FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2049444895> ?p ?o ?g. }

• W2049444895 endingPage "23928" @default.
• W2049444895 startingPage "23922" @default.
• W2049444895 abstract "“Classical” nitroreductase of Salmonella typhimurium is a flavoprotein that catalyzes the reduction of nitroaromatics to metabolites that are toxic, mutagenic, or carcinogenic. This enzyme represents a new class of flavin-dependent enzymes, which includes nitroreductases of Enterobacter cloacae and Escherichia coli,flavin oxidoreductase of Vibrio fischeri, and NADH oxidase of Thermus thermophilus. To investigate the structure-function relation of this class of enzymes, the gene encoding a mutant nitroreductase was cloned from S. typhimuriumstrain TA1538NR, and the enzymatic properties were compared with those of the wild-type. DNA sequence analysis revealed a T to G mutation in the mutant nitroreductase gene, predicting a replacement of leucine 33 with arginine. In contrast to the wild-type enzyme, the purified protein with a mutation of leucine 33 to arginine has no detectable nitroreductase activities in the standard assay conditions and easily lost FMN by dialysis or ultrafiltration. In the presence of an excess amount of FMN, however, the mutant protein exhibited a weak but measurable enzyme activity, and the substrate specificity was similar to that of the wild-type enzyme. Possible mechanisms by which the mutation greatly diminishes binding of FMN to the nitroreductase are discussed. “Classical” nitroreductase of Salmonella typhimurium is a flavoprotein that catalyzes the reduction of nitroaromatics to metabolites that are toxic, mutagenic, or carcinogenic. This enzyme represents a new class of flavin-dependent enzymes, which includes nitroreductases of Enterobacter cloacae and Escherichia coli,flavin oxidoreductase of Vibrio fischeri, and NADH oxidase of Thermus thermophilus. To investigate the structure-function relation of this class of enzymes, the gene encoding a mutant nitroreductase was cloned from S. typhimuriumstrain TA1538NR, and the enzymatic properties were compared with those of the wild-type. DNA sequence analysis revealed a T to G mutation in the mutant nitroreductase gene, predicting a replacement of leucine 33 with arginine. In contrast to the wild-type enzyme, the purified protein with a mutation of leucine 33 to arginine has no detectable nitroreductase activities in the standard assay conditions and easily lost FMN by dialysis or ultrafiltration. In the presence of an excess amount of FMN, however, the mutant protein exhibited a weak but measurable enzyme activity, and the substrate specificity was similar to that of the wild-type enzyme. Possible mechanisms by which the mutation greatly diminishes binding of FMN to the nitroreductase are discussed. Nitroreduction is an initial step in the metabolism of a variety of structurally diverse nitroaromatic compounds, including nitrofurans, nitropyrenes, and nitrobenzenes (1McCalla D.R. Kaiser C. Green M.H. J. Bacteriol. 1978; 133: 10-16Crossref PubMed Google Scholar, 2McCoy E.C. Rosenkranz H.S. Mermelstein R. Environ. Mutagen. 1981; 3: 421-427Crossref PubMed Scopus (172) Google Scholar, 3Thornton M.J. Smith B.A. Beland F.A. Heflich R.H. Carcinogenesis. 1991; 12: 2317-2323Crossref PubMed Scopus (17) Google Scholar, 4Einisto P. Watanabe M. Ishidate Jr., M. Nohmi T. Mutat. Res. 1991; 259: 95-102Crossref PubMed Scopus (214) Google Scholar, 5Anlezark G.M. Melton R.G. Sherwood R.F. Wilson W.R. Denny W.A. Palmer B.D. Knox R.J. Friedlos F. Williams A. Biochem. Pharmacol. 1995; 50: 609-618Crossref PubMed Scopus (88) Google Scholar). Enzymes that catalyze this process are termed nitroreductases and are classified into two groups: oxygen-sensitive and oxygen-insensitive (6Peterson F.J. Mason R.P. Hovsepian J. Holtzman J.L. J. Biol. Chem. 1979; 254: 4009-4014Abstract Full Text PDF PubMed Google Scholar). The former enzymes, such as NADPH-cytochrome P-450 oxidoreductase (EC 1.6.2.4) and NADPH-b 5 oxidoreductase (EC 1.6.2.2), catalyze the one-electron reduction of nitro moiety in which case the anion free radicals are formed (7Morrison H. Jernstrom B. Nordenskjold M. Thor H. Orrenius S. Biochem. Pharmacol. 1984; 33: 1763-1769Crossref PubMed Scopus (111) Google Scholar, 8Di M.D. Bellomo G. Thor H. Nicotera P. Orrenius S. Arch. Biochem. Biophys. 