FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2048543680> ?p ?o ?g. }

• W2048543680 endingPage "22364" @default.
• W2048543680 startingPage "22356" @default.
• W2048543680 abstract "Maspin is a serpin that acts as a tumor suppressor in a range of human cancers, including tumors of the breast and lung. Maspin is crucial for development, because homozygous loss of the gene is lethal; however, the precise physiological role of the molecule is unclear. To gain insight into the function of human maspin, we have determined its crystal structure in two similar, but non-isomorphous crystal forms, to 2.1- and 2.8-Å resolution, respectively. The structure reveals that maspin adopts the native serpin fold in which the reactive center loop is expelled fully from the A β-sheet, makes minimal contacts with the core of the molecule, and exhibits a high degree of flexibility. A buried salt bridge unique to maspin orthologues causes an unusual bulge in the region around the D and E α-helices, an area of the molecule demonstrated in other serpins to be important for cofactor recognition. Strikingly, the structural data reveal that maspin is able to undergo conformational change in and around the G α-helix, switching between an open and a closed form. This change dictates the electrostatic character of a putative cofactor binding surface and highlights this region as a likely determinant of maspin function. The high resolution crystal structure of maspin provides a detailed molecular framework to elucidate the mechanism of function of this important tumor suppressor. Maspin is a serpin that acts as a tumor suppressor in a range of human cancers, including tumors of the breast and lung. Maspin is crucial for development, because homozygous loss of the gene is lethal; however, the precise physiological role of the molecule is unclear. To gain insight into the function of human maspin, we have determined its crystal structure in two similar, but non-isomorphous crystal forms, to 2.1- and 2.8-Å resolution, respectively. The structure reveals that maspin adopts the native serpin fold in which the reactive center loop is expelled fully from the A β-sheet, makes minimal contacts with the core of the molecule, and exhibits a high degree of flexibility. A buried salt bridge unique to maspin orthologues causes an unusual bulge in the region around the D and E α-helices, an area of the molecule demonstrated in other serpins to be important for cofactor recognition. Strikingly, the structural data reveal that maspin is able to undergo conformational change in and around the G α-helix, switching between an open and a closed form. This change dictates the electrostatic character of a putative cofactor binding surface and highlights this region as a likely determinant of maspin function. The high resolution crystal structure of maspin provides a detailed molecular framework to elucidate the mechanism of function of this important tumor suppressor. Maspin (mammary serine proteinase inhibitor (SERPINB5)) was initially identified as a tumor-suppressing serpin down-regulated in invasive mammary carcinoma cell lines (1Zou Z. Anisowicz A. Hendrix M.J. Thor A. Neveu M. Sheng S. Rafidi K. Seftor E. Sager R. Science. 1994; 263: 526-529Crossref PubMed Scopus (820) Google Scholar). Maspin loss in numerous cancers (including breast, prostate, squamous cell carcinoma, gastric cancer, and lung) correlates with metastasis and a poor clinical prognosis (for a review, see Ref. 2Zhang M. Front. Biosci. 2004; 9: 2218-2226Crossref PubMed Scopus (15) Google Scholar). In contrast, high levels of maspin expression in certain cancers (in particular, pancreatic and ovarian cancer) correlate with tumor invasion and poor survival. Like other clade B serpins (3Silverman G.A. Bird P.I. Carrell R.W. Church F.C. Coughlin P.B. Gettins P.G. Irving J.A. Lomas D.A. Luke C.J. Moyer R.W. Pemberton P.A. Remold-O'Donnell E. Salvesen G.S. Travis J. Whisstock J.C. J. Biol. Chem. 2001; 276: 33293-33296Abstract Full Text Full Text PDF PubMed Scopus (1054) Google Scholar), maspin has a nucleocytoplasmic distribution, however it is also found at the cell surface (1Zou Z. Anisowicz A. Hendrix M.J. Thor A. Neveu M. Sheng S. Rafidi K. Seftor E. Sager R. Science. 