FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2049291236> ?p ?o ?g. }

• W2049291236 endingPage "26826" @default.
• W2049291236 startingPage "26820" @default.
• W2049291236 abstract "The pineal gland expresses a unique member of the opsin family (P-opsin; Max, M., McKinnon, P. J., Seidenman, K. J., Barrett, R. K., Applebury, M. L., Takahashi, J. S., and Margolskee, R. F. (1995) Science 267, 1502–1506) that may play a role in circadian entrainment and photo-regulation of melatonin synthesis. To study the function of this protein, an epitope-tagged P-opsin was stably expressed in an embryonic chicken pineal cell line. When incubated with 11-cis-retinal, a light-sensitive pigment was formed with a λmax at 462 ± 2 nm. P-opsin bleached slowly in the dark (t 1/2 = 2 h) in the presence of 50 mm hydroxylamine. Purified P-opsin in dodecyl maltoside activated rod transducin in a light-dependent manner, catalyzing the exchange of more than 300 mol of GTPγS (guanosine 5′-O-(3-thiotriphosphate))/mol of P-opsin. The initial rate for activation (75 mol of GTPγS bound/mol of P-opsin/min at 7 μm) increased with increasing concentrations of transducin. The addition of egg phosphatidylcholine to P-opsin had little effect on the activation kinetics; however, the intrinsic rate of decay in the absence of transducin was accelerated. These results demonstrate that P-opsin is an efficient catalyst for activation of rod transducin and suggest that the pineal gland may contain a rodlike phototransduction cascade. The pineal gland expresses a unique member of the opsin family (P-opsin; Max, M., McKinnon, P. J., Seidenman, K. J., Barrett, R. K., Applebury, M. L., Takahashi, J. S., and Margolskee, R. F. (1995) Science 267, 1502–1506) that may play a role in circadian entrainment and photo-regulation of melatonin synthesis. To study the function of this protein, an epitope-tagged P-opsin was stably expressed in an embryonic chicken pineal cell line. When incubated with 11-cis-retinal, a light-sensitive pigment was formed with a λmax at 462 ± 2 nm. P-opsin bleached slowly in the dark (t 1/2 = 2 h) in the presence of 50 mm hydroxylamine. Purified P-opsin in dodecyl maltoside activated rod transducin in a light-dependent manner, catalyzing the exchange of more than 300 mol of GTPγS (guanosine 5′-O-(3-thiotriphosphate))/mol of P-opsin. The initial rate for activation (75 mol of GTPγS bound/mol of P-opsin/min at 7 μm) increased with increasing concentrations of transducin. The addition of egg phosphatidylcholine to P-opsin had little effect on the activation kinetics; however, the intrinsic rate of decay in the absence of transducin was accelerated. These results demonstrate that P-opsin is an efficient catalyst for activation of rod transducin and suggest that the pineal gland may contain a rodlike phototransduction cascade. arylalkylamine-N-acetyltransferase pineal opsin guanosine 5′-O-(3-thiotriphosphate) dodecyl maltoside phosphatidylcholine. Circadian rhythms are synchronized or entrained by external stimuli, particularly environmental light. In birds and reptiles, the isolated pineal gland is directly photosensitive and synthesizes melatonin rhythmically under the regulation of an endogenous circadian oscillator (2Binkely S. MacBride S.E. Klein D.C. Ralph C.L. Science. 1973; 181: 273-275Crossref PubMed Scopus (108) Google Scholar, 3Deguchi T. Nature. 1979; 282: 94-96Crossref PubMed Scopus (222) Google Scholar, 4Deguchi T. Science. 1979; 203: 1245-1247Crossref PubMed Scopus (153) Google Scholar, 5Zatz M. Mullen D.A. Moskal J.R. Brain Res. 1988; 438: 199-215Crossref PubMed Scopus (133) Google Scholar, 6Robertson L.M. Takahashi J.S. J. Neurosci. 1988; 8: 12-21Crossref PubMed Google Scholar, 7Robertson L.M. Takahashi J.S. J. Neurosci. 1988; 8: 22-30Crossref PubMed Google Scholar, 8Takahashi J.S. Murakami N. Nikaido S.S. Pratt B.L. Robertson L.M. Rec. Prog. Hormone Res. 1989; 45: 279-352PubMed Google Scholar). In contrast, the mammalian pineal gland does not directly respond to light (9Axelrod J. Science. 1974; 184: 1341-1348Crossref PubMed Scopus (721) Google Scholar). Light exerts two distinct effects on avian pineal melatonin synthesis. First, light acutely suppresses the activity of the rate-limiting enzyme, arylalkylamineN-acetyltransferase (AA-NAT)1 without limiting the synthesis of its mRNA (10Bernard M. Iuvone P.M. Cassone B.M. Roseboom H. Coon S.L. Klein D.C. J. Neurochem. 