1984; 235: 343-350Crossref PubMed Scopus (329) Google Scholar, 9Di M.D. Ross D. Bellomo G. Eklow L. Orrenius S. Arch. Biochem. Biophys. 1984; 235: 334-342Crossref PubMed Scopus (390) Google Scholar). These enzymes are termed oxygen-sensitive, because the resulting radicals are easily reoxidized to the parent compounds by O2 in a futile redox cycle, which generates superoxide. Thus, these enzymes can mediate the reduction of nitroaromatics only under anaerobic conditions (3Thornton M.J. Smith B.A. Beland F.A. Heflich R.H. Carcinogenesis. 1991; 12: 2317-2323Crossref PubMed Scopus (17) Google Scholar). The latter enzymes, such as NAD(P)H-quinone oxidoreductase (formerly called DT-diaphorase, EC 1.6.99.2) and nitroreductases of enteric bacteria, catalyze the two-electron reduction of the nitro moiety through nitroso and hydroxylamine intermediates to the fully reduced amino compounds (10Brunmark A. Cadenas E. Segura A.J. Lind C. Ernster L. Free Radic. Biol. Med. 1988; 5: 133-143Crossref PubMed Scopus (38) Google Scholar,11Bryant C. DeLuca M. J. Biol. Chem. 1991; 266: 4119-4125Abstract Full Text PDF PubMed Google Scholar). Although this process does not produce superoxide, some of the hydroxylamine intermediates are mutagenic and carcinogenic (12Nohmi T. Yoshikawa K. Nakadate M. Miyata R. Ishidate M. Mutat. Res. 1984; 136: 159-168Crossref PubMed Scopus (25) Google Scholar,13Watanabe M. Sofuni T. Nohmi T. J. Biol. Chem. 1992; 267: 8429-8436Abstract Full Text PDF PubMed Google Scholar). In the strains of Salmonella typhimurium used in the Ames mutagenicity test, a “classical” nitroreductase plays an important role in the reductive metabolic activation process (2McCoy E.C. Rosenkranz H.S. Mermelstein R. Environ. Mutagen. 1981; 3: 421-427Crossref PubMed Scopus (172) Google Scholar). In fact,S. typhimurium TA98NR, a nitroreductase-deficient strain, is resistant to both the killing and mutagenic effects of nitroarenes, whereas S. typhimurium YG1021, a nitroreductase-overproducing strain, is extremely sensitive to the effects (14Rosenkranz H.S. Mermelstein R. Mutat. Res. 1983; 114: 217-267Crossref PubMed Scopus (680) Google Scholar, 15Watanabe M. Ishidate M.J. Nohmi T. Mutat. Res. 1989; 216: 211-220Crossref PubMed Scopus (164) Google Scholar). The latter strain was constructed in this laboratory by introducing a multicopy number plasmid carrying the gene encoding the nitroreductase of S. typhimurium into an Ames tester strain TA98 (16Maron D.M. Ames B.N. Mutat. Res. 1983; 113: 173-215Crossref PubMed Scopus (7169) Google Scholar). The enzyme is termed classical because other nitroreductases were identified in S. typhimurium later (17McCoy E.C. Anders M. Rosenkranz H.S. Mutat. Res. 1983; 121: 17-23Crossref PubMed Scopus (219) Google Scholar). The NfsB protein of Escherichia coli, which is about 90% homologous to the nitroreductase of S. typhimurium, has been used in antibody-directed enzyme prodrug cancer therapy, because it can activate a nitroaromatic monofunctional prodrug CB1954 (18Michael N.P. Brehm J.K. Anlezark G.M. Minton N.P. FEMS Microbiol. Lett. 1994; 124: 195-202Crossref PubMed Scopus (57) Google Scholar, 19Knox R.J. Connors T.A. Clin. Immunother. 1995; 3: 136-153Crossref Scopus (17) Google Scholar, 20Zenno S. Koike H. Tanokura M. Saigo K. J. Biochem. (Tokyo). 1996; 120: 736-744Crossref PubMed Scopus (128) Google Scholar). In 1990, we identified the nucleotide sequence of the gene encoding the nitroreductase of S. typhimurium and estimated that the enzyme is composed of 217 amino acids with a calculatedM r of 23,955 (21Watanabe M. Ishidate M. Nohmi T. Nucleic Acids Res. 1990; 18: 1059Crossref PubMed Scopus (47) Google Scholar). Since then, several enzymes have been reported to share similarities with the deduced amino acid sequence of the nitroreductase of S. typhimurium. Such enzymes include the oxygen-insensitive, flavin-dependent nitroreductases of Enterobacter cloacae (22Bryant C. Hubbard L. McElroy W.D. J. Biol. Chem. 1991; 266: 4126-4130Abstract Full Text PDF PubMed Google Scholar) and E. coli (18Michael N.P. Brehm J.K. Anlezark G.M. Minton N.P. FEMS Microbiol. Lett. 1994; 124: 195-202Crossref PubMed Scopus (57) Google Scholar, 20Zenno S. Koike H. Tanokura M. Saigo K. J. Biochem. (Tokyo). 1996; 120: 736-744Crossref PubMed Scopus (128) Google Scholar) and flavin reductases of Vibrio fischeri(23Zenno S. Saigo K. J. Bacteriol. 