholar). The primers PerEF (CTTGGATCCCGGGATGGCTGTCCCTCAGGTCAA) and PerER (CTTGGATCCTTGGCATTGGCATAGACT) were used to introduce BamHI sites at both ends as well as an additional SmaI site at the 5′ end. The product was digested with BamHI and then inserted into the BamHI site of pYes2 (Invitrogen) to generate pYes2Per. The GFP gene was amplified from pEGFP (Clontech) with the primers GfpPerF (CCGAGCTCGGATCCCGTACCGGTCGCCACCATG) and GfpPerR (AGGGACAGCCATCCCCTTGTACAGCTCGTCCATGC) by deleting the 3′ TAA stop codon (the underlined regions exactly match the terminal regions of pYes2Per after digestion with SmaI). The product was integrated into the SmaI site of plasmid pYes2Per using an in-fusion dry-down PCR cloning kit (Clontech) to generate the plasmid pGfpPer.To determine whether MPL1 localizes to LDs in a fungus lacking endogenous perilipin-like proteins, Saccharomyces cerevisiae strain INVSc1 (Invitrogen) was transformed with pGfpPer and the transformant grown overnight in SC-U medium plus 2% raffinose. The culture was adjusted to A600 = 0.4 in 2% galactose SC-U medium and incubated at 30 °C, 250 rpm for 12 h.To ectopically express GFP-tagged MPL1 in its endogenous M. anisopliae environment, the Gfp-Mpl1 fusion product was excised from pGfpPer and inserted into the BamHI site of pBARGPE1 (20Brasaemle D.L. Barber T. Kimmel A.R. Londos C. J. Biol. Chem. 1997; 272: 9378-9387Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar) under the control of a constitutive Aspergillus GpdA promoter. The construct was linearized with ScaI and transformed into M. anisopliae protoplasts as described (11Wang C. St. Leger R.J. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 6647-6652Crossref PubMed Scopus (214) Google Scholar).RT-PCR Analysis of Gene Expression—To monitor gene expression of Mpl1 mycelium from 36-h Sabouraud dextrose broth (SDB), cultures were collected by filtration and washed three times with sterile distilled water. Equal amounts (0.2 g, wet weight) of mycelia were incubated (6 h) in 10 ml of water or water supplemented with 0.1% bean root exudate (25Welte M.A. Cermelli S. Griner J. Viera A. Guo Y. Kim D.H. Gindhart J.G. Gross S.P. Curr. Biol. 2005; 15: 1266-1275Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar) or 1% cuticle. Mycelia were also incubated in minimal medium (MM, glucose 10 g/liter, NaNO3 6 g/liter, KCl 0.52 g/liter, MgSO4·7H2O 0.52 g/liter, KH2PO4 0.25 g/liter) or in hemolymph of Manduca sexta. For time course studies, conidia were inoculated in SDB for 1–12 h. To identify any inductive relationship with fatty acids, oleic acid (OA, 600 μm) was added to 36-h MM cultures and incubated for 1–12 h. The mycelia were collected for RNA extraction, cDNA conversion, and RT-PCR analysis as described before (11Wang C. St. Leger R.J. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 6647-6652Crossref PubMed Scopus (214) Google Scholar).Fluorescence Microscopy—Yeast or Metarhizium cells were fixed in 3% formaldehyde in PBS for 20 min and then washed four times with PBS (12DiDonato D. Brasaemle D.L. J. Histochem. Cytochem. 2003; 51: 773-780Crossref PubMed Scopus (104) Google Scholar). Cells were then stained with either Nile Red (NR, Sigma) or Bodipy (D3922, Invitrogen) to detect neutral lipids. A stock solution of NR (500 μg/ml) was prepared in acetone and diluted to 5–10 μg/ml in PBS. Bodipy was used at 10 μg/ml (stock, 1 mg/ml in ethanol) in PBS and provided a more stable fluorescent signal than NR.Lipid Quantification—Total lipid quantification was conducted using a phosphoric acid-vanillin method (13Izard J. Limberger R.J. J. Microbiol. Methods. 