1997; 68: 213-224Crossref PubMed Scopus (176) Google Scholar). Second, light entrains the phase of the circadian oscillator (reviewed in Ref. 8Takahashi J.S. Murakami N. Nikaido S.S. Pratt B.L. Robertson L.M. Rec. Prog. Hormone Res. 1989; 45: 279-352PubMed Google Scholar), which in turn regulates the transcription of AA-NAT (10Bernard M. Iuvone P.M. Cassone B.M. Roseboom H. Coon S.L. Klein D.C. J. Neurochem. 1997; 68: 213-224Crossref PubMed Scopus (176) Google Scholar, 11Bernard M. Klein D.C. Zatz M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 304-309Crossref PubMed Scopus (86) Google Scholar). The phototransduction pathway that leads to these two effects has not yet been elucidated, and the relationship between the acute and phase-shift responses is uncertain. Acute photo-suppression of chick pineal melatonin synthesis and photo-entrainment of the circadian clock respond to a spectrally broad range of wavelengths with equivalent sensitivity between 450 and 500 nm (12Deguchi T. Nature. 1981; 290: 706-707Crossref PubMed Scopus (139) Google Scholar, 13Robertson L.M. The Avian Pineal: Characterization of a Cellular Circadian System.Ph.D. thesis. Northwestern University, Evanston, IL1990Google Scholar). A rhodopsin-like photopigment was postulated to mediate pineal phototransduction based on several observations: sensitivity to light in the visible region; an action spectrum consistent with vitamin A-based pigments (12Deguchi T. Nature. 1981; 290: 706-707Crossref PubMed Scopus (139) Google Scholar); the existence of 11-cis- and all-trans retinal in the pineal gland (14Sun J.H. Reiter R.J. Mata N.L. Tsin A.T. Neurosci. Lett. 1991; 133: 97-99Crossref PubMed Scopus (18) Google Scholar, 15Foster R.G. Korf H.W. Schalken J.J. Cell Tissue Res. 1987; 248: 61-167Crossref Scopus (62) Google Scholar, 16Masuda H. Oishi T. Ohtani M. Michinomai M. Fukada Y. Shichida Y. Yoshizawa T. Tissue Cell. Res. 1994; 26: 101-113Crossref Scopus (40) Google Scholar); opsin immunoreactivity (17Vigh B. Vigh-Teichman I. Cell Tissue Res. 1981; 221: 451-463Crossref PubMed Scopus (88) Google Scholar); and immunochemical identification in the pineal gland of retinal proteins such as transducin (18Van Veen T. Ostholm T. Gierschik P. Spiegel A. Somers R. Korf H.W. Klein D.D. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 912-916Crossref PubMed Scopus (81) Google Scholar), arrestin (19Van Veen R. Elofsson R. Hartwig H.G. Gery I. Mochizuki M. Cena V. Klein D.C. Exp. Biol. 1986; 45: 15-25PubMed Google Scholar), and others (20Lolley R.N. Craft C.M. Lee R.H. Neurochem. Res. 1992; 17: 81-89Crossref PubMed Scopus (40) Google Scholar). Using molecular cloning, a chicken pinealocyte-specific cDNA was recently identified that encodes a protein with strong similarity to the visual opsins (1Max M. McKinnon P.J. Seidenman K.J. Barrett R.K. Applebury M.L. Takahashi J.S. Margolskee R.F. Science. 1995; 267: 1502-1506Crossref PubMed Scopus (146) Google Scholar, 21Okano T. Yoshizawa T. Fukada Y. Nature. 1994; 270: 94-97Crossref Scopus (277) Google Scholar). This protein, pineal opsin (P-opsin), is ∼40% identical to the visual pigments. P-opsin, but none of the known chicken visual opsins, was found to be expressed in pinealocytes by RNase protection and in situhybridization, 2L. Ruiz-Avila, R. F. Margolskee, and M. Max, submitted for publication.2L. Ruiz-Avila, R. F. Margolskee, and M. Max, submitted for publication. suggesting that P-opsin might mediate pineal phototransduction. A consideration of P-opsin's amino acid sequence suggests that it binds 11-cis-retinal and activates transducin. To characterize the spectral and biochemical properties of P-opsin, an epitope-tagged P-opsin was expressed in embryonic chick pineal cells (CP3 cells; Ref.22Sheshbaradaran H. Takahashi J.S. Mol. Cell Neurosci. 1994; 5: 309-318Crossref PubMed Scopus (25) Google Scholar). P-opsin was regenerated with 11-cis-retinal and purified by immunoaffinity chromatography to obtain absorption spectra. In addition, we characterized the ability of expressed P-opsin to catalyze light-dependent guanyl nucleotide exchange on bovine rod transducin. To create the epitope-tagged P-opsin cDNA (23Mackenzie D. Arendt A. Hargrave P. McDowell J. Molday R. Biochem. 