1994; 176: 3544-3551Crossref PubMed Google Scholar). In addition, significant levels of similarities to theSalmonella enzyme have been observed in NADH oxidase of Thermus thermophilus (24Park H.J. Kreutzer R. Reiser C.O. Sprinzl M. Eur. J. Biochem. 1993; 211: 909PubMed Google Scholar), DrgA of Synechocystissp. (GenBankTM accession numbers L29426 and D90910) (25Kaneko T. Sato S. Kotani H. Tanaka A. Asamizu E. Nakamura Y. Miyajima N. Hirosawa M. Sugiura M. Sasamoto S. Kimura T. Hosouchi T. Matsuno A. Muraki A. Nakazaki N. Naruo K. Okumura S. Shimpo S. Takeuchi C. Wada T. Watanabe A. Yamada M. Yasuda M. Tabata S. DNA Res. 1996; 3: 109-136Crossref PubMed Scopus (2122) Google Scholar), a putative flavin reductase of Hemophilus influenzae (National Center for Biotechnology Information ID B64116) (26Fleischmann R.D. Adams M.D. White O. Clayton R.A. Kirkness E.F. Kerlavage A.R. Bult C.J. Tomb J.F. Dougherty B.A. Merrick J.M. McKenney K. Sutton G. FitzHugh W. Fields C. Gocayne J.D. Scott J. Shirley R. Liu L.-I. Glodek A. Kelley J.M. Weidman J.F. Phillips C.A. Spriggs T. Hedblom E. Cotton M.D. Utterback T.R. Hanna M.C. Nguyen D.T. Saudek D.M. Brandon R.C. Gnehm C.L. McDonald L.A. Small K.V. Fraser C.M. Smith H.O. Venter J.C. Science. 1995; 269: 496-512Crossref PubMed Scopus (4673) Google Scholar) and a putative nitroreductase of a Mycoplasma-like organism (GenBankTMaccession number L22217). The NADH oxidase of T. thermophilus reduces a number of nitro compounds and contains flavin as a cofactor (27Park H.J. Reiser C.O. Kondruweit S. Erdmann H. Schmid R.D. Sprinzl M. Eur. J. Biochem. 1992; 205: 881-885Crossref PubMed Scopus (111) Google Scholar). DrgA controls resistance to metronidazole, a nitroaromatic compound, in Cyanobacterium, suggesting that DrgA also participates in nitroreduction. These bacterial enzymes are functionally similar to mammalian NAD(P)H-quinone oxidoreductase, in that they are oxygen-insensitive and flavin-dependent enzymes (28Lind C. Cadenas E. Hochstein P. Ernster L. Methods Enzymol. 1990; 186: 287-301Crossref PubMed Scopus (287) Google Scholar). However, no sequence similarities are observed between the bacterial enzymes and NAD(P)H-quinone oxidoreductase (29Robertson J.A. Chen H.C. Nebert D.W. J. Biol. Chem. 1986; 261: 15794-15799Abstract Full Text PDF PubMed Google Scholar, 30Bayney R.M. Morton M.R. Favreau L.V. Pickett C.B. J. Biol. Chem. 1989; 264: 21793-21797Abstract Full Text PDF PubMed Google Scholar, 31Jaiswal A.K. McBride O.W. Adesnik M. Nebert D.W. J. Biol. Chem. 1988; 263: 13572-13578Abstract Full Text PDF PubMed Google Scholar). In addition, the bacterial enzymes tightly associate with FMN (11Bryant C. DeLuca M. J. Biol. Chem. 1991; 266: 4119-4125Abstract Full Text PDF PubMed Google Scholar, 20Zenno S. Koike H. Tanokura M. Saigo K. J. Biochem. (Tokyo). 1996; 120: 736-744Crossref PubMed Scopus (128) Google Scholar, 31Jaiswal A.K. McBride O.W. Adesnik M. Nebert D.W. J. Biol. Chem. 1988; 263: 13572-13578Abstract Full Text PDF PubMed Google Scholar,32Knox R.J. Friedlos F. Sherwood R.F. Melton R.G. Anlezark G.M. Biochem. Pharmacol. 1992; 44: 2297-2301Crossref PubMed Scopus (113) Google Scholar), whereas FAD is a prosthetic group in the mammalian enzyme (33Hosoda S. Nakamura W. Hayashi K. J. Biol. Chem. 1974; 249: 6416-6423Abstract Full Text PDF PubMed Google Scholar,34Rase B. Bartfai T. Ernster L. Arch. Biochem. Biophys. 1976; 172: 380-386Crossref PubMed Scopus (38) Google Scholar). Thus, it is suggested that the bacterial enzymes represented by the nitroreductase of S. typhimurium constitute a separate class of flavoproteins. To investigate structure-function relation of this class of enzymes, we cloned the gene encoding a mutant nitroreductase from S. typhimurium strain TA1538NR and compared the enzymatic properties between the mutant and wild-type nitroreductases. The parent strain of TA1538NR, i.e. S. typhimurium TA98NR, was isolated as a mutant resistant to the killing effects of nitrofuran (35Rosenkranz H.S. Speck W.T. Biochem. Biophys. Res. Commun. 