1994; 263: 526-529Crossref PubMed Scopus (820) Google Scholar, 4Reis-Filho J.S. Milanezi F. Silva P. Schmitt F.C. Pathol. Res. Pract. 2001; 197: 817-821Crossref PubMed Scopus (52) Google Scholar, 5Pemberton P.A. Tipton A.R. Pavloff N. Smith J. Erickson J.R. Mouchabeck Z.M. Kiefer M.C. J. Histochem. Cytochem. 1997; 45: 1697-1706Crossref PubMed Scopus (136) Google Scholar). The intracellular role of maspin is at present unclear, but it has been suggested to play a role in apoptosis pathways (6Jiang N. Meng Y. Zhang S. Mensah-Osman E. Sheng S. Oncogene. 2002; 21: 4089-4098Crossref PubMed Scopus (114) Google Scholar). A large body of evidence suggests that maspin has an important extracellular role: it can suppress tumor growth and metastasis in vivo and tumor cell motility and invasion in vitro (1Zou Z. Anisowicz A. Hendrix M.J. Thor A. Neveu M. Sheng S. Rafidi K. Seftor E. Sager R. Science. 1994; 263: 526-529Crossref PubMed Scopus (820) Google Scholar, 7Sheng S. Carey J. Seftor E.A. Dias L. Hendrix M.J. Sager R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 11669-11674Crossref PubMed Scopus (326) Google Scholar, 8Ngamkitidechakul C. Warejcka D.J. Burke J.M. O'Brien W.J. Twining S.S. J. Biol. Chem. 2003; 278: 31796-31806Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Maspin also plays a fundamental role in early embryonic development; murine knock-out studies reveal that it is essential for proper organization of the epiblast (9Gao F. Shi H.Y. Daughty C. Cella N. Zhang M. Development. 2004; 131: 1479-1489Crossref PubMed Scopus (66) Google Scholar). Consistent with a complex role in tumorigenesis, maspin also exhibits anti-angiogenic activity (10Zhang M. Volpert O. Shi Y.H. Bouck N. Nat. Med. 2000; 6: 196-199Crossref PubMed Scopus (407) Google Scholar), and expression of the maspin gene has been demonstrated to be under the control of the oncogenic transcription factors p53 and p63 (11Zou Z. Gao C. Nagaich A.K. Connell T. Saito S. Moul J.W. Seth P. Appella E. Srivastava S. J. Biol. Chem. 2000; 275: 6051-6054Abstract Full Text Full Text PDF PubMed Scopus (245) Google Scholar, 12Kim S. Han J. Kim J. Park C. Cancer Res. 2004; 64: 6900-6905Crossref PubMed Scopus (49) Google Scholar). Because the failure to properly control proteolytic activity can result in disruption of the basement membrane and promote tumor invasion, it was initially hypothesized that maspin may exert its anti-metastatic effect by functioning as a pericellular protease inhibitor (1Zou Z. Anisowicz A. Hendrix M.J. Thor A. Neveu M. Sheng S. Rafidi K. Seftor E. Sager R. Science. 1994; 263: 526-529Crossref PubMed Scopus (820) Google Scholar).Serpins are unusual molecules that fold into a metastable native state. The majority of serpins function to inhibit either serine or cysteine proteases; however, non-inhibitory members of the family have also been identified, including the avian serpin ovalbumin and the human angiogenesis inhibitor pigment epithelium-derived factor (PEDF) 1The abbreviations used are: PEDF, pigment epithelium-derived factor; r.m.s.d., root mean square deviation; RCL, reactive center loop; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; PAI-2, plasminogen activator inhibitor-2. 1The abbreviations used are: PEDF, pigment epithelium-derived factor; r.m.s.d., root mean square deviation; RCL, reactive center loop; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; PAI-2, plasminogen activator inhibitor-2. (3Silverman G.A. Bird P.I. Carrell R.W. Church F.C. Coughlin P.B. Gettins P.G. Irving J.A. Lomas D.A. Luke C.J. Moyer R.W. Pemberton P.A. Remold-O'Donnell E. Salvesen G.S. Travis J. Whisstock J.C. J. Biol. Chem. 2001; 276: 33293-33296Abstract Full Text Full Text PDF PubMed Scopus (1054) Google Scholar, 13Whisstock J. Skinner R. Lesk A.M. Trends Biochem. Sci. 1998; 23: 63-67Abstract Full Text PDF PubMed Scopus (162) Google Scholar, 14Irving J.A. Pike R.N. Lesk A.M. Whisstock J.C. Genome Res. 2000; 10: 1845-1864Crossref PubMed Scopus (504) Google Scholar). All known inhibitory serpins inactivate target proteases via a major conformational change termed the stressed (S) to relaxed (R) transition. During this rearrangement, the region responsible for docking with the protease (the reactive center loop (RCL)) is cleaved and inserts into the center of a large β-sheet (the A β-sheet), forming an extra β-strand. This conformational rearrangement is responsible for the translocation and trapping of the target protease (15Huntington J.A. Read R.J. Carrell R.W. Nature. 