1984; 23: 6544-6549Crossref PubMed Scopus (179) Google Scholar), anEcoRI-ApaI fragment of the P-opsin gene was cloned into pMT4 (24Franke R.R. Sakmar T.P. Oprian D.D. Khorana H.G. J. Biol. Chem. 1988; 263: 2119-2122Abstract Full Text PDF PubMed Google Scholar) together with the synthetic linker (sense, CCATGCAGATGTCACCGCAGCGGGGCTGAGGAACAAGGTGATGCCAGCACACCCCGTGGAGACTAGTCAGGTGGCTCCTGCTTGAGC; antisense, GGCCGCTCAAGCAGGAGCCACCTGACTAGTCTCCACGGGGTGTGCTGGCATCACCTTGTTCCTCAGCCCCGCTGCGGTGACATCTGCATGGGGCC), that recreates the carboxyl terminus of P-opsin sequence (1–351) and adds the 1D4 epitope and termination codon of bovine rhodopsin (341–348). The resulting cDNA was subcloned as anEcoRI-NotI fragment into pBK-RSV (with the prokaryotic promoter removed; Stratagene) and was confirmed by DNA sequencing. CP3, a clonal, immortal, transformed cell line derived from chick pinealocytes (E10) following exposure to MH2 chicken retrovirus, have been described elsewhere (22Sheshbaradaran H. Takahashi J.S. Mol. Cell Neurosci. 1994; 5: 309-318Crossref PubMed Scopus (25) Google Scholar). CP3 cells, grown in suspension culture, were freshly dispersed on poly-l-ornithine-treated plates (106cells/15-cm plate) and treated with calcium phosphate-precipitatedStuI-linearized plasmid (25Graham F.L. van der EB A.J. Virology. 1973; 52: 456-467Crossref PubMed Scopus (6485) Google Scholar). Stable lines were selected in media containing G418 (120 μg/ml). After 3 weeks, floating clonal clumps of CP3 cells were propagated separately. Fifty lines were grown, and of these, 20 were tested for P-opsin protein expression by RNase protection assay (1Max M. McKinnon P.J. Seidenman K.J. Barrett R.K. Applebury M.L. Takahashi J.S. Margolskee R.F. Science. 1995; 267: 1502-1506Crossref PubMed Scopus (146) Google Scholar), immunofluorescence and/or Western blotting using the 1D4 antibody (23Mackenzie D. Arendt A. Hargrave P. McDowell J. Molday R. Biochem. 1984; 23: 6544-6549Crossref PubMed Scopus (179) Google Scholar). P-opsin-positive CP3 cells were grown in flasks in Dulbecco's modified Eagle's medium/F-12 medium and 10% fetal bovine serum containing G418 (60 μg/ml), 0.4 mm retinal acetate and penicillin-streptomycin. Half of the growth media and cells were harvested every other day and replaced by fresh media. Cells were recovered by centrifugation, washed once with 1× buffer Y1 (1× = 50 mm HEPES, pH 6.6, 140 mm NaCl, 3 mm MgCl2), resuspended in a small volume of 1× buffer Y1. All subsequent procedures were carried out at 0–4 °C. Cells were pooled to obtain ∼6 × 108 cells, centrifuged at 40,000 × g for 1 h and resuspended in 20 ml of 0.1× buffer Y1 containing 50 μg/ml each of aprotinin, leupeptin, pepstatin, and phenylmethylsulfonyl fluoride. The cell slurry was disrupted by passage through progressively narrower syringe needles and centrifuged at 1500 × g for 30 min to pellet nuclei. Membranes were recovered from the supernatant by centrifugation at 40,000 ×g for 1 h. The membrane pellet was resuspended in 9 ml of 1× buffer Y2 (= buffer Y1 containing 20% (v/v) glycerol and supplemented with 50 μg/ml each of aprotinin, leupeptin, pepstatin, and phenylmethylsulfonyl fluoride). All subsequent steps were performed under dim red light (Kodak no. 2) at 4 °C. Membranes and 11-cis-retinal (final concentration, 5 μm) were incubated overnight, solubilized by the addition of 10% (w/v) dodecyl maltoside (DM) to a final concentration of 1% DM, and incubated for 2 h. Insoluble material was removed by centrifugation at 40,000 × g for 1 h. The P-opsin protein was purified on 1D4-Sepharose by immunoaffinity chromatography (26Oprian D. Molday R. Kaufman R. Khorana H.G. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 8874-8878Crossref PubMed Scopus (385) Google Scholar, 27Starace D. Knox B.E. J. Biol. Chem. 1997; 272: 1095-1100Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar). Rhodopsin from bovine retina was purified in parallel with P-opsin. Lipid was added to the samples from a sonicated stock of egg phosphatidylcholine (PC, Sigma) to a final concentration of 0.2% egg PC (w/v) and 0.2% DM (w/v) in 1× buffer Y2. Following incubation in dark on ice for at least 1 h, the P-opsin lipid-detergent mixture was diluted for subsequent experiments. UV-visible absorption spectra of pigments were performed at 20 °C in buffer Y2 