2003; 55: 411-418Crossref PubMed Scopus (105) Google Scholar). Conidia of both the wild type and mutant were harvested from newly mycosed Manduca larvae, potato dextrose agar (PDA), or PDA plus 600 μm oleic acid. Spore suspensions (0.5 ml containing ∼1.5 × 108 conidia/ml) were added to glass tubes. To each tube, 2 ml of 18 m H2SO4 was added, and the tubes were boiled in a water bath for 10 min. After cooling (5 min at room temperature), 5 ml of phosphoric acid-vanillin reagent (0.12 g of vanillin, 20 ml of water and the volume adjusted to 100 ml with 85% H3PO4) was added, and the tubes were incubated at 37 °C for 15 min. The samples were centrifuged, and the absorbance of supernatants was measured at 530 nm. A standard curve was generated using triolein (Sigma).For yeast studies, a single colony of pYes2Per transformed yeast cells was incubated overnight in YPD (1% yeast extract, 2% peptone, and 2% dextrose), YPD plus 600 μm OA, 2% raffinose SC-U, or 2% raffinose SC-U plus OA. Cells harvested from the different media were washed three times, adjusted to A600 = 1.0 with sterile water, and incubated for up to 20 h to induce starvation. The cell concentration was adjusted to A600 = 2.0 and 0.5 ml used for lipid assay. Differences in lipid content between treatments were compared using the Duncan’s analysis of variance analysis (SPSS, 11.0.0).Appressorial Turgor Assay—To examine the potential involvement of MPL1 in this process, appressoria were induced on locust hind wings (14Wang C. St. Leger R.J. Eukaryot. Cell. 2005; 4: 937-947Crossref PubMed Scopus (121) Google Scholar). Appressorial turgor pressure was assayed using serial solutions of PEG-8000 (2–13 g in 10 ml of distilled water) (15Howard R.J. Ferrari M.A. Roach D.H. Money N.P. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 11281-11284Crossref PubMed Scopus (608) Google Scholar). Individual wings were dipped in PEG solutions for 10 min, and the percentage of collapsed appressoria was determined from 300 cells per PEG solution.Insect Bioassay—Virulence of the wild type and ΔMpl1 was assayed against newly emerged 5th instar larvae of M. sexta (16St. Leger R.J. Joshi L. Bidochka M.J. Roberts D.W. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6349-6354Crossref PubMed Scopus (329) Google Scholar). Conidia were applied either topically by immersion of larvae in an aqueous suspension containing 2 × 107 conidia/ml for 20 s or by injecting the second proleg with 10 μl of an aqueous suspension containing 5 × 106 spores per ml. Each treatment had three replicates with 10 insects each, and the experiments were repeated twice. Mortality was recorded every 12 h.RESULTSProtein Structure and Characteristics—The mammalian PAT proteins are characterized by conservation through ∼350 amino acids of the N-terminal sequence where the lipid targeting functions reside. Distal to the N-terminal conservations, the proteins diverge to varying degrees (17Garcia A. Subramanian V. Sekowski A. Bhattacharyya S. Love M.W. Brasaemle D.L. J. Biol. Chem. 2004; 279: 8409-8416Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). The full open reading frame of Mpl1 encodes a protein of 183 amino acids (20.3 kDa with a predicted pI of 8.96). MPL1 is therefore only 35% the size of mouse perilipin A (Per A), but it has a similar overall structure and several conserved regions with its N-terminal sequence (overall sequence similarity E = 1 × 10-5) (Fig. 1A). In particular, like the N terminus of Per A (17Garcia A. Subramanian V. Sekowski A. Bhattacharyya S. Love M.W. Brasaemle D.L. J. Biol. Chem. 2004; 279: 8409-8416Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 18Subramanian V. Garcia A. Sekowski A. Brasaemle D.L. J. Lipid Res. 2004; 45: 1983-1991Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar), the MPL1 protein contains N-terminal β-strands, three moderately hydrophobic regions (H1, H2, and H3), and an acidic region (129–136 in MPL1) before H2. Also like Per A, MPL1 has multiple phosphorylation sites, including a consensus cAMP-dependent protein kinase phosphorylation site at position 96 in a region conserved with Per A (Fig. 1, A and B).MPL1 shows homology to a reputed CAP20 protein (Fig. 1B) expressed during appressorial formation by the plant pathogen C. gloeosporioides and critical for virulence (10Hwang C.S. Flaishman M.A. Kolattukudy P.E. Plant Cell. 1995; 7: 183-193PubMed Google Scholar). However, our blast searches (Blastp or tBlastn) revealed no similarities between CAP proteins and either MPL1 or the protein from C. gloeosporioides. No evidence is provided by Hwang et al. (10Hwang C.S. Flaishman M.A. Kolattukudy P.E. Plant Cell. 1995; 7: 183-193PubMed Google Scholar) as to why the Colletotrichum sequence is a CAP protein. Aside from the animal perilipins, homologs (E < 10-5) of MPL1 are only present in pezizomycotinal fungi of the order Ascomycota, and are absent in yeasts and other fungi. Each pezizomycotinal fungus has only a single perilipin-like gene in contrast to animals encoding three perilipin genes (A, B, and C) (19Greenberg A.S. Egan J.J. Wek S.A. Moos Jr., M.C. Londos C. Kimmel A.R. