FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2049667730> ?p ?o ?g. }

• W2049667730 endingPage "44482" @default.
• W2049667730 startingPage "44475" @default.
• W2049667730 abstract "The oncoprotein MDM2 associates with ribosomal proteins L5, L11, and L23. Both L11 and L23 have been shown to activate p53 by inhibiting MDM2-mediated p53 suppression. Here we have shown that L5 also activates p53. Overexpression of L5 stabilized ectopic p53 in H1299 cells and endogenous p53 in U2OS cells. Consequently, L5 enhanced p53 transcriptional activity and induced p53-dependent G1 cell cycle arrest. Furthermore, like L11 and L23, L5 also remarkably inhibited MDM2-mediated p53 ubiquitination. The interaction of L5 with MDM2 was also enhanced by treatment with a low dose of actinomycin D. Actinomycin D-induced p53 was inhibited by small interference RNA against L5. By reciprocal co-immunoprecipitation, we further showed that there were at least two MDM2-ribosomal protein complexes in cells: MDM2-L5-L11-L23 and p53-MDM2-L5-L11-L23. We propose that the MDM2-L5-L11-L23 complex functions to inhibit MDM2-mediated p53 ubiquitination and thus activates p53. The oncoprotein MDM2 associates with ribosomal proteins L5, L11, and L23. Both L11 and L23 have been shown to activate p53 by inhibiting MDM2-mediated p53 suppression. Here we have shown that L5 also activates p53. Overexpression of L5 stabilized ectopic p53 in H1299 cells and endogenous p53 in U2OS cells. Consequently, L5 enhanced p53 transcriptional activity and induced p53-dependent G1 cell cycle arrest. Furthermore, like L11 and L23, L5 also remarkably inhibited MDM2-mediated p53 ubiquitination. The interaction of L5 with MDM2 was also enhanced by treatment with a low dose of actinomycin D. Actinomycin D-induced p53 was inhibited by small interference RNA against L5. By reciprocal co-immunoprecipitation, we further showed that there were at least two MDM2-ribosomal protein complexes in cells: MDM2-L5-L11-L23 and p53-MDM2-L5-L11-L23. We propose that the MDM2-L5-L11-L23 complex functions to inhibit MDM2-mediated p53 ubiquitination and thus activates p53. Inhibition of MDM2-mediated p53 ubiquitination and degradation by ribosomal protein L5. Vol. 279 (2004) 44475–44482Journal of Biological ChemistryVol. 279Issue 50PreviewPage 44479: In the right column, lines 13–16, the word “not” was omitted from the sentence. The correct sentence should read: “Of note, the slight decrease of p53 in L5 siRNA-treated cells was specific to p53; it was not caused by global translational inhibition after reduction of L5 by its siRNA.” Full-Text PDF Open Access The oncoprotein MDM2 is a crucial feedback regulator of the tumor suppressor protein p53 (1Piette J. Neel H. Marechal V. Oncogene. 1997; 15: 1001-1010Crossref PubMed Scopus (241) Google Scholar). Under physiological conditions, p53 is short-lived mainly because of MDM2-mediated ubiquitination and degradation. Under pathological conditions, the half-life of p53 is prolonged because multiple cellular pathways are activated to prevent MDM2-mediated p53 ubiquitination and degradation, consequently leading to p53 activation (2Brooks C.L. Gu W. Curr. Opin. Cell Biol. 2003; 15: 164-171Crossref PubMed Scopus (641) Google Scholar). In addition to induction of many p53-responsive genes, including those involved in cell cycle and apoptotic regulation, activated p53 also induces transcription of MDM2, which in turn suppresses p53 function. Hence, tight regulation of this MDM2-p53 feedback pathway is critically important for a cell to respond to various stresses. An example of such stress is ribosomal biogenesis stress. In response to the