containing 0.1% DM. Spectra were recorded with a Beckman DU 640 single beam spectrophotometer equipped with a water-jacketed cuvette holder. The pigment concentrations were determined spectroscopically from the absorbance maxima, using the extinction coefficient of rhodopsin. Pigment was treated in the dark with 50 mm hydroxylamine (pH 6.7), and absorbance was monitored at various times following addition. The half time for the reaction was determined by fitting the absorbance at 462 nm versus time to a single exponential decay function (SigmaPlot software). Bovine transducin purification and [35S]GTPγS exchange assays have been described elsewhere (28Bubis J. Khorana H.G. J. Biol. Chem. 1990; 265: 12995-12999Abstract Full Text PDF PubMed Google Scholar, 29Surya A. Foster K.W. Knox B.E. J. Biol. Chem. 1995; 270: 5024-5031Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar). Purified transducin bound 0.9–1.0 mol of [35S]GTPγS/mol of protein in the presence of excess, light-activated rhodopsin. The concentration of active transducin in each assay was determined independently by the amount of [35S]GTPγS bound in response to an excess of light-activated rhodopsin. Reactions were carried out at 22 °C in 0.01% DM, 10 mm Tris acetate (pH 7.0), 100 mmNaCl, 5 mm MgCl2, 5 mm2-mercaptoethanol, 2 μm [35S]GTPγS (1400–4000 cpm/pmol) with transducin and initiated by exposing the samples to light from a 300-watt projector (Eastman Kodak) at a distance of 50–60 cm using a high-pass colored glass cut-off filter (>515 nm, Edmund Scientific Inc., Barrington, NJ). All data were corrected for [35S]GTPγS binding to transducin in the absence of pigment (typically 5–8% of the maximum). The lifetime of the active species was determined by illuminating (λmax> 515) a solution of P-opsin or rhodopsin (in buffers as indicated in the figure legends) at 22 °C. At the times indicated, an aliquot of the pigment solution was added to reaction buffer containing transducin and [35S]GTPγS and the reaction proceeded for 1 h before filtering through nitrocellulose. Data were fit using SigmaPlot (Jandel). The small size of the chicken pineal gland prohibits ready purification of P-opsin or other phototransduction components for functional assays. Therefore, P-opsin was expressed in transfected cells. To enable purification (26Oprian D. Molday R. Kaufman R. Khorana H.G. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 8874-8878Crossref PubMed Scopus (385) Google Scholar) of the expressed protein, an 8-amino acid epitope derived from bovine rhodopsin (amino acids 341–348) was added to the carboxyl terminus of P-opsin. This minor carboxyl addition is not expected to significantly change the properties of P-opsin based on results from proteolytic cleavage of bovine rhodopsin or spectral characterization and transducin activation by similarly tagged pigments (27Starace D. Knox B.E. J. Biol. Chem. 1997; 272: 1095-1100Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar, 30Kuhn H. Hargrave P. Biochem. 1981; 20: 2410-2417Crossref PubMed Scopus (96) Google Scholar, 31Oprian D.D. Asenjo A.B. Lee N. Pelletier S.L. Biochemistry. 1991; 30: 11367-11372Crossref PubMed Scopus (143) Google Scholar, 32Yokoyama R. Knox B.E. Yokoyama S. Invest. Ophthalmol. Vis. Sci. 1995; 36: 939-945PubMed Google Scholar, 33Batni S. Scalzetti L. Moody S.A. Knox B.E. J. Biol. Chem. 1996; 271: 3179-3186Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). All experiments reported below were performed with the epitope-tagged P-opsin. Previous workers have used a monkey kidney cell line (COS1; Refs. 31Oprian D.D. Asenjo A.B. Lee N. Pelletier S.L. Biochemistry. 1991; 30: 11367-11372Crossref PubMed Scopus (143) Google Scholarand 34Khorana H.G. J. Biol. Chem. 1992; 267: 1-4Abstract Full Text PDF PubMed Google Scholar) or a human embryonic kidney cell line (HEK293; Ref. 35Nathans J. Merbs S.L. Sung C.H. Weitz C.J. Wang Y. Annu. Rev. Genet. 1992; 26: 403-424Crossref PubMed Scopus (86) Google Scholar) to express functional visual proteins. Western blot analysis showed levels of P-opsin protein expressed in COS1 cells comparable to protein levels obtained for bovine rhodopsin (∼4 μg/107 COS1 cells; data not shown). However, there was barely detectable pigment formed upon incubation of cells with 11-cis-retinal (6 ng of pigment/107 COS1 cells or ∼0.15% pigment formation). This extremely low level of P-opsin pigment formation was similar to that observed previously using HEK293 cells (21Okano T. Yoshizawa T. Fukada Y. Nature. 