2000; 407: 923-926Crossref PubMed Scopus (937) Google Scholar). Mutations within the RCL that interfere with the S to R transition (for example, within the conserved hinge region) abolish or seriously compromise inhibitory activity. Consistent with these data, serpins (such as ovalbumin and PEDF) that do not function as protease inhibitors have non-conserved hinge regions and lack the ability to undergo the S to R transition under physiological conditions (16Stein P.E. Tewkesbury D.A. Carrell R.W. Biochem. J. 1989; 262: 103-107Crossref PubMed Scopus (125) Google Scholar).Biochemical and biophysical studies reveal that maspin does not undergo the S to R transition and is thus unable to inactivate proteases in a classic serpin-like fashion (17Pemberton P.A. Wong D.T. Gibson H.L. Kiefer M.C. Fitzpatrick P.A. Sager R. Barr P.J. J. Biol. Chem. 1995; 270: 15832-15837Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar). Nor does the RCL of maspin contain the consensus hinge region motif present in inhibitory serpins (18Hopkins P.C. Whisstock J. Science. 1994; 265: 1893-1894Crossref PubMed Google Scholar, 19Hopkins P.C. Stone S.R. Biochemistry. 1995; 34: 15872-15879Crossref PubMed Scopus (60) Google Scholar). It has been suggested that maspin may control the urokinase-type plasminogen activator and/or tissue-type plasminogen activator; however, recent studies do not support this view (8Ngamkitidechakul C. Warejcka D.J. Burke J.M. O'Brien W.J. Twining S.S. J. Biol. Chem. 2003; 278: 31796-31806Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 20Bass R. Fernandez A.M. Ellis V. J. Biol. Chem. 2002; 277: 46845-46848Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). Interestingly, however, the RCL of maspin is clearly important for function: studies using synthetic maspin RCL peptides as well as maspin/ovalbumin chimeras reveal that this region is important for promoting cell adhesion (8Ngamkitidechakul C. Warejcka D.J. Burke J.M. O'Brien W.J. Twining S.S. J. Biol. Chem. 2003; 278: 31796-31806Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 21Blacque O.E. Worrall D.M. J. Biol. Chem. 2002; 277: 10783-10788Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar). Taken together, these data suggest that maspin is a non-inhibitory serpin that functions to suppress angiogenesis and metastasis through an as yet uncharacterized protein-protein or protein-ligand interaction.The role of maspin in tumor progression, angiogenesis, and embryogenesis is of great interest, but many aspects of maspin biology, such as the underlying biochemical reasons behind the apparently conflicting role of maspin in different cancers, remain to be understood. To begin to understand maspin at the molecular level we have determined two crystal structures of this important human tumor suppressor, at 2.1- and 2.8-Å resolution. Recently a 3.1-Å crystal structure of a maspin mutant lacking cysteine residues has been reported (22Al-Ayyoubi M. Gettins P.G. Volz K. J. Biol. Chem. 2004; 279: 55540-55544Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar); however, the low resolution of this structure places a limit on structural interpretation. High resolution structures of the wild-type protein reveal that maspin is capable of undergoing conformational change in and around the G-helix, a region of the serpin scaffold previously understood to be conformationally inert. In particular, structural changes in this region result in a major reorganization of charged residues and the manifestation of a large negatively charged patch centered on the G-helix. We suggest that this region represents a cofactor binding site under conformational control.EXPERIMENTAL PROCEDURESProtein Expression and Purification—The pRSETc/maspin plasmid (21Blacque O.E. Worrall D.M. J. Biol. Chem. 2002; 277: 10783-10788Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar) was modified by restriction enzyme