1975; 66: 520-525Crossref PubMed Scopus (217) Google Scholar). The purified mutant nitroreductase showed a reduced affinity for flavin, suggesting that the replacement of leucine 33 with arginine, which was found in the mutant nitroreductase gene, causes destabilization of folding FMN in the enzyme. Based on the amino acid sequence similarities between the nitroreductase of S. typhimurium and NADH oxidase of T. thermophilus, we discuss the possible mechanisms by which the mutation reduces the affinity of the enzyme for FMN. NADH, NADPH, NADP+, glucose 6-phosphate, and glucose-6-phosphate dehydrogenase were obtained from Oriental Yeast (Tokyo, Japan). Nitrofurazone,p-nitrophenol, p-nitrobenzoic acid,p-nitroacetophenone, and menadione were obtained from Tokyo Kasei Kogyo (Tokyo, Japan). FMN and FAD were obtained from Boehringer Mannheim (Mannheim, Germany). Riboflavin was obtained from Wako Pure Chemical (Osaka, Japan). Restriction endonucleases and T4 DNA ligase were obtained from Nippon Gene (Toyama, Japan). Genomic DNA of S. typhimurium strain TA1538NR was isolated and digested completely with restriction endonucleases EcoRI and PstI. A 5.65-kilobase pair DNA fragment was recovered from agarose gel and ligated into EcoRI- and PstI-digested plasmid pHSG399. E. coli XL1-Blue (Stratagene, La Jolla, CA) was transformed by the resulting plasmids. Plasmid DNAs were prepared from the transformants, and the restriction patterns were analyzed by digesting them with EcoRI plus PstI, followed by agarose gel electrophoresis. Plasmids having the identical restriction pattern with that of the wild-type nitroreductase gene (15Watanabe M. Ishidate M.J. Nohmi T. Mutat. Res. 1989; 216: 211-220Crossref PubMed Scopus (164) Google Scholar, 21Watanabe M. Ishidate M. Nohmi T. Nucleic Acids Res. 1990; 18: 1059Crossref PubMed Scopus (47) Google Scholar) were further selected by the digestion with EcoRV and the plasmid carrying the mutant nitroreductase gene was termed pYG143. DNA sequence of the cloned gene in pYG143 was determined by ALFred DNA sequencer using AutoRead sequencing kit (Amersham Pharmacia Biotech, Little Chalfont, Great Britain). Primers used for sequencing were 24-mer oligonucleotides corresponding to nucleotides 134–157 (AATGACTCATGGAATCTGGTCGTA) in the coding strand and 1027–1004 (TTCGCGCCATTGATCATTGAGGAA) in the complementary strand shown in the Fig. 1 of Ref. 21Watanabe M. Ishidate M. Nohmi T. Nucleic Acids Res. 1990; 18: 1059Crossref PubMed Scopus (47) Google Scholar. The coding region of nitroreductase is nucleotides 299–949. Cy5-dATP (Amersham Pharmacia Biotech) was used for internal labeling. Plasmid pYG220, a pBluescript-based plasmid carrying the wild-type nitroreductase gene, was used as a control. Direct DNA sequencing of the mutant nitroreductase gene of strain TA1538NR was also carried out using polymerase chain reaction techniques described previously (13Watanabe M. Sofuni T. Nohmi T. J. Biol. Chem. 1992; 267: 8429-8436Abstract Full Text PDF PubMed Google Scholar). In this case, strain TA1538, which carries the wild-type nitroreductase gene, was used as a control. The 24-mer oligonucleotides described above were used for amplifications. S. typhimurium strain YG1021 was grown in 16 liters of LB broth (1% Bacto-tryptone, 0.5% Bacto-yeast extract, and 1% NaCl) supplemented with 10 μg/ml tetracycline for 16 h at 37 °C with vigorous shaking. The cells (101 g) were washed with 50 mm Tris-HCl buffer, pH 7.5 (buffer A). All the following steps were performed on ice or at 4 °C. The washed cells were suspended in 3 volumes of buffer A containing 1 mmdithiothreitol (buffer B) and disrupted by sonication. The cytosol fraction was prepared, and streptomycin sulfate was added at a final concentration of 1% to precipitate nucleic acids. After centrifugation, nitroreductase was precipitated between 40 and 60% saturation of ammonium sulfate. The precipitate was dissolved in 60 ml of buffer B plus 1 μm FMN (buffer C), followed by dialysis against buffer C. The dialyzed sample was applied to a DE52 anion-exchange DEAE-cellulose (Whatman) column (5 × 15 cm) that was preequilibrated with buffer A. Nitroreductase was eluted with a 3,000-ml linear gradient of 50–300 mm NaCl in buffer C at a flow rate of 2.5 ml/min. Fractions were subjected for enzyme assays and the analysis by SDS-polyacrylamide gel electrophoresis. The activity was eluted with about 130 mm NaCl in buffer C. The active fractions (160.5 ml) were dialyzed against buffer C, and nitroreductase was precipitated by the addition of ammonium sulfate to 35% saturation (buffer C + 35%). Then