ribosomal biogenesis stress caused by either a low dose (5 nm) of actinomycin D (Act D) 1The abbreviations used are: Act D: actinomycin D; siRNA: small interference RNA; GST, glutathione S-transferase; GFP, green fluorescence protein; E2, ubiquitin carrier protein; E3, ubiquitin-protein isopeptide ligase. or overexpression of the mutant Bop1, a nucleolar protein critical for rRNA processing and ribosome assembly, p53 is activated and induces cell growth arrest at the G1 phase (3Ashcroft M. Kubbutat M.H. Vousden K.H. Mol. Cell. Biol. 1999; 19: 1751-1758Crossref PubMed Scopus (379) Google Scholar, 4Pestov D.G. Strezoska Z. Lau L.F. Mol. Cell. Biol. 2001; 21: 4246-4255Crossref PubMed Scopus (293) Google Scholar, 5Strezoska Z. Pestov D.G. Lau L.F. J. Biol. Chem. 2002; 277: 29617-29625Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar). Ironically, this activation does not appear to require posttranslational modifications of p53, such as phosphorylation (6Ashcroft M. Taya Y. Vousden K.H. Mol. Cell. Biol. 2000; 20: 3224-3233Crossref PubMed Scopus (324) Google Scholar). Instead, recent studies by several groups, including ours, suggest that association of the ribosomal proteins L11 and L23 with MDM2 might be responsible for p53 activation after Act D treatment (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar, 8Lohrum M.A. Ludwig R.L. Kubbutat M.H. Hanlon M. Vousden K.H. Cancer Cells. 2003; 3: 577-587Abstract Full Text Full Text PDF PubMed Scopus (540) Google Scholar, 9Zhang Y. Wolf G.W. Bhat K. Jin A. Allio T. Burkhart W.A. Xiong Y. Mol. Cell. Biol. 2003; 23: 8902-8912Crossref PubMed Scopus (460) Google Scholar). L11 and L23 can bind to MDM2 directly, and this binding is enhanced in response to Act D treatment. RNA interference against L23 can block Act D-induced p53 activation, demonstrating that L23 is required for p53 activation in response to ribosomal biogenesis stress (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar). Another ribosomal protein, L5, has also been shown to bind to MDM2 in vitro and in cells (10Marechal V. Elenbaas B. Piette J. Nicolas J.C. Levine A.J. Mol. Cell. Biol. 1994; 14: 7414-7420Crossref PubMed Scopus (294) Google Scholar, 11Elenbaas B. Dobbelstein M. Roth J. Shenk T. Levine A.J. Mol. Med. 1996; 2: 439-451Crossref PubMed Google Scholar). However, it is still puzzling whether L5, like L11 and L23, can activate p53 by inhibiting MDM2-mediated p53 ubiquitination. It is also unclear whether these three ribosomal proteins can form a single complex with MDM2 to inhibit its ubiquitin ligase activity toward p53 in cells. To address these issues, we have performed a series of cellular experiments. Our studies demonstrate that L5 can also activate p53 and induce p53-dependent G1 arrest in response to Act D-induced ribosomal biogenesis stress. Additionally, a set of reciprocal immunoprecipitation experiments reveals that L5, L11, and L23 appear to bind to MDM2 simultaneously, forming one quadruple complex in cells. The steady state level of the complex is reduced in the presence of p53, suggesting that the ribosomal proteins may compete with p53 for MDM2. Thus, our study shows that the three ribosomal proteins inhibit MDM2 function by forming a complex with MDM2. Cell Lines, Plasmids, and Antibodies—Human 293, H1299, U2OS, Saos-2, and SJSA cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% (v/v) fetal bovine serum as previously described (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar, 12Jin Y. Lee H. Zeng S.X. Dai M.S. Lu H. EMBO J. 2003; 22: 6365-6377Crossref PubMed Scopus (184) Google Scholar). To generate human L5 expression construct pcDNA3–2FLAG-L5, the