1994; 270: 94-97Crossref Scopus (277) Google Scholar). A chicken embryonic pineal cell line (CP3; Ref. 22Sheshbaradaran H. Takahashi J.S. Mol. Cell Neurosci. 1994; 5: 309-318Crossref PubMed Scopus (25) Google Scholar), which does not express P-opsin (Fig. 1), was chosen as an alternative expression system. CP3 cells were transfected with a plasmid encoding P-opsin under the control of the Rous sarcome virus promoter. Individual G418-resistant clones varied by more than 10-fold in the level of mRNA for P-opsin (Fig. 1 A), reaching levels comparable to that in pineal gland in lines 4 and 9. Line 9 had the strongest immunofluorescence signal (Fig. 1 B) and thus was chosen to produce the P-opsin for in vitroexperiments. Immunostaining of epitope-tagged P-opsin was most prominent around the cell periphery, indicating that P-opsin was targeted to the cell membrane (Fig. 1 B). The parental cell line did not show any reactivity to the 1D4 antibody. CP3 cell-expressed P-opsin was only found in the membrane fraction (data not shown), and Western blots of the membranes showed two broad bands with apparent molecular masses of ∼40 and ∼43 kDa (Fig. 1 C). The presence of two labeled bands suggests that P-opsin is heterogeneously glycosylated. This was confirmed by treatment with peptide N-glycosidase F, which transformed both original bands to the same higher mobility band (data not shown). From the deduced amino acid sequence, there are two potential N-linked glycosylation sites (1Max M. McKinnon P.J. Seidenman K.J. Barrett R.K. Applebury M.L. Takahashi J.S. Margolskee R.F. Science. 1995; 267: 1502-1506Crossref PubMed Scopus (146) Google Scholar). The sizes of the bands in P-opsin expressing CP3 membranes suggest that both sites are utilized. To determine if P-opsin can form a photopigment, membranes were incubated with 11-cis-retinal in the dark. The purified P-opsin exhibited a peak absorption at 462 ± 2 nm (Fig. 2 A) with a profile similar in shape to that of rhodopsin (Fig. 2 A, inset), with some distortion in the blue region, due to protein absorption (280 nm). An important property of 11-cis-retinal (A1)-based pigments is an increase in bandwidth with decreasing λmax (36Ebrey T.G. Honig B. Vision Res. 1977; 17: 147-151Crossref PubMed Scopus (153) Google Scholar). Using the long wavelength side of the P-opsin peak to estimate bandwidth, we found a half-bandwidth of 4590 cm−1 for P-opsin and 4230 cm−1 for rhodopsin (λmax = 500 nm). The observed value for the P-opsin pigment agrees with the value (4600 cm−1) predicted from the visual pigment nomogram (36Ebrey T.G. Honig B. Vision Res. 1977; 17: 147-151Crossref PubMed Scopus (153) Google Scholar). A dark-light difference spectrum in the presence of hydroxylamine (Fig. 2 B) shows that the 462 nm absorbance disappears with a corresponding increase in absorbance at 363 nm, consistent with the formation of retinaloxime. Purified P-opsin, regenerated with 11-cis-retinal, was denatured in the dark at pH 1.8. This treatment stably traps protonated Schiff base linkages (440 nm) and otherwise eliminates interactions of retinal with the apoprotein (37Kito Y. Suzuki T. Azuma M. Sekoguti Y. Nature. 1968; 218: 955-957Crossref PubMed Scopus (60) Google Scholar). Acid-trapped P-opsin exhibited a shift in peak absorbance from 462 nm to 440 nm, with a slight increase in bandwidth (Fig. 2 C), consistent with results from rhodopsin (37Kito Y. Suzuki T. Azuma M. Sekoguti Y. Nature. 1968; 218: 955-957Crossref PubMed Scopus (60) Google Scholar). The ratio of the acidic to the control peak heights indicates that the extinction coefficient for P-opsin is similar to that of rhodopsin (∼40,000m−1 cm−1), although a more precise estimate of the extinction coefficient was not possible due to the significant increase in absorbance at short wavelengths following acid denaturation. The absorption spectrum of P-opsin had a higher than expected ratio of 280 nm to 462 nm peaks (∼5), when compared with rhodopsin (280/500 nm ratio of ∼1.6; Ref. 38Ridge K.D. Lu A. Liu X. Khorana H.G. Biochem. 