digest, using NdeI and EcoRI to excise the translated codons upstream of the maspin cDNA and replace them with the following oligonucleotides after annealing: 5′-tatgcggggttctcatcatcatcatcatcatgaaaacctgtattttcagggccag and 5′-aattctggccctgaaaatacaggttttcatgatgatgatgatgatgagaaccccgca.The resulting plasmid, pHisTev/maspin, encodes an N-terminal hexahistidine tag linked to the maspin cDNA via a tobacco etch virus protease recognition site. Maspin was expressed in Escherichia coli and purifed using nickel-nitrilotriacetic acid-agarose as described previously (Qiagen) (21Blacque O.E. Worrall D.M. J. Biol. Chem. 2002; 277: 10783-10788Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar), except that the N-terminal hexahistidine tag on the recombinant maspin was removed using tobacco etch virus protease as described (23Kapust R.B. Tozser J. Fox J.D. Anderson D.E. Cherry S. Copeland T.D. Waugh D.S. Protein Eng. 2001; 14: 993-1000Crossref PubMed Scopus (622) Google Scholar) and the tag-less maspin protein was further purified by gel filtration using Superdex 200 (Amersham Biosciences). Recombinant maspin was routinely stored in 50 mm Tris-HCl, pH 8.0, 150 mm NaCl, 5 mm β-mercaptoethanol, and this material was used throughout the course of the work. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (Voyager-DE STR BioSpectrometry Workstation, Applied Biosystems, Framingham, MA) revealed that the molecular mass of the purified product was 42.92 kDa, compared with a theoretical molecular mass of 42.53 kDa. Because β-mercaptoethanol was used in all buffers throughout the purification and crystallization steps, the molecular weight discrepancy corresponds to approximately five cysteine residues derivatized with β-mercaptoethanol. The derivation of cysteine residues is consistent with the high resolution crystal structures, which show three and six derivatized cysteines for each of the two molecules in the asymmetric unit.Maspin Cleavage by Cathepsin L—Recombinant maspin (18 μm) was treated with 0.25 μm recombinant human cathepsin L (24Carmona E. Dufour E. Plouffe C. Takebe S. Mason P. Mort J.S. Menard R. Biochemistry. 1996; 35: 8149-8157Crossref PubMed Scopus (189) Google Scholar) at 37 °C for 30 min in 0.1 m NaAc, pH 5.5, 1 mm EDTA, 0.1% Brij-35, 10 mm cysteine. Complete cleavage within the RCL was confirmed by SDS-PAGE, and the molecular masses of the cleaved products were found to be 38.24 and 4.707 kDa by mass spectrometry. Based on these data (and the observation that the only cysteine residue in the C-terminal peptide is buried and unmodified in all crystal structures) the position of the cleavage site was mapped to P5/P6 (SIE↓VPG).Spectroscopic Methods—Circular dichroism experiments were performed using a Jasco 810 Spectropolarimeter (Jasco, Tokyo). The protein concentration for both cleaved and native maspin used was 15 μm with a 0.1-cm path length. Thermal denaturation was performed at a heating rate of 1 °C/min in 20 mm Tris-HCl, pH 8.0, and monitored at 222 nm.Cell-Extracellular Matrix Adhesion Assay—The breast carcinoma cell line MDA-MB-231 (provided by T. Brown, Monash University), was routinely cultured in RPMI 1640 medium containing 10% fetal calf serum and 2 mm glutamine (Invitrogen). For the cell adhesion assay, wells were coated with 50 μl of 5 μg/ml fibronectin (Sigma) and blocked with 2% bovine serum albumin in phosphate-buffered saline. The cell adhesion assay was performed essentially as described by Ngamkitidechakul et al. (8Ngamkitidechakul C. Warejcka D.J. Burke J.M. O'Brien W.J. Twining S.S. J. Biol. Chem. 2003; 278: 31796-31806Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar), except that prior to assessing adhesion, cells in suspension were preincubated with the indicated concentration of recombinant maspin for 30 min at 37 °C, then added directly to the wells.Crystallization—Maspin was concentrated to 20 mg/ml and a Cartesian Honeybee™ crystallization robot (Genomic Solutions) was used to establish initial crystallization conditions (100-nl drops). Small needles were identified in a condition containing 0.1 m Tris, pH 8.28, 3 m (NH4)2SO4. Subsequent fine screening was carried out using the hanging drop vapor diffusion method. Single