full-length L5 cDNA was amplified by reverse transcriptase-PCR from HeLa cell mRNA using primers P1, 5′-CGCGG-ATCCATGGGGTTTGTTAAAGTTG-3′, and P2, 5′-CCGGAATTCTTAGCTCTCAGCAGCCCGCTC-3′. The PCR product was cloned into pcDNA3–2FLAG vector in BamHI and EcoRI sites. The pEGFP-L5 was cloned by inserting the PCR product using primers P3, 5′-CCGGAATTCATGGGGTTTGTTAAAGTTG-3′, and P4, 5′-CGCGGATCCTTAGCTCTCAGCAGCCCGCTC-3′ into pEGFP-C1 (Clontech) in EcoRI and BamHI sites. GST-MDM2 and His-MDM2 bacterial expression vectors were described previously (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar, 13Jin Y. Zeng S.X. Dai M.S. Yang X.J. Lu H. J. Biol. Chem. 2002; 277: 30838-30843Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). The His-tagged L5 bacteria expression vector pet24a-His-L5 was cloned by PCR using primers P1 and P5, 5′-CCGGAATTCCGGCTCTCAGCAGCCCGCTC-3′, into pet24a-His vector in BamHI and EcoRI sites. For generation of the polyclonal anti-L5 antibody, His-tagged full-length L5 protein was expressed in Escherichia coli, purified using nickel-nitrilotriacetic acid beads, and used as an antigen to raise rabbit polyclonal anti-L5 antisera. Anti-L23 and anti-L11 polyclonal antibodies were described (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar, 9Zhang Y. Wolf G.W. Bhat K. Jin A. Allio T. Burkhart W.A. Xiong Y. Mol. Cell. Biol. 2003; 23: 8902-8912Crossref PubMed Scopus (460) Google Scholar). Anti-FLAG (Sigma), anti-p21cip1 (NeoMarkers), anti-p53 (DO-1, Santa Cruz Biotechnology), and polyclonal anti-MDM2 (Santa Cruz) were purchased. Monoclonal anti-MDM2 (2A10 and 4B11) and anti-HA (12CA5) have been previously described (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar, 13Jin Y. Zeng S.X. Dai M.S. Yang X.J. Lu H. J. Biol. Chem. 2002; 277: 30838-30843Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). Cotransfection, Immunoblot, and Co-immunoprecipitation Analyses—H1299, U2OS, or Saos2 cells were transfected with plasmids as indicated in the figure legends using Lipofectin following the manufacturer's protocol (Invitrogen). Cells were harvested 48 h posttransfection and lysed in lysis buffer. Equal amounts of clear cell lysates were used for immunoblot analysis as described previously (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar, 14Zeng S.X. Dai M.S. Keller D.M. Lu H. EMBO J. 2002; 21: 5487-5497Crossref PubMed Scopus (75) Google Scholar). Immunoprecipitation was conducted using antibodies as indicated in the figure legends and described previously (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar, 14Zeng S.X. Dai M.S. Keller D.M. Lu H. EMBO J. 2002; 21: 5487-5497Crossref PubMed Scopus (75) Google Scholar). Beads were washed with lysis buffer twice, once with SNNTE buffer (50 mmol/liter Tris-HCl (pH 7.4), 750 mmol/liter NaCl, 1% Triton X-100, 0.1% sodium dodecyl sulfate (SDS), and 1%, sodium deoxycholate), and once with radioimmune precipitation assay buffer. Bound proteins were detected by immunoblot using antibodies as indicated in the figure legends. Lysis buffer, SNNTE, radioimmune precipitation assay buffer, and Buffer C 100 (BC100) (containing 20 mmol/liter Tris-HCl (pH 7.9), 0.1 mmol/liter EDTA, 10% glycerol, 100 mmol/liter KCl, 4 mmol/liter MgCl2, 0.2 mmol/liter PMSF, 1 mmol/liter dithiothreitol, and 0.25 mg/ml pepstatin A) were described (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar, 14Zeng S.X. Dai M.S. Keller D.M. Lu H. EMBO J. 2002; 21: 5487-5497Crossref PubMed Scopus (75) Google Scholar). GST Fusion Protein Association Assays—His-tagged L5, L11, L23, and MDM2 proteins were expressed in E. coli, purified through a nickel-nitrilotriacetic acid