1995; 34: 3261-3267Crossref PubMed Scopus (70) Google Scholar) due to proteins in the preparation that do not absorb at 462 nm: either misfolded P-opsin or other co-purifying proteins. A silver-stained gel of purified P-opsin showed two prominent P-opsin bands (Fig. 3 B, bands 2 and 3) that were reactive with the 1D4 antibody in a corresponding Western blot (Fig. 3 A). One distinct band and several minor ones appeared in the silver-stained gel that did not label with 1D4 (Fig. 3 B). The unlabeled protein(s) did not appear in 1D4-Sepharose immunopurified material from parental CP3 cell membranes (data not shown); thus, the presence of non-P-opsin proteins in the immunopurified preparation results from an interaction with P-opsin. The high ratio of A 280/A 462 is primarily due to the presence of non-opsin protein. However, there may also be a small amount of misfolded or non-functional P-opsin in the preparation. In darkness cone pigments bleach rapidly in the presence of hydroxylamine, but typical rhodopsins are stable (39Yoshizawa T. Biophys. Chem. 1994; 50: 17-24Crossref PubMed Scopus (25) Google Scholar, 40Starace D. Knox B.E. Exp. Eye Res. 1998; 67: 209-220Crossref PubMed Scopus (52) Google Scholar, 41Kawamura S. Yokoyama S. Vis. Res. 1998; 38: 37-44Crossref PubMed Scopus (104) Google Scholar, 42Kawamura S. Yokoyama S. Vis. Res. 1997; 37: 1867-1871Crossref PubMed Scopus (70) Google Scholar, 43Hisatomi O. Ishikawa M. Tonosaki A. Tokunaga F. Photochem Photobiol. 1997; 66: 792-795Crossref PubMed Scopus (12) Google Scholar). Bleaching of the pigment in the presence of hydroxylamine in darkness indicates that the chromophore is accessible to the aqueous environment. We added hydroxylamine to purified P-opsin pigment in the dark and observed the effect on the absorption spectrum over time (Fig. 4). P-opsin bleached in the presence of hydroxylamine. However, the reaction occurred slowly, with a half time of decay of approximately 2 h; absorbance at 462 nm persisted even after 5 h. Visual pigments interact in a light-dependent fashion with transducins and stimulate the exchange of bound guanyl nucleotide. Sequence homology with visual opsins suggests that P-opsin may interact with a transducin. In fact, transducin immunoreactivity has been observed in chicken pineal (18Van Veen T. Ostholm T. Gierschik P. Spiegel A. Somers R. Korf H.W. Klein D.D. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 912-916Crossref PubMed Scopus (81) Google Scholar) and rod, but not cone, transducin α subunit mRNA has been detected in chicken pineal gland.2 These results and others (44Okano T. Takanaka Y. Nakamura A. Hirunagi K. Adachi A. Ebihara S. Fukada Y. Brain Res. Mol. Brain Res. 1997; 50: 190-196Crossref PubMed Scopus (57) Google Scholar) suggest that P-opsin and rod transducin proteins are present in the same cells (pinealocytes) and may provide a phototransduction pathway. We investigated the interaction of P-opsin with exogenously added bovine transducin, since bovine and chick α transducins are nearly identical (45Okano T. Yamazaki K. Kasahara T. Fukada Y. J Mol. Evol. 1997; 44: 91-97Crossref PubMed Google Scholar) and bovine transducin is readily available. Nucleotide exchange assays were performed using purified components under conditions that produce high activity of similarly prepared bovine rhodopsin (46Franke R. Sakmar T. Graham R. Khorana H.G. J. Biol. Chem. 1992; 267: 14767-14774Abstract Full Text PDF PubMed Google Scholar) and violet cone opsin (27Starace D. Knox B.E. J. Biol. Chem. 1997; 272: 1095-1100Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar). Transducin activation by P-opsin was strictly light-dependent (i.e. in the dark, nucleotide exchange was the same as transducin alone), and addition of phospholipid did not alter the rate of transducin activation (Fig. 5 A). Under these conditions, the reaction was complete by 10 min and was not limited by the available transducin (Fig. 5 A; see below). Varying concentrations of purified P-opsin were exposed to light and nucleotide exchange reactions were allowed to go to completion. The total number of activated transducins increased with increasing P-opsin concentration, eventually reaching saturation (Fig. 5 B, closed symbols). Approximately 50% of the transducin that could be activated by excess rhodopsin was activated by P-opsin, indicating that the cessation of activity was not caused by depletion of