large crystals grew at 22 °C in 0.1 m BisTris, pH 8.3, 2.9 m (NH4)2SO4 after 4–6 weeks. The crystals were flash-frozen prior to data collection with 5% ethylene glycol as the cryoprotectant.X-ray Data Collection, Structure Determination, and Refinement—The first crystal form of maspin diffracted to 2.8-Å resolution and belongs to space group P212121, with unit cell dimensions of a = 53.54 Å, b = 100.48 Å, c = 136.61 Å. The second form diffracted to 2.1-Å resolution and belongs to space group P212121, with unit cell dimensions of a = 54.12, b = 95.05, c = 139.23. Both structures are consistent with two monomers in the asymmetric unit and ∼42% solvent content (calculated using Matthews (25Matthews B.W. J. Mol. Biol. 1968; 33: 491-497Crossref PubMed Scopus (7899) Google Scholar)). The data were integrated and scaled with the HKL suite (26Otwinowski Z. Minor. W. Methods Enzymol. 1997; 276: 307-326Crossref Scopus (38344) Google Scholar). See Table I for a summary of data collection statistics.Table IData collection and refinement statisticsData collection2.8 Å2.1 ÅSpace groupP212121P212121Cell dimensions (Å): a, b, ca = 53.54, b = 100.48, c = 136.61a = 54.12, b = 95.05, c = 139.23Resolution (Å)50–2.878.6–2.1Total number of observations51,277246,426Number of unique observations17,99742,714Multiplicity2.85.8Data completeness (%)97.0 (94.0)aValues in parentheses refer to the highest resolution shell99.8 (99.4)〈I/σI〉11.5 (3.2)22.2 (2.2)Rmerge (%)bAgreement between intensities of repeated measurements of the same reflections and can be defined as: Σ(Ih,i – 〈Ih〉)/Σ Ih,i, where Ih,i are individual values and 〈Ih〉 is the mean value of the intensity of reflection h8.7 (32.0)4.5 (71.0)Structure refinementNon-hydrogen atomsProtein5,8255,528Solvent124201Sulfate21Rfree (%)cThe free R factor was calculated with the 5% of data omitted from the refinement28.324.9Rcryst (%)23.220.7r.m.s.d.s from idealityBond lengths (Å)0.0090.007Bond angles (°)1.311.15Impropers (°)18.9015.60Dihedrals (°)1.181.13Ramachandran plotMost favored (%)85.490.1Additional allowed (%)13.49.8B factors (Å2)Mean-main chain (A/B)19.6/20.236.8/46.4Mean-side chain (A/B)21.6/22.138.8/46.8Mean water molecule27.445.2r.m.s.d. bonded Bs (A/B)1.16/1.250.66/1.78a Values in parentheses refer to the highest resolution shellb Agreement between intensities of repeated measurements of the same reflections and can be defined as: Σ(Ih,i – 〈Ih〉)/Σ Ih,i, where Ih,i are individual values and 〈Ih〉 is the mean value of the intensity of reflection hc The free R factor was calculated with the 5% of data omitted from the refinement Open table in a new tab The 2.8-Å structure was solved using an implementation of the molecular replacement method (resolution range, 10–3.5 Å) within the PHASER program (27Storoni L.C. McCoy A.J. Read R.J. Acta Crystallogr. D Biol. Crystallogr. 2004; 60: 432-438Crossref PubMed Scopus (1089) Google Scholar) and multiple superposed search models of native serpins (ovalbumin, 1OVA; antitrypsin, 1QLP; serpin 1K, 1SEK; antithrombin, 1E05). Two clear peaks in the rotation function yielded two solutions in the translation function that packed well within the unit cell and, together with unbiased features in the initial electron density map, confirmed the correctness of the molecular replacement solution.An initial model was built using native ovalbumin (1OVA), with all sequence differences mutated to alanine. The progress of refinement was monitored by the Rfree value (5% of the data) with neither a sigma, nor a low resolution cut-off applied to the data. The structure was refined using rigid-body fitting of the individual domains followed by the simulated-annealing protocol implemented in CNS (version 1.1) (28Brunger A.T. Adams P.D. Clore G.M. DeLano W.L. Gros P. Grosse-Kunstleve R.W. Jiang J.S. Kuszewski J. Nilges M. Pannu N.S. Read R.J. Rice L.M. Simonson T. Warren G.L. Acta Crystallogr. D Biol. Crystallogr. 