column, and eluted by 0.5 m imidazole. Protein-protein interaction assays were conducted as described (13Jin Y. Zeng S.X. Dai M.S. Yang X.J. Lu H. J. Biol. Chem. 2002; 277: 30838-30843Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). Briefly, purified His-tagged L5, L11, or L23 proteins were incubated with glutathione-Sepharose 4B beads (Sigma) containing 200 ng of GST-MDM2 or GST, respectively, for 30 min at room temperature. The mixtures were then washed once in BC100 containing 0.1% Nonidet P-40, twice in SNNTE, and once in radioimmune precipitation assay buffer. Bound proteins were analyzed on a 12% SDS gel and detected by immunoblot using anti-His, anti-L11, anti-L23, or anti-MDM2 (2A10) antibody. Transient Transfection and Luciferase Assays—U2OS or Saos-2 cells were transfected with the pCMV-β-galactoside reporter plasmid (0.1 μg) and a luciferase reporter plasmid (0.1 μg) driven by two copies of the p53RE motif derived from the MDM2 promoter (15Wu X. Bayle J.H. Olson D. Levine A.J. Genes Dev. 1993; 7: 1126-1132Crossref PubMed Scopus (1645) Google Scholar), together with a combination of different plasmids (total plasmid DNA 1 μg/well) as indicated in Fig. 2B, using Lipofectin (Invitrogen). 48 h posttransfection, cells were harvested for luciferase assays as described previously (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar, 14Zeng S.X. Dai M.S. Keller D.M. Lu H. EMBO J. 2002; 21: 5487-5497Crossref PubMed Scopus (75) Google Scholar). Luciferase activity was normalized by a factor of β-galactosidase activity in the same assay. Cell Cycle Analysis—U2OS or Saos-2 cells were transfected with plasmids encoding GFP or GFP-L5. 32 h posttransfection, cells were treated with 200 μg/ml nocodazole for an additional 16 h. Cells were stained in 500 μl of propidium iodide (Sigma) stain buffer and analyzed for DNA content using a Becton Dickinson FACScan flow cytometer as described (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar, 14Zeng S.X. Dai M.S. Keller D.M. Lu H. EMBO J. 2002; 21: 5487-5497Crossref PubMed Scopus (75) Google Scholar). Data were collected using the ModFit software program. GFP-positive cells were gated for cell cycle analysis. Reverse Transcriptase PCR Analysis—Total RNA was isolated using Qiagen RNeasy minikits. Reverse transcriptions were performed as described (14Zeng S.X. Dai M.S. Keller D.M. Lu H. EMBO J. 2002; 21: 5487-5497Crossref PubMed Scopus (75) Google Scholar). The PCR reactions were performed in a 20-μl mixture containing 1× PCR buffer, 60 μmol/liter of dNTPs, 1 unit of Taq polymerase (Roche Applied Science), 0.5 μmol/liter of each primer, and 0.2 μCi of [32P]dCTP for 18–20 cycles as described (14Zeng S.X. Dai M.S. Keller D.M. Lu H. EMBO J. 2002; 21: 5487-5497Crossref PubMed Scopus (75) Google Scholar). PCR products were resolved onto a 6% polyacrylamide gel. The gel was dried and followed by autoradiography. The primers for amplifying p21cip1, glyceraldehyde-3-phosphate dehydrogenase were described (14Zeng S.X. Dai M.S. Keller D.M. Lu H. EMBO J. 2002; 21: 5487-5497Crossref PubMed Scopus (75) Google Scholar). The primers for amplifying p53 were 5′-TACAGTCAGAGCCAACCTCAG-3′ and 5′-AGATGAAGCTCCCAGAATGCC-3′. In Vivo Ubiquitination Assays—H1299 cells were transfected with His6 ubiquitin (2 μg), p53 (2 μg), Ha-MDM2 (2 μg), and L5 (1, 2 μg) expression plasmids as indicated in figure legend 4 using Lipofectin. 