unactivated transducin. Moreover, the concentration of P-opsin required to produce 50% of the maximum turnovers was similar for both transducin concentrations (6 nm P-opsin for 3 μm transducin compared with 3 nm P-opsin for 1 μm transducin), and substantially below the concentration of transducin throughout the reaction. At concentrations below 1 μm transducin, the fraction of transducin activated dropped significantly (Fig. 5 B). Thus, it appears that P-opsin exhibits an interaction-dependent inactivation; in contrast, bovine rhodopsin is able to activate >95% of the available transducin. In the linear portion of the P-opsin concentration range, P-opsin catalyzed the exchange of GTPγS on a large number of transducin molecules (162 GTPγS bound/P-opsin and 80 GTPγS bound/P-opsin at 3 μm and 1 μmtransducin respectively). Exogenously added lipid did not have a significant effect on the total number of transducins activated (Fig. 5 B, open symbols). The initial rates of GTPγS exchange at different transducin concentrations were measured using light-activated P-opsin and bovine rhodopsin. Comparing the slopes of the linear portions of the curves (Fig. 6), the initial rate of nucleotide exchange catalyzed by rhodopsin was 2–3 times faster than that achieved with P-opsin. These results indicate that the efficiency of P-opsin interaction with rod transducin (the binding affinity, catalytic turnover rate, or both) is lower than that of rhodopsin. The addition of phospholipid decreased the initial rate of activation by 1.5–2-fold. In contrast, rhodopsin exhibited a significant, 4-fold increase in activity in the presence of lipid. Compared with P-opsin in lipid micelles, rhodopsin had a 15–20-fold faster initial rate. Visual pigments respond to light by going through a series of photo-intermediates leading to a metastable state (metarhodopsin II) that stimulates transducin (47Hargrave P.A. McDowell J.H. FASEB J. 1992; 6: 2323-2331Crossref PubMed Scopus (233) Google Scholar). The metarhodopsin II state decays to the apoprotein plus all-trans-retinal, and the time course of the decay plays an important role in phototransduction. To determine the stability of its active state, P-opsin was exposed to light for various times prior to addition to the nucleotide exchange reaction. At low detergent concentrations (0.01%), P-opsin exhibited a slow decay in active conformation, with a half-time of about 60 min (Fig. 7). Under the same conditions, rhodopsin had a slightly faster decay, with a half-time of about 30 min. Surprisingly, P-opsin did not decay at higher detergent concentrations. When phospholipid was added, P-opsin's decay was dramatically accelerated, with a half-time of about 4 min. The increase in decay of metarhodopsin II in phospholipid compared with detergent has been previously described (reviewed in Ref. 48Brown M.F. Chem. Phys. Lipids. 1994; 73: 159-180Crossref PubMed Scopus (370) Google Scholar). Thus, P-opsin produces a meta-stable active state when exposed to light, with properties that parallel metarhodopsin II. In comparison to other opsins, P-opsin remains active 5 times longer than violet cone opsin (27Starace D. Knox B.E. J. Biol. Chem. 1997; 272: 1095-1100Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar) and its active state decays more slowly than that of green cone opsin (as estimated by spectroscopic measurements; Refs. 49Imai H. Imamoto Y. Yoshizawa T. Shichida Y. Biochemistry. 1995; 34: 10525-10531Crossref PubMed Scopus (58) Google Scholar and 50Shichida Y. Imai H. Imamoto Y. Fukada Y. Yoshizawa T. Biochemistry. 1994; 33: 9040-9044Crossref PubMed Scopus (72) Google Scholar). We have investigated several properties of P-opsin and made comparisons to the visual pigments. First, CP3-expressed P-opsin bound 11-cis-retinal with a maximum absorbance at 462 nm, in good agreement with the dark-light difference spectrum (λmax∼470 nm) obtained from a membrane preparation of P-opsin-expressing HEK 293 cells (21Okano T. Yoshizawa T. Fukada Y. Nature. 1994; 270: 94-97Crossref Scopus (277) Goog" @default.
• W2049291236 created "2016-06-24" @default.
• W2049291236 creator A5015319838 @default.
• W2049291236 creator A5041726520 @default.
• W2049291236 creator A5053465320 @default.
• W2049291236 creator A5074907447 @default.
• W2049291236 creator A5076767575 @default.