1998; 54: 905-921Crossref PubMed Scopus (16929) Google Scholar), interspersed with rounds of model building using the program ‘O’ (29Jones T.A. Zou J.Y. Cowan S.W. Kjeldgaard M. Acta Crystallogr. A. 1991; 47: 110-119Crossref PubMed Scopus (13003) Google Scholar). Tightly restrained individual B-factor refinement was employed, and bulk solvent correction was applied to the data set, which led to a significant drop in the Rfree value. Further refinement, incorporating translation, libration, and screw-rotation displacement refinement was then carried out using REFMAC (30Murshudov G.N. Vagin A.A. Dodson E.J. Acta Crystallogr. Sect. D. 1997; 53: 240-255Crossref PubMed Scopus (13773) Google Scholar). A bulk solvent correction (Babinet model with mask) was also used within REFMAC. Throughout refinement, tight non-crystallographic symmetry restraints were imposed on the two molecules, excluding residues involved in crystal contacts. Water molecules were included in the model if they were within hydrogen-bonding distance to chemically reasonable groups, if they appeared in Fo - Fc maps contoured at 3.5σ and had a B-factor <60 Å2. The RCL loop in both monomers was observed to be mobile and relatively disordered and was not modeled fully in either monomer.Upon obtaining better diffracting crystals, the 2.1-Å structure was solved by molecular replacement using AMORE (31Navaza J. Acta Crystallogr. D Biol. Crystallogr. 2001; 57: 1367-1372Crossref PubMed Scopus (658) Google Scholar) and chain A of the refined 2.8-Å model as a search probe. Subsequent structure refinement proceeded as for the 2.8-Å structure using CNS, however the higher resolution data permitted full positional and B-factor refinement without non-crystallographic symmetry restraints. Further refinement, incorporating translation, libration, and screw-rotation displacement refinement was then carried out using REFMAC (30Murshudov G.N. Vagin A.A. Dodson E.J. Acta Crystallogr. Sect. D. 1997; 53: 240-255Crossref PubMed Scopus (13773) Google Scholar), together with automated placement of solvent molecules using ARP/wARP. A bulk solvent correction (Babinet model with mask) was also used within REFMAC. See Table I for a summary of refinement statistics and model quality. The coordinates and structure factors have been deposited in the Protein Data Bank (accession codes 1XU8 and 1WZ9).Structural Analysis—Hydrogen bonds (excluding water-mediated bonds), salt bridges, and surface area were calculated using the WHA-TIF server (32Rodriguez R. Chinea G. Lopez N. Pons T. Vriend G. Bioinformatics. 1998; 14: 523-528Crossref PubMed Scopus (309) Google Scholar); MolScript (33Kraulis P.J. J. Appl. Crystallogr. 1991; 24: 946-950Crossref Google Scholar) and Raster3D (34Merritt E.A. Acta Crystallogr. D. Biol. Crystallogr. 1994; 50: 869-873Crossref PubMed Scopus (2854) Google Scholar) were used to produce Figs. 1, 4, 5C, 5D, 5E, 6A, 6B, and 7. GRASP (35, Nicholls, A. (1992) GRASP, Graphical Representation and Analysis of Surface Properties, New YorkGoogle Scholar) was used to produce Fig. 5 (A and B), and Alscript (36Barton G.J. Protein Eng. 1993; 6: 37-40Crossref PubMed Scopus (1109) Google Scholar) and DeluxeAlign 2J. Irving, unpublished data. were used to produce Fig. 3. GRASP surfaces were color-coded according to electrostatic potential (calculated by the Poisson-Boltzmann solver within GRASP). Lys and Arg residues were assigned a single positive charge, and Asp and Glu residues were assigned a single negative charge; all other residues were considered neutral. The calculation was done assuming a uniform dielectric constant of 80 for the solvent and 2 for the protein interior. The ionic strength was set to zero. The color of the surface represents the electrostatic potential at the protein surface, going from blue (potential of +10 kT/e) to red (potential of -10 kT/e), where T is temperature, e is the charge of an electron, and k is the Boltzmann constant. The probe radius used was 1.4 Å. Maspin, PEDF, and ovalbumin were superposed using the program PINQ (Ref. 37Lesk A.M. Saccone C. Biosequences: Perspectives and User Services in Europe. European Economic Community, Brussels, Belgium1986: 23-28Google Scholar and references contained therein), and using techniques as previously described (38Whisstock J.C. Skinner R. Carrell R.W. Lesk A.M. J. Mol. Biol. 2000; 296: 685-699Crossref PubMed Scopus (59) Google Scholar). The G-helix rotation angle was calculated using the program PINQ (Ref. 37Lesk A.M. Saccone C. Biosequences: Perspectives and User Services in Europe. European Economic Community, Brussels, Belgium1986: 23-28Google Scholar and references contained therein). Cavities were calculated using Quanta (Accelrys Inc.).Fig. 4Stereo superposition of maspin, PEDF, and ovalbumin. Maspin is in black, ovalbumin in red, and PEDF in green.