hydrophobic interaction chromatography was performed using a phenyl-Sepharose CL-4B (Amersham Pharmacia Biotech) column (1.5 × 30 cm). After the column was washed with 30 ml of buffer C + 20% ammonium sulfate saturation solution, nitroreductase was eluted with a 500-ml linear gradient of 20 to 0% saturation of ammonium sulfate in buffer C at a flow rate of 0.4 ml/min. The nitroreductase activity was eluted in about 5% saturation of ammonium sulfate in buffer C. The active fractions (115 ml) were dialyzed against 10 mm sodium phosphate buffer, pH 6.8, and applied to a Bio-Gel HT hydroxyapatite (Bio-Rad) column (1 × 6 cm). The nitroreductase activity was recovered in the pass-through fractions. The fractions (170.5 ml) were concentrated using Centriprep 10 concentrators (Amicon, Beverly, MA) to 4 ml. After adjustments of the concentrate to 50 mm Tris-HCl, pH 7.5, and 50 mm NaCl, the sample was loaded onto a Sephadex G-100 (Amersham Pharmacia Biotech) column (2.5 × 100 cm). The elution buffer was buffer C containing 50 mm NaCl, and the flow rate was 0.25 ml/min. The active fractions (30 ml) were pooled and concentrated to 2 ml by Centriprep 10 concentrators. The final preparation was used as purified nitroreductase. Purified enzyme solution (1.5 μl) was desalted and diluted to 30 μl. The sample was loaded on to a glass fiber disc and was analyzed by Applied Biosystems 477 sequencer for the first 19 amino acids. Plasmid pYG143 was digested with NotI and SacII. A 1.0-kilobase pair DNA fragment, which contains the mutant nitroreductase gene, was isolated from agarose gel and inserted into the NotI- and SacII-digested pBluescript KS+ (Stratagene). The resulting plasmid was designated as pYG149 and was introduced into the nitroreductase-deficient strain S. typhimurium TA1538NR. LB broth (1 liter) supplemented with 50 μg/ml ampicillin was inoculated with the transformant and incubated for 16 h at 37 °C. Purification protocols were similar to those for the purification of the wild-type enzyme, but several modifications were made because of different chromatographic behavior of the mutant enzyme. After streptomycin sulfate precipitation, the mutant nitroreductase was precipitated between 33 and 45% saturation of ammonium sulfate. The mutant nitroreductase was eluted from a DEAE-cellulose column DE52 in about 80 mm NaCl solution, which was lower than that needed for elution of the wild-type enzyme. The mutant nitroreductase tightly bound to a phenyl-Sepharose CL-4B column and could not be eluted from the column without using organic solvent. Thus, this step was omitted. Contrary to the wild-type enzyme, the mutant enzyme bound to a hydroxyapatite column and was eluted with about 70 mmsodium phosphate buffer, pH 6.8. A fraction that eluted from a hydroxyapatite column showed a single band when analyzed by SDS-polyacrylamide gel electrophoresis followed by visualization with Coomassie Brilliant Blue. Thus, this fraction was used as a source of the purified mutant nitroreductase. Samples were separated by SDS-polyacrylamide gel electrophoresis and blotted on nitrocellulose sheets (BA83, Schleicher & Schuell, Dassel, Germany) by semidry electrophoretic transfer. The rabbit antiserum raised against the wild-type nitroreductase was prepared by Takara-shuzo Co. (Otsu, Japan). The nitroreductase antiserum and horseradish peroxidase-linked anti-rabbit antibody (Amersham Pharmacia Biotech) combined with diaminobenzidine-staining technique were used to visualize the wild-type and mutant nitroreductases (36Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Nitrofurazone reductase activity was determined by the method of McCalla et al. with modifications (37McCalla D.R. Reuvers R.A. Kaiser C. J. Bacteriol. 1970; 104: 1126-1134Crossref PubMed Google Scholar). Reaction was performed in 0.6 ml of buffer B (50 mm Tris-HCl buffer, pH 7.5, 1 mmdithiothreitol) containing 0.05 mm nitrofurazone, NADPH-generating system (6.7 mm glucose 6-phosphate, 0.04 mm NADP+, 0.8 unit of glucose-6-phosphate dehydrogenase), and an enzyme preparation. The reaction was carried out at 37 °C, and the initial reaction velocity was determined by monitoring the decrease in absorption at 375 nm of nitrofurazone. The extinction coefficient of 1.5 × 104m−1 cm−1 was used to calculate the amount of nitrofurazone reduced per min per mg of protein. Because the absorbance of NAD(P)H overlaps that of nitrofurazone at 375 nm, the NADPH-generating system was employed to maintain constant concentrations of NADPH. When a fixed concentration of NADH or NADPH was used, the decrease in absorption at 400 or 420 nm was monitored. Flavin-reductase activity was determined by the method described by Zenno et al. with modifications (38Zenno S. Saigo K. Kanoh H. Inouye S. J. Bacteriol. 