48 h after transfection, cells were harvested and split into two aliquots, one for immunoblot and the other for ubiquitination assays. The in vivo ubiquitination assay was conducted as previously described (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar, 12Jin Y. Lee H. Zeng S.X. Dai M.S. Lu H. EMBO J. 2003; 22: 6365-6377Crossref PubMed Scopus (184) Google Scholar). Eluted proteins were analyzed by immunoblot with monoclonal p53 antibodies (DO-1; Santa Cruz). Introduction of siRNA against L5 into Human Cells Followed by Treatment with Act D—RNA interference-mediated ablation of endogenous L5 was performed essentially as previously described (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar, 16Nikolaev A.Y. Li M. Puskas N. Qin J. Gu W. Cell. 2003; 112: 29-40Abstract Full Text Full Text PDF PubMed Scopus (325) Google Scholar). The 21-nucleotide siRNA duplexes with a 3′ dTdT overhang, corresponding to L5 mRNA (AAGGGAGCTGTGGATGGAGGC), or the scramble II RNA duplex (AAGCGCGCTTTGTAGGATTC) as a control were synthesized (Dhamacon). These siRNA duplexes (0.2 μm) were introduced into U2OS cells using Oligofectamine (Invitrogen) following the manufacturer's protocol. The cells were then treated either with or without 5 nm Act D for 8 h before harvesting. Cells were harvested 48 h after transfection for immunoblot analysis. To determine the global protein synthesis after L5 siRNA treatment, U2OS cells were transfected with either L5 siRNA or scramble RNA as above. The cells were directly lysed, and equal amounts (10 μg) of total protein were loaded on a 10% SDS-PAGE gel followed by silver staining. Alternatively, the cells were starved in a methionine-free medium for 30 min followed by pulse labeling with 50 μCi/ml of [35S]methionine for 30 min. The cells were lysed, and equal amounts of total proteins were loaded onto a 10% SDS-PAGE gel. The gel was incubated in an Amplify solution (Amersham Biosciences) for 10 min, dried, and exposed to x-ray film. L5 Interacts with MDM2 in Cells and in Vitro—We previously identified an MDM2 complex that contains ribosomal proteins L5, L11, and L23 from cytoplasmic fractions of a stable HA-MDM2-expressing 293 cell line (293-HA-MDM2) using immunoaffinity chromatography followed by mass spectrometry (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar). Consistent with an early report (10Marechal V. Elenbaas B. Piette J. Nicolas J.C. Levine A.J. Mol. Cell. Biol. 1994; 14: 7414-7420Crossref PubMed Scopus (294) Google Scholar), we also found that L5 directly bound to MDM2. Ectopically expressed FLAG-L5 and HA-MDM2 were co-immunoprecipitated in 293 cells with antibodies against HA or FLAG, but not the control antibody (Fig. 1A). Because it has not been determined whether endogenous L5 and MDM2 proteins bind to each other, we generated polyclonal anti-L5 antibodies to test this unsolved issue. The antibody specifically recognized a band at ∼35 kDa, the predicted size for L5, in 293 cells (Fig. 1B, lane 1), as well as the ectopically expressed FLAG-L5 (Fig. 1B, lane 2). This antibody also specifically detected endogenous L5 co-immunoprecipitated by anti-MDM2, but not control antibody, in SJSA cells, which expressed a relatively high level of endogenous MDM2 (Fig. 1C, lane 2). Also, L5, like L11 (Fig. 1F, second panel) and L23 (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar), directly interacted with MDM2 in vitro as shown in Fig. 1F using glutathione S-transferase fusion MDM2-protein association assays. To determine where the L5-MDM2 binding occurs in cells, we prepared both cytoplasmic and nuclear fractions of lysates from 293-HA-MDM2 cells. HA-MDM2 was expressed in both the cytoplasm and the nucleus as shown by immunoblot (Fig. 1D, lanes 3 and 4) and by immunofluorescence staining (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar). Equal amounts of both fractions were immunoprecipitated with anti-L5 