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 12035-12039Crossref PubMed Scopus (211) Google Scholar, 20Brasaemle D.L. Barber T. Kimmel A.R. Londos C. J. Biol. Chem. 1997; 272: 9378-9387Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar).Expression Profile and Localization of MPL1—We analyzed Mpl1 expression in time course studies of M. anisopliae grown in different media. RT-PCR analysis demonstrated strong expression of Mpl1 when the fungus was grown in nutrient-rich media (insect hemolymph or SDB) as compared with nutrient-poor media (Fig. 2A). The addition of fatty acids to mammalian cells stimulates lipid accumulation and increases intracellular levels of perilipin (21Zweytick D. Athenstaedt K. Daum G. Biochim. Biophys. Acta. 2000; 1469: 101-120Crossref PubMed Scopus (265) Google Scholar). Likewise, transcription of Mpl1 by M. anisopliae germlings was up-regulated within 30 min following the addition of oleic acid to minimal medium (MM) (Fig. 2B). Conidia contained many large LDs (Fig. 3A) and demonstrated a strong enrichment of Mpl1 transcripts. Transcription levels decreased during germination (Fig. 2C), and LD numbers dropped by 40% between 6 and 12 h (Fig. S2) as lipid stores are mobilized during germ tube elongation (Fig. 3C). Collectively, these results suggest that Mpl1 regulation parallels lipid storage.FIGURE 2Mpl1 gene expression and protein localization. A, RT-PCR analysis of Mpl1 expression in mycelia cultured for 6 h in water, minimal medium (MM), Sabouraud dextrose broth (SDB), bean root exudates (RE), 1% (w/v) Manduca cuticle (Cut), or hemolymph (HE). B, time course study of Mpl1 expression in 36-h MM culture supplemented with oleic acid (600 μm). C, time course study of Mpl1 expression in conidia germinating in SDB. D and E, co-localization of neutral lipids and MPL1 demonstrated by NR staining of GFP-MPL1 expressing cells in conidia (D), mycelium (E) of M. anisopliae, and a budding yeast (S. cerevisiae) cell (F), respectively. BF, bright field microscopy. Bar = 5 μm.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 3MPL1 affects the number of lipid droplets and germling morphology. Wild type and ΔMpl1 cells were stained with Bodipy to demonstrate the reduced numbers of lipid droplets in the mutant. A, wild type conidia; B, ΔMpl1 conidia; C, wild type germlings; D, comparatively thin ΔMpl1 germlings from 20-h MM cultures (Note, arrows show the transportation of lipid droplets to germ tube tips); E, wild type and F, ΔMpl1 appressoria produced 20-h post-inoculation on locust wings; G, wild type; and H, ΔMpl1 hyphal bodies harvested from the hemocoels of infected insects. Bar = 5 μm.View Large Image Figure ViewerDownload Hi-res image Download (PPT)To visualize the intracellular targeting of MPL1 in vivo, we expressed an MPL1-GFP fusion protein in M. anisopliae using the Aspergillus GpdA promoter. We also determined whether LD localization is a general quality of MPL1 by expressing it with the Gal1-inducible promoter in the yeast S. cerevisiae, which is a system that lacks endogenous perilipin-like proteins. Consistent with GFP fusions of mammalian PAT proteins, i.e. perilipin A (22Garcia A. Sekowski A. Subramanian V. Brasaemle D.L. J. Biol. Chem. 2003; 278: 625-635Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar), TIP47 (23Miura S. Gan J.W. Brzostowski J. Parisi M.J. Schultz C.J. Londos C. Oliver B. Kimmel A.R. J. Biol. Chem. 2002; 277: 32253-32257Abstract Full Text Full Text PDF PubMed Scopus (303) Google Scholar), and adipocyte differentiation-related protein (24Targett-Adams P. Chambers D. Gledhill S. Hope R.G. Coy J.F. Girod A. McLauchlan J. J. Biol. Chem. 2003; 278: 15998-16007Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar), N-terminal fusion of MPL1 with GFP did not disrupt the ability of the protein to localize to lipid vesicles. Transformed yeast and Metarhizium cells treated with the neutral lipid stain