1994; 176: 3536-3543Crossref PubMed Google Scholar). The reaction mixture (0.6 ml) consisted of enzyme preparation, flavin (FMN, FAD, or riboflavin, 0.1 mm), and electron donor (NADH or NADPH, 0.1 mm) in buffer B. Before the addition of NADH, the reaction mixture was preincubated at 23 °C for 5 min. Reaction was carried out at 23 °C, and the initial reaction rate was determined by measuring the decrease in absorption of NADH at 340 nm. All assays were performed in Shimadzu double beam spectrophotometer UV-200S (Shimadzu, Kyoto, Japan). Protein concentration was determined using a Bio-Rad Bradford protein assay kit. Bovine serum albumin (Boehringer Mannheim number 711454) was used as a standard. Apoenzyme of the wild-type nitroreductase was prepared using potassium bromide (39Massey V. Curti B. J. Biol. Chem. 1966; 241: 3417-3423Abstract Full Text PDF PubMed Google Scholar). Briefly, the purified enzyme preparation was combined with 3 volumes of buffer B containing 4 m potassium bromide. The solution was applied to Centricon 10 concentrators (Amicon). Once concentrated, the solution was diluted with buffer B containing 3 m potassium bromide. This concentration-dilution cycle was repeated several times, and the final preparation was used as the apoenzyme. Then, 1 nmol of the apoenzyme was combined with 2 or 100 nmol of FMN, FAD, or riboflavin in a final volume of 20 μl in buffer B and incubated overnight at 4 °C. Riboflavin was not completely dissolved when the final concentration was 5 mm. The incubated enzyme preparations were analyzed for their nitrofurazone-reductase activities. S. typhimurium TA98NR and its pKM101-removed derivative, i.e. TA1538NR, are deficient in nitroreductase and are insensitive to mutagenic and cytotoxic effects of nitroaromatic compounds (15Watanabe M. Ishidate M.J. Nohmi T. Mutat. Res. 1989; 216: 211-220Crossref PubMed Scopus (164) Google Scholar, 35Rosenkranz H.S. Speck W.T. Biochem. Biophys. Res. Commun. 1975; 66: 520-525Crossref PubMed Scopus (217) Google Scholar). To identify the mutation that inactivates the enzyme activity, the nitroreductase gene of the deficient TA1538NR strain was cloned, and the entire coding region plus the 5′-flanking region was sequenced. A base change mutation of T:A to G:C transversion at nucleotide 396 shown in the Fig. 1 of Ref. 21Watanabe M. Ishidate M. Nohmi T. Nucleic Acids Res. 1990; 18: 1059Crossref PubMed Scopus (47) Google Scholar, which leads to a replacement of leucine 33 with arginine, was identified (Fig. 1). Direct amplification and sequence analysis of the genomic DNA of TA1538NR also detected the same mutation. These results suggest that the base change mutation at the nitroreductase gene confers the phenotypes upon the strains TA1538NR and TA98NR. From 101 g of cell pellet, we obtained 24 mg of the purified wild-type nitroreductase. The NH2-terminal amino acid sequence of the purified protein was MDIVSVALQRYSTKAFDPS, which was exactly the same as that deduced from the nucleotide sequence of nitroreductase gene (21Watanabe M. Ishidate M. Nohmi T. Nucleic Acids Res. 1990; 18: 1059Crossref PubMed Scopus (47) Google Scholar). To purify the mutant protein without any contamination of the wild-type enzyme, the strain TA1538NR deficient in nitroreductase was used as a host strain for the overproduction of the mutant enzyme. The mutant protein showed different behavior from the wild-type enzyme during the protein purification: it bound tightly to phenyl-Sepharose CL-4B and hydroxyapatite columns. We have obtained 2.3 mg of the purified mutant protein (Table I). The final preparations were more than 99 and 95% pure in the wild-type and the mutant enzymes, respectively, as judged by SDS-polyacrylamide gel electrophoresis followed by staining with Coomassie Brilliant Blue (Fig. 2, A and B). The mutant and wild-type nitroreductases could react with antiserum raised against the wild-type