antibody. As shown in Fig. 1D, HA-MDM2 was co-immunoprecipitated by anti-L5 in both fractions. Furthermore, we introduced FLAG-L5 together with wild type MDM2 or its nuclear localization sequence deletion mutant (MDM2Δ 150–230) into 293 cells. Cell lysates were co-immunoprecipitated with an anti-FLAG antibody. As shown in Fig. 1E, both MDM2Δ 150–230 and wild type MDM2 were co-immunoprecipitated with the anti-FLAG antibody. It is worth noting that the level of this deletion mutant was apparently lower than that of wild type MDM2 because of its rapid degradation in the cytoplasm (12Jin Y. Lee H. Zeng S.X. Dai M.S. Lu H. EMBO J. 2003; 22: 6365-6377Crossref PubMed Scopus (184) Google Scholar). Because the Δ150–320 mutant of MDM2 is localized only in the cytoplasm (12Jin Y. Lee H. Zeng S.X. Dai M.S. Lu H. EMBO J. 2003; 22: 6365-6377Crossref PubMed Scopus (184) Google Scholar) and L5 is localized in both the cytoplasm and the nucleus (data not shown), these results indicate that L5 can bind to MDM2 in both the cytoplasm and the nucleus. Ectopic Expression of L5 Induces p53 Transcriptional Activity and G1 Cell Cycle Arrest—We (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar) and others (8Lohrum M.A. Ludwig R.L. Kubbutat M.H. Hanlon M. Vousden K.H. Cancer Cells. 2003; 3: 577-587Abstract Full Text Full Text PDF PubMed Scopus (540) Google Scholar, 9Zhang Y. Wolf G.W. Bhat K. Jin A. Allio T. Burkhart W.A. Xiong Y. Mol. Cell. Biol. 2003; 23: 8902-8912Crossref PubMed Scopus (460) Google Scholar) have shown that overexpression of either L11 or L23 induces p53 transcriptional activity. To determine whether L5 has a similar effect, we introduced FLAG-L5 into human osteosarcoma U2OS cells that contain endogenous wild type p53. Interestingly, overexpression of FLAG-L5 also markedly induced p53 in a dose-dependent fashion (Fig. 2A). Correspondingly, the levels of the p53 targets p21cip1 and MDM2 were also induced. Overexpression of GFP-L5 had a similar effect on p53 and p21cip1 induction (Fig. 3C). The induction of p53 by L5 occurred at the posttranscriptional level as the mRNA level of p53 was not affected, whereas p21cip1 induction occurred at the transcriptional level (Fig. 3D). This result suggests that overexpression of L5 stimulates p53 transcriptional activity. To further confirm this stimulatory effect on p53 transcriptional activity, we carried out luciferase assays using a luciferase reporter plasmid driven by a p53RE. Indeed, ectopic expression of L5 markedly stimulated p53RE-driven transcription in a dose-dependent manner (Fig. 2B) in p53-proficient U2OS cells, but not in p53-deficient human osteosarcoma Saos-2 cells. This result indicates that the enhanced luciferase activity is p53-dependent. To test whether induction of p53 and p21cip1 levels by L5 leads to cell growth arrest, we introduced GFP-fused L5 or GFP alone into U2OS and Saos2 cells. Cells were then subjected to fluorescence-activated cell sorter analysis after treatment with the mitotic inhibitor nocodazole (17Boyd M.T. Vlatkovic N. Haines D.S. J. Biol. Chem. 2000; 275: 31883-31890Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). GFP-positive cells were then gated for cell cycle analysis. A representative result in Fig. 3A shows that 26.6% of GFP-L5-expressing U2OS cells were arrested in the G1 phase, whereas only 5.9% of U2OS cells expressing GFP were detected in the G1 phase (Fig. 3, A and B). The G1 arrest induced by L5 was dependent on p53 because no significant change was observed in p53-null Saos2 cells that contained ectopically expressed GFP-L5 (Fig. 3, A and B). Correspondingly, both p53 and p21cip1 protein levels (Fig. 3C) as well