NR co-localized with the GFP signal confirming that MPL1 is binding to LDs (Fig. 2, D–F). No additional diffuse cytoplasmic signal was seen with either GFP or NR. The expression patterns and the intracellular localization of MPL1 are therefore consistent with the proposal that the protein plays a regulatory role in global triacylglycerol (TAG) storage by acting at the level of LDs.Loss of Function Mutants Confirm That MPL1 Plays an Important Role in Lipid Homeostasis—Mpl1 null mutants were generated by homologous replacement (Fig. S1). The conidia of wild type (WT) M. anisopliae have multiple LDs (mean per cell = 19.4 ± 3.76) that mostly cluster at the poles of the cell (Fig. 3A). ΔMpl1 conidia have ∼2.4-fold fewer LDs than WT (p < 0.05) indicating that knock-out of Mpl1 impairs, but does not abolish, the ability of M. anisopliae to store lipid (Fig. 3B). During germination of WT conidia in minimal medium, the total number of LDs diminishes by 62% indicative of lipid degradation, and the remaining LDs migrate into the germ tube apexes (mean per apex = 3.6 ± 1.1). This distribution of LDs is explainable by fungi being tip growers; the tip is the area of greatest metabolism and where new membranes are being laid down. Relative to the WT, the ΔMpl1 germ tubes are thinner and apparently analogous to the “lean” phenotype of perilipin-deficient mice (3Martinez-Botas J. Anderson J.B. Tessier D. Lapillonne A. Chang B.H. Quast M.J. Gorenstein D. Chen K.H. Chan L. Nat. Genet. 2000; 26: 474-479Crossref PubMed Scopus (488) Google Scholar) (Fig. 3, C and D). Approximately 50% of ΔMpl1 germ tubes lack visible LDs. The remaining germ tubes have up to three LDs. The aggregated, albeit small, clusters of LDs at the poles of ΔMpl1 conidia (Fig. 3B) and the successful transportation of residual LDs to their hyphal tips (Fig. 3D) indicate that Mpl1 is not crucially involved in mediating the positioning of droplets in Metarhizium. This contrasts with Drosophila where perilipin regulates transportation of LDs (25Welte M.A. Cermelli S. Griner J. Viera A. Guo Y. Kim D.H. Gindhart J.G. Gross S.P. Curr. Biol. 2005; 15: 1266-1275Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). The pattern of LD distribution was also studied during formation of appressoria on locust hind wings. LDs moved into the differentiating hyphal tip so the WT appressoria were enriched in LDs. ΔMpl1 appressoria frequently contained no LDs at all (Fig. 3, E and F).After breaching the insect cuticle, Metarhizium produces variably shaped hyphal bodies for dispersal in the hemocoele (11Wang C. St. Leger R.J. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 6647-6652Crossref PubMed Scopus (214) Google Scholar). The distribution of LDs in these was also examined. Unlike conidia, LDs are dispersed throughout hyphal body cells, but as with other cell types, the ΔMpl1 mutants have fewer (Fig. 3, G and H).Because ΔMpl1 cell types contain relatively few, if any, LDs, the regulation of lipid homeostasis by MPL1 in Metarhizium was also studied by assaying total levels of intracellular lipids (Fig. 4A). Consistent with an elevated number of LDs, there was >2-fold more lipid in WT conidia relative to ΔMpl1 conidia irrespective of whether they were harvested from insect cadavers, PDA, or PDA plus OA. A more dramatic difference in lipid levels (>7-fold) was observed when germinating the WT and ΔMpl1 conidia in a minimal medium (Fig. 4A), indicative of rapid depletion of residual stored lipid in the mutant. As OA up-regulates Mpl1 expression (Fig. 2B), Mpl1 activity might adjust storage of lipids when nutrients are available to ensure extended survival when food supply is limiting. However, the 8% increase in lipid content in conidia harvested from PDA plus OA as compared with PDA alone was not statistically significantly (p > 0.05).FIGURE 4Quantification of lipids from Metarhizium conidia and yeast (S. cerevisiae) cells. A, wild type and ΔMpl1 conidia harvested from mycosed M. sexta cadavers, PDA, and PDA plus OA. B, yeast cells transformed with Mpl1 under the control of the GAL1 promoter were grown overnight in noninductive (YPD or 2% raffinose (Raf)) or inductive media (2% galactose (Gal)) with or without OA and