nitroreductase with similar efficiencies (Fig. 2 C).Table IPurification of the wild-type and mutant nitroreductases of S. typhimuriumPurification stepTotal proteinTotal activitySpecific activityYieldmgμmol/minμmol/min/mg%Wild-type Crude extract4,8002,6000.54 (×1.0)100 Cytosol3,7002,3000.62 (×1.1)88 (NH4)2SO41,4001,7001.2 (×2.2)65 DEAE-Sepharose1501,2008.0 (×15)46 Phenyl-Sepharose3593027 (×50)36 Hydroxyapatite2687033 (×61)33 Sephadex G-1002481034 (×63)31Mutant L33R Crude extract4200.800.0019 (×1)100 Cytosol360 (NH4)2SO455 DEAE-Sepharose5.6 Hydroxyapatite2.30.0850.036 (×19)11Nitrofurazone reductase activity was determined in a reaction mixture containing 0.05 mm nitrofurazone and the NADPH-generating system. To measure the mutant nitroreductase activity, 0.1 mm of FMN was supplemented to the reaction mixture. Activity was calculated based on the reduction of nitrofurazone.-Fold increase of the specific activity of each fraction relative to that of crude extract was presented in parentheses. Open table in a new tab Nitrofurazone reductase activity was determined in a reaction mixture containing 0.05 mm nitrofurazone and the NADPH-generating system. To measure the mutant nitroreductase activity, 0.1 mm of FMN was supplemented to the reaction mixture. Activity was calculated based on the reduction of nitrofurazone. -Fold increase of the specific activity of each fraction relative to that of crude extract was presented in parentheses. The absorption spectrum of the purified wild-type nitroreductase, the color of which was yellow, showed two peaks at 370 and 455 nm (Fig. 3). The absorption spectrum suggests that it is a flavoprotein containing an oxidized form of flavin (11Bryant C. DeLuca M. J. Biol. Chem. 1991; 266: 4119-4125Abstract Full Text PDF PubMed Google Scholar). The enzyme was judged as an oxygen-insensitive nitroreductase, because the product generated from nitrofurazone by this enzyme showed an absorption maximum at 276 nm (data not shown). This indicates the formation of an open chain nitrile, which is a two-electron-reduced product of nitrofurazone (6Peterson F.J. Mason R.P. Hovsepian J. Holtzman J.L. J. Biol. Chem. 1979; 254: 4009-4014Abstract Full Text PDF PubMed Google Scholar). We compared the abilities of NADH and NADPH as electron donors and those of FMN, FAD, and riboflavin as cofactors for supporting nitroreductase activities. Both NADH and NADPH were effective as the electron donors, although theK m for NADH was more than four times lower than that of NADPH (Table II). FMN was most effective when the nitroreductase holoenzyme was reconstituted from the apoenzyme plus FMN, FAD, or riboflavin (Fig. 4). Although it was less effective, FAD also acted as a cofactor for the nitroreductase. A higher concentration of FAD (100 × FAD) yielded a higher activity than did a lower concentration (2 × FAD). There was no activity when riboflavin was used as a cofactor. We also compared the reduction rates of FMN, FAD, and riboflavin by the nitroreductase holoenzyme (Table III). In this case, riboflavin was most efficiently reduced. When the apoenzyme was used, the order of reduction rates was FMN > FAD ≫ riboflavin. Riboflavin was not reduced, probably because riboflavin did not act as a cofactor for supporting flavin reductase activity. Both NADH and NADPH acted as electron donors for the reduction of FMN, as in the case of the reduction of nitrofurazone (data not shown).Table IIKinetic parameters for the wild-type and mutant nitroreductases of S. typhimuriumSubstrateWild-typeL33R mutantRatio (B/A)K mV max(A)K mV max(B)μmμmol/min/mg proteinμmμmol/min/mg protein%NADH7102270.290.28NADPH3099880.250.25Nitrofurazone700550NDNDMichaelis constant (K m) and maximal velocity (V max) were determined from double-reciprocal plots of initial velocity of nitrofurazone reduction versus NADH, NADPH, or ni" @default.
• W2049444895 created "2016-06-24" @default.
• W2049444895 creator A5010967300 @default.
• W2049444895 creator A5022353603 @default.
• W2049444895 creator A5032120247 @default.
• W2049444895 creator A5053575988 @default.
• W2049444895 creator A5091369488 @default.
• W2049444895 date "1998-09-01" @default.
• W2049444895 modified "2023-09-27" @default.
• W2049444895 title "Purification and Characterization of Wild-type and Mutant “Classical” Nitroreductases of Salmonella typhimurium" @default.