• W2049291236 date "1998-10-01" @default.
• W2049291236 modified "2023-10-16" @default.
• W2049291236 title "Light-dependent Activation of Rod Transducin by Pineal Opsin" @default.
• W2049291236 cites W1528051864 @default.
• W2049291236 cites W1551126510 @default.
• W2049291236 cites W1579091371 @default.
• W2049291236 cites W1584596151 @default.
• W2049291236 cites W1590595627 @default.
• W2049291236 cites W1594236032 @default.
• W2049291236 cites W1597490842 @default.
• W2049291236 cites W1621683903 @default.
• W2049291236 cites W1630586322 @default.
• W2049291236 cites W1890185838 @default.
• W2049291236 cites W1958832876 @default.
• W2049291236 cites W1965372133 @default.
• W2049291236 cites W1967425877 @default.
• W2049291236 cites W1968520624 @default.
• W2049291236 cites W1968734149 @default.
• W2049291236 cites W1971524741 @default.
• W2049291236 cites W1973803699 @default.
• W2049291236 cites W1974799596 @default.
• W2049291236 cites W1977014763 @default.
• W2049291236 cites W1977184155 @default.
• W2049291236 cites W1978618066 @default.
• W2049291236 cites W1981783745 @default.
• W2049291236 cites W1983352378 @default.
• W2049291236 cites W1986482978 @default.
• W2049291236 cites W1986531420 @default.
• W2049291236 cites W1987654762 @default.
• W2049291236 cites W1989876250 @default.
• W2049291236 cites W1998865435 @default.
• W2049291236 cites W2005931793 @default.
• W2049291236 cites W2006393374 @default.
• W2049291236 cites W2006434271 @default.
• W2049291236 cites W2006729726 @default.
• W2049291236 cites W2007897296 @default.
• W2049291236 cites W2009082256 @default.
• W2049291236 cites W2009415098 @default.
• W2049291236 cites W2009493198 @default.
• W2049291236 cites W2016290238 @default.
• W2049291236 cites W2018116236 @default.
• W2049291236 cites W2027222274 @default.
• W2049291236 cites W2051352459 @default.
• W2049291236 cites W2054939760 @default.
• W2049291236 cites W2059441263 @default.
• W2049291236 cites W2060991227 @default.
• W2049291236 cites W2064215179 @default.
• W2049291236 cites W2066022164 @default.
• W2049291236 cites W2068077032 @default.
• W2049291236 cites W2068137624 @default.
• W2049291236 cites W2070192355 @default.
• W2049291236 cites W2070429490 @default.
• W2049291236 cites W2070796106 @default.
• W2049291236 cites W2071250685 @default.
• W2049291236 cites W2071915650 @default.
• W2049291236 cites W2072450788 @default.
• W2049291236 cites W2072550433 @default.
• W2049291236 cites W2077319609 @default.
• W2049291236 cites W2077628548 @default.
• W2049291236 cites W2087686093 @default.
• W2049291236 cites W2090761082 @default.
• W2049291236 cites W2091673574 @default.
• W2049291236 cites W2092747196 @default.
• W2049291236 cites W2112405802 @default.
• W2049291236 cites W2113183595 @default.
• W2049291236 cites W2116486508 @default.
• W2049291236 cites W2168365422 @default.
• W2049291236 cites W2177856107 @default.
• W2049291236 cites W4252462144 @default.
• W2049291236 doi "https://doi.org/10.1074/jbc.273.41.26820" @default.
• W2049291236 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9756926" @default.
• W2049291236 hasPublicationYear "1998" @default.
• W2049291236 type Work @default.
• W2049291236 sameAs 2049291236 @default.
• W2049291236 citedByCount "24" @default.
• W2049291236 countsByYear W20492912362012 @default.
• W2049291236 countsByYear W20492912362014 @default.
• W2049291236 countsByYear W20492912362015 @default.
• W2049291236 countsByYear W20492912362019 @default.
• W2049291236 crossrefType "journal-article" @default.
• W2049291236 hasAuthorship W2049291236A5015319838 @default.
• W2049291236 hasAuthorship W2049291236A5041726520 @default.
• W2049291236 hasAuthorship W2049291236A5053465320 @default.
• W2049291236 hasAuthorship W2049291236A5074907447 @default.
• W2049291236 hasAuthorship W2049291236A5076767575 @default.
• W2049291236 hasBestOaLocation W20492912361 @default.
• W2049291236 hasConcept C12554922 @default.
• W2049291236 hasConcept C149574991 @default.
• W2049291236 hasConcept C169760540 @default.
• W2049291236 hasConcept C185592680 @default.
• W2049291236 hasConcept C202033177 @default.

• next