then starved (S) in sterile water for 20 h before lipid assay. Mean lipid content for columns labeled with the same letter are not significantly different (α = 0.01, Duncan’s analysis of variance analysis).View Large Image Figure ViewerDownload Hi-res image Download (PPT)We also quantified lipids in yeast transformed with Mpl1 cDNA under the control of the Gal1 promoter (Fig. 4B). No significant differences in lipid content were observed between cells grown in noninductive media (YPD and 2% raffinose) or inductive medium (2% galactose) with or without the addition of OA. However, yeast cells that had not produced MPL1 rapidly reduced their lipid content during starvation. In contrast, cells previously induced to produce MPL1 failed to utilize their stored lipid when deprived of nutrients showing that MPL1 blocks the access (Fig. 4B).MPL1 Affects Appressorial Differentiation and Fungal Virulence—The “Cap20” transcript of the Mpl1 homolog in the plant pathogen C. gloeosporioides is present in conidia, expressed during formation of appressoria, and null mutants are not pathogenic to tomatoes (10Hwang C.S. Flaishman M.A. Kolattukudy P.E. Plant Cell. 1995; 7: 183-193PubMed Google Scholar). To investigate the role of Mpl1 on appressorium formation/function in M. anisopliae, we induced appressorial differentiation on locust hind wings. WT appressorial differentiation typically occurs after nuclear division with a septum being formed between the appressorium and conidial mother cell (Fig. 5A). However, this compartmentalization of germ tubes occurred in only 10% of the mutant germlings (Fig. 5B).FIGURE 5MPL1 affects appressorial differentiation and turgor pressure. The appressoria produced by conidia germinating on locust hind wings were visualized by staining with Calcofluor white to show the formation of septa (indicated by an arrow) between the appressoria (AP) and conidia (CO) in wild type (A) but not ΔMpl1 germlings (B). Relatively higher levels of ΔMpl1 appressoria collapse when infected locust wings are immersed in serial solutions of PEG-8000 (PEG) for 10 min (C). The insets show collapsed appressoria. Bar = 5 μm.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Analysis of appressorial collapse rates in M. anisopliae using serial concentrations of PEG-8000 shows that the loss of Mpl1 results in a dramatic reduction of turgor pressure (Fig. 5C). This suggests that lipolysis of LDs and consequent production of solutes produce turgor in the wild type. Virulence tests using 5th instar larvae of M. sexta revealed a significant reduction of mortality and speed of kill by ΔMpl1 as compared with the WT. The mutant failed to achieve 50% mortality before the insects pupated (Fig. 6A). However, when the cuticle was bypassed by injecting spores directly into the hemocoele, the speed of kill by the WT (LT50 = 4.42 days) and the mutant (LT50 = 4.72 days) were not significantly different (p = 1.58, t = 0.13) (Fig. 6B). The results indicate that the lack of Mpl1 affects fungal virulence by reducing mechanical penetration of the host cuticle.FIGURE 6The survival of M. sexta larvae after infection with wild type or ΔMpl1 conidia. A, survival of Manduca larvae following topical application with 2 × 107 conidia/ml sus" @default.
• W2047644930 created "2016-06-24" @default.
• W2047644930 creator A5055282694 @default.
• W2047644930 creator A5071518021 @default.
• W2047644930 date "2007-07-01" @default.
• W2047644930 modified "2023-10-14" @default.
• W2047644930 title "The Metarhizium anisopliae Perilipin Homolog MPL1 Regulates Lipid Metabolism, Appressorial Turgor Pressure, and Virulence" @default.
• W2047644930 cites W1500782512 @default.
• W2047644930 cites W1504753880 @default.
• W2047644930 cites W1540864797 @default.
• W2047644930 cites W1969741764 @default.
• W2047644930 cites W1975732952 @default.
• W2047644930 cites W1976879072 @default.
• W2047644930 cites W1987703403 @default.
• W2047644930 cites W2017703643 @default.
• W2047644930 cites W2020543398 @default.
• W2047644930 cites W2024145410 @default.
• W2047644930 cites W2030016913 @default.
• W2047644930 cites W2031299871 @default.
• W2047644930 cites W2031502981 @default.
• W2047644930 cites W2038667709 @default.