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 5A, a GRASP electrostatic potential surface of maspin. The view, centered on the D- and E-helices, reveals a cluster of basic residues as well as the buried salt bridge. B, a GRASP electrostatic potential surface of maspin showing the altered electrostatic characteristics of (left) the open form (2.1-Å chain A), and (right) the closed form (A chain of 1XQG). Residues that contribute to the charged patch are labeled. C, a schematic showing the position of the positively charged cluster (dark blue) as well as residues lining the cavity beneath the D-helix (in green; Phe70, Val73, Thr74, Val77, Ile33, and Leu88). The positions of Lys79, Lys87, Arg91, Lys109, and Arg110 as well as the salt bridge between Lys90/Glu115 (in red) are labeled. The bulge in the loop preceding s1A is highlighted in magenta. D, the corresponding region in ovalbumin: Asn186 forms a hydrogen bond to Ser116 (the equivalent residue to Lys90) as well as the backbone of Ala56. E, close-up stereo diagram showing the open (yellow) and closed (cyan) conformations around the G-helix. The β-mercaptoethanol-derivatized cysteines are shown in purple, positively charged residues in blue, and negatively charged residues in red. B-sheet strands are labeled. Residue labels are appended with a or b to differentiate the chains.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 6Comparisons of maspin structures.A, a structural superposition of the 2.1- and 2.8-Å maspin structures, and the previously determined, non-isomorphous structure of maspin at 3.1 Å (PDB code 1XQG (22Al-Ayyoubi M. Gettins P.G. Volz K. J. Biol. Chem. 2004; 279: 55540-55544Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar)) is shown, revealing striking conformational heterogeneity at the G-helix. The Cα traces are colored as follows: 2.1-Å chain A (red), 2.1-Å chain B (black), 2.8-Å chain A (cyan), 2.8-Å chain B (magenta), 3.1-Å (1XQG) chain A (green). B, superposition of maspin (closed form in red, open form in green) with the native conformations of clade B serpins ovalbumin (black) and PAI-2 (blue).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 7Residues unique in maspin. A stereo schematic illustrating the positions of residues predicted to be important to maspin function. The residues are mapped onto chain A of the 2.1-Å structure, and colored according to type: blue, basic; red, acidic; green, polar; gold, non-polar. The G-helix and s3C–s4C hairpin loop are shown as dotted lines.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 3Sequence alignment of all maspin-like proteins. The secondary structure of maspin is shown above the alignment, and numbering is for human maspin. Conserved residues are in bold and boxed. The positions of Lys90 and Glu115 are indicated by asterisks. Species are labeled as follows: hos, human; mmu, mouse; rno, rat; gga, chicken; xla, frog.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Analysis of Sequence Conservation—The patterns of conservation within sub-branches of the intracellular (clade B) family of serpins (14Irving J.A. Pike R.N. Lesk A.M. Whisstock J.C. Genome Res. 2000; 10: 1845-1864Crossref PubMed Scopus (504) Google Schol" @default.
• W2048543680 created "2016-06-24" @default.
• W2048543680 creator A5018635279 @default.
• W2048543680 creator A5031275115 @default.
• W2048543680 creator A5036417435 @default.
• W2048543680 creator A5046822952 @default.
• W2048543680 creator A5047563397 @default.
• W2048543680 creator A5050620343 @default.
• W2048543680 creator A5050738316 @default.
• W2048543680 creator A5053894618 @default.
• W2048543680 creator A5054562937 @default.
• W2048543680 creator A5061930729 @default.
• W2048543680 creator A5076905861 @default.
• W2048543680 creator A5081880237 @default.
• W2048543680 creator A5088390473 @default.
• W2048543680 date "2005-06-01" @default.
• W2048543680 modified "2023-10-03" @default.