• W2049444895 cites W1417333514 @default.
• W2049444895 cites W1494486600 @default.
• W2049444895 cites W1499795865 @default.
• W2049444895 cites W1503552721 @default.
• W2049444895 cites W1514998706 @default.
• W2049444895 cites W1528681221 @default.
• W2049444895 cites W1537365266 @default.
• W2049444895 cites W1547817405 @default.
• W2049444895 cites W1565055209 @default.
• W2049444895 cites W1569233292 @default.
• W2049444895 cites W1583993235 @default.
• W2049444895 cites W1586547644 @default.
• W2049444895 cites W1598071110 @default.
• W2049444895 cites W1600133349 @default.
• W2049444895 cites W1885317482 @default.
• W2049444895 cites W1914561217 @default.
• W2049444895 cites W1929791435 @default.
• W2049444895 cites W1932522703 @default.
• W2049444895 cites W1967502884 @default.
• W2049444895 cites W1971403296 @default.
• W2049444895 cites W1971760100 @default.
• W2049444895 cites W1978218610 @default.
• W2049444895 cites W1981299904 @default.
• W2049444895 cites W1985276467 @default.
• W2049444895 cites W1990236329 @default.
• W2049444895 cites W2002404744 @default.
• W2049444895 cites W2005156172 @default.
• W2049444895 cites W2029335737 @default.
• W2049444895 cites W2031653666 @default.
• W2049444895 cites W2033980786 @default.
• W2049444895 cites W2042365947 @default.
• W2049444895 cites W2062371411 @default.
• W2049444895 cites W2063875099 @default.
• W2049444895 cites W2070194097 @default.
• W2049444895 cites W2070223536 @default.
• W2049444895 cites W2090259372 @default.
• W2049444895 cites W2103673388 @default.
• W2049444895 cites W2111225291 @default.
• W2049444895 cites W2121763255 @default.
• W2049444895 cites W2138533612 @default.
• W2049444895 cites W2148835993 @default.
• W2049444895 cites W345758922 @default.
• W2049444895 cites W4295127969 @default.
• W2049444895 cites W4300100368 @default.
• W2049444895 doi "https://doi.org/10.1074/jbc.273.37.23922" @default.
• W2049444895 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9727006" @default.
• W2049444895 hasPublicationYear "1998" @default.
• W2049444895 type Work @default.
• W2049444895 sameAs 2049444895 @default.
• W2049444895 citedByCount "57" @default.
• W2049444895 countsByYear W20494448952012 @default.
• W2049444895 countsByYear W20494448952013 @default.
• W2049444895 countsByYear W20494448952015 @default.
• W2049444895 countsByYear W20494448952016 @default.
• W2049444895 countsByYear W20494448952017 @default.
• W2049444895 countsByYear W20494448952018 @default.
• W2049444895 countsByYear W20494448952021 @default.
• W2049444895 countsByYear W20494448952022 @default.
• W2049444895 crossrefType "journal-article" @default.
• W2049444895 hasAuthorship W2049444895A5010967300 @default.
• W2049444895 hasAuthorship W2049444895A5022353603 @default.
• W2049444895 hasAuthorship W2049444895A5032120247 @default.
• W2049444895 hasAuthorship W2049444895A5053575988 @default.
• W2049444895 hasAuthorship W2049444895A5091369488 @default.
• W2049444895 hasBestOaLocation W20494448951 @default.
• W2049444895 hasConcept C104317684 @default.
• W2049444895 hasConcept C143065580 @default.
• W2049444895 hasConcept C185592680 @default.
• W2049444895 hasConcept C207583985 @default.
• W2049444895 hasConcept C2781065037 @default.
• W2049444895 hasConcept C501734568 @default.
• W2049444895 hasConcept C523546767 @default.
• W2049444895 hasConcept C54355233 @default.
• W2049444895 hasConcept C55493867 @default.
• W2049444895 hasConcept C86803240 @default.
• W2049444895 hasConcept C89423630 @default.
• W2049444895 hasConceptScore W2049444895C104317684 @default.
• W2049444895 hasConceptScore W2049444895C143065580 @default.
• W2049444895 hasConceptScore W2049444895C185592680 @default.
• W2049444895 hasConceptScore W2049444895C207583985 @default.
• W2049444895 hasConceptScore W2049444895C2781065037 @default.
• W2049444895 hasConceptScore W2049444895C501734568 @default.
• W2049444895 hasConceptScore W2049444895C523546767 @default.
• W2049444895 hasConceptScore W2049444895C54355233 @default.
• W2049444895 hasConceptScore W2049444895C55493867 @default.
• W2049444895 hasConceptScore W2049444895C86803240 @default.
• W2049444895 hasConceptScore W2049444895C89423630 @default.
• W2049444895 hasIssue "37" @default.

• next