• W2047644930 cites W2040690986 @default.
• W2047644930 cites W2049485107 @default.
• W2047644930 cites W2055443182 @default.
• W2047644930 cites W2063083457 @default.
• W2047644930 cites W2076903823 @default.
• W2047644930 cites W2081192589 @default.
• W2047644930 cites W2096519088 @default.
• W2047644930 cites W2098681671 @default.
• W2047644930 cites W2100608670 @default.
• W2047644930 cites W2112180603 @default.
• W2047644930 cites W2131951463 @default.
• W2047644930 cites W2136545373 @default.
• W2047644930 cites W2148123120 @default.
• W2047644930 cites W2155722642 @default.
• W2047644930 doi "https://doi.org/10.1074/jbc.m609592200" @default.
• W2047644930 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17526497" @default.
• W2047644930 hasPublicationYear "2007" @default.
• W2047644930 type Work @default.
• W2047644930 sameAs 2047644930 @default.
• W2047644930 citedByCount "170" @default.
• W2047644930 countsByYear W20476449302012 @default.
• W2047644930 countsByYear W20476449302013 @default.
• W2047644930 countsByYear W20476449302014 @default.
• W2047644930 countsByYear W20476449302015 @default.
• W2047644930 countsByYear W20476449302016 @default.
• W2047644930 countsByYear W20476449302017 @default.
• W2047644930 countsByYear W20476449302018 @default.
• W2047644930 countsByYear W20476449302019 @default.
• W2047644930 countsByYear W20476449302020 @default.
• W2047644930 countsByYear W20476449302021 @default.
• W2047644930 countsByYear W20476449302022 @default.
• W2047644930 countsByYear W20476449302023 @default.
• W2047644930 crossrefType "journal-article" @default.
• W2047644930 hasAuthorship W2047644930A5055282694 @default.
• W2047644930 hasAuthorship W2047644930A5071518021 @default.
• W2047644930 hasBestOaLocation W20476449301 @default.
• W2047644930 hasConcept C104317684 @default.
• W2047644930 hasConcept C2781292303 @default.
• W2047644930 hasConcept C43143990 @default.
• W2047644930 hasConcept C4733338 @default.
• W2047644930 hasConcept C55493867 @default.
• W2047644930 hasConcept C59822182 @default.
• W2047644930 hasConcept C60987743 @default.
• W2047644930 hasConcept C86803240 @default.
• W2047644930 hasConcept C87865070 @default.
• W2047644930 hasConcept C89423630 @default.
• W2047644930 hasConcept C95444343 @default.
• W2047644930 hasConceptScore W2047644930C104317684 @default.
• W2047644930 hasConceptScore W2047644930C2781292303 @default.
• W2047644930 hasConceptScore W2047644930C43143990 @default.
• W2047644930 hasConceptScore W2047644930C4733338 @default.
• W2047644930 hasConceptScore W2047644930C55493867 @default.
• W2047644930 hasConceptScore W2047644930C59822182 @default.
• W2047644930 hasConceptScore W2047644930C60987743 @default.
• W2047644930 hasConceptScore W2047644930C86803240 @default.
• W2047644930 hasConceptScore W2047644930C87865070 @default.
• W2047644930 hasConceptScore W2047644930C89423630 @default.
• W2047644930 hasConceptScore W2047644930C95444343 @default.
• W2047644930 hasIssue "29" @default.
• W2047644930 hasLocation W20476449301 @default.
• W2047644930 hasOpenAccess W2047644930 @default.
• W2047644930 hasPrimaryLocation W20476449301 @default.
• W2047644930 hasRelatedWork W1947502769 @default.
• W2047644930 hasRelatedWork W2044478803 @default.
• W2047644930 hasRelatedWork W2074387040 @default.
• W2047644930 hasRelatedWork W2146753964 @default.
• W2047644930 hasRelatedWork W2274169395 @default.
• W2047644930 hasRelatedWork W2315625558 @default.
• W2047644930 hasRelatedWork W2362092958 @default.
• W2047644930 hasRelatedWork W3033085109 @default.
• W2047644930 hasRelatedWork W2058866255 @default.
• W2047644930 hasRelatedWork W2185909259 @default.
• W2047644930 hasVolume "282" @default.
• W2047644930 isParatext "false" @default.
• W2047644930 isRetracted "false" @default.
• W2047644930 magId "2047644930" @default.
• W2047644930 workType "article" @default.