• W2048543680 title "The High Resolution Crystal Structure of the Human Tumor Suppressor Maspin Reveals a Novel Conformational Switch in the G-helix" @default.
• W2048543680 cites W1502713173 @default.
• W2048543680 cites W1539796472 @default.
• W2048543680 cites W1933062072 @default.
• W2048543680 cites W1964524187 @default.
• W2048543680 cites W1971646948 @default.
• W2048543680 cites W1980564158 @default.
• W2048543680 cites W1981570640 @default.
• W2048543680 cites W1982941324 @default.
• W2048543680 cites W1983561824 @default.
• W2048543680 cites W1986698112 @default.
• W2048543680 cites W1993395700 @default.
• W2048543680 cites W1995017064 @default.
• W2048543680 cites W1995655166 @default.
• W2048543680 cites W2007219751 @default.
• W2048543680 cites W2008325045 @default.
• W2048543680 cites W2009073915 @default.
• W2048543680 cites W2013083986 @default.
• W2048543680 cites W2013474205 @default.
• W2048543680 cites W2014694459 @default.
• W2048543680 cites W2016765195 @default.
• W2048543680 cites W2027766635 @default.
• W2048543680 cites W2028231353 @default.
• W2048543680 cites W2028745592 @default.
• W2048543680 cites W2029415557 @default.
• W2048543680 cites W2034350906 @default.
• W2048543680 cites W2038840577 @default.
• W2048543680 cites W2039597097 @default.
• W2048543680 cites W2040295790 @default.
• W2048543680 cites W2043688321 @default.
• W2048543680 cites W2048263097 @default.
• W2048543680 cites W2054526594 @default.
• W2048543680 cites W2063267527 @default.
• W2048543680 cites W2074967753 @default.
• W2048543680 cites W2075106828 @default.
• W2048543680 cites W2078248419 @default.
• W2048543680 cites W2079068643 @default.
• W2048543680 cites W2079921751 @default.
• W2048543680 cites W2086652886 @default.
• W2048543680 cites W2091969321 @default.
• W2048543680 cites W2106320506 @default.
• W2048543680 cites W2106882534 @default.
• W2048543680 cites W2114710924 @default.
• W2048543680 cites W2122932905 @default.
• W2048543680 cites W2141793288 @default.
• W2048543680 cites W2148131811 @default.
• W2048543680 cites W2160898059 @default.
• W2048543680 cites W2160988970 @default.
• W2048543680 cites W2170327826 @default.
• W2048543680 cites W2171215167 @default.
• W2048543680 cites W2235400136 @default.
• W2048543680 cites W4229858997 @default.
• W2048543680 cites W4246582722 @default.
• W2048543680 cites W4313379548 @default.
• W2048543680 doi "https://doi.org/10.1074/jbc.m412043200" @default.
• W2048543680 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15760906" @default.
• W2048543680 hasPublicationYear "2005" @default.
• W2048543680 type Work @default.
• W2048543680 sameAs 2048543680 @default.
• W2048543680 citedByCount "69" @default.
• W2048543680 countsByYear W20485436802012 @default.
• W2048543680 countsByYear W20485436802013 @default.
• W2048543680 countsByYear W20485436802014 @default.
• W2048543680 countsByYear W20485436802015 @default.
• W2048543680 countsByYear W20485436802016 @default.
• W2048543680 countsByYear W20485436802017 @default.
• W2048543680 countsByYear W20485436802018 @default.
• W2048543680 countsByYear W20485436802019 @default.
• W2048543680 countsByYear W20485436802020 @default.
• W2048543680 countsByYear W20485436802021 @default.
• W2048543680 countsByYear W20485436802022 @default.
• W2048543680 countsByYear W20485436802023 @default.
• W2048543680 crossrefType "journal-article" @default.
• W2048543680 hasAuthorship W2048543680A5018635279 @default.
• W2048543680 hasAuthorship W2048543680A5031275115 @default.
• W2048543680 hasAuthorship W2048543680A5036417435 @default.
• W2048543680 hasAuthorship W2048543680A5046822952 @default.
• W2048543680 hasAuthorship W2048543680A5047563397 @default.
• W2048543680 hasAuthorship W2048543680A5050620343 @default.
• W2048543680 hasAuthorship W2048543680A5050738316 @default.
• W2048543680 hasAuthorship W2048543680A5053894618 @default.

• next