as the mRNA level of p21cip1 (Fig. 3D) were induced by GFP-L5, but not GFP, in U2OS cells. Taken together, these results demonstrate that ectopic expression of L5 induces p53 transcriptional activity and p53-dependent G1 arrest. Overexpression of L5 Inhibits MDM2-mediated p53 Ubiquitination—To determine whether p53 induction by L5 is caused by inhibition of MDM2-mediated p53 ubiquitination and degradation, we introduced exogenous MDM2, p53, and L5 into p53-deficient human non-small cell carcinoma H1299 cells. Transfected cells were harvested 48 h after transfection and 6 h after treatment with the proteasome inhibitor MG132 for ubiquitination and immunoblot assays. As shown in Fig. 4A and by others (18Fang S. Jensen J.P. Ludwig R.L. Vousden K.H. Weissman A.M. J. Biol. Chem. 2000; 275: 8945-8951Abstract Full Text Full Text PDF PubMed Scopus (875) Google Scholar, 19Haupt Y. Maya R. Kazaz A. Oren M. Nature. 1997; 387: 296-299Crossref PubMed Scopus (3750) Google Scholar, 20Honda R. Tanaka H. Yasuda H. FEBS Lett. 1997; 420: 25-27Crossref PubMed Scopus (1604) Google Scholar), MDM2 ubiquitinated p53 (lane 4). By contrast, expression of L5 (lanes 5 and 6) remarkably inhibited p53 ubiquitination in a dose-dependent manner. This inhibition was not generated by sample loading, as the levels of all the proteins were approximately equivalent (Fig. 4A, bottom panels). Consistently, expression of L5 also partially rescued MDM2-mediated p53 degradation in the absence of MG132 (Fig. 4B, compare lane 3 with lane 4). These results indicate that L5 can stabilize p53 by alleviating MDM2-mediated p53 ubiquitination and degradation. Actinomycin D Induces L5 Interaction and Activates p53, Which Is Inhibited by L5 siRNA—Our recent study (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar) suggests that L23 may be involved in p53 activation induced by a low dose (5 nm) of Act D. Because 5 nm of Act D has been shown to specifically inhibit RNA polymerase I and thus to lead to perturbation of ribosomal biogenesis and p53 activation (6Ashcroft M. Taya Y. Vousden K.H. Mol. Cell. Biol. 2000; 20: 3224-3233Crossref PubMed Scopus (324) Google Scholar), we wanted to determine whether L5, like L11 (8Lohrum M.A. Ludwig R.L. Kubbutat M.H. Hanlon M. Vousden K.H. Cancer Cells. 2003; 3: 577-587Abstract Full Text Full Text PDF PubMed Scopus (540) Google Scholar, 9Zhang Y. Wolf G.W. Bhat K. Jin A. Allio T. Burkhart W.A. Xiong Y. Mol. Cell. Biol. 2003; 23: 8902-8912Crossref PubMed Scopus (460) Google Scholar) and L23 (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar), also plays a role in this ribosomal biogenesis stress-p53 pathway. To this end, siRNA against L5 was introduced into U2OS cells prior to treatment with 5 nm of Act D. As shown in Fig. 5A, similar to the case of L23 (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar), siRNA against L5 also drastically inhibited Act D-induced p53 levels (5.5-fold reduction; compare lane 4 to lane 3 of top panel) and activation evidenced by the reduced MDM2 and p21cip1 levels (lane 4 of second and third panels), suggesting that L5 might also be an important regulator of the Act D-p53 pathway. However, unlike in the case of L23, in which L23 reduction by its siRNA drastically induced both p53 and MDM2 (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar), ablation of L5 by its siRNA slightly reduced the p53 level in Act D-untreated cells (2.1-fold reduction, compare lane 2 to lane 1 of top panel). This slight reduction of p53 by L5 siRNA does not contradict the result above showing that siRNA against L5 inhibited Act D-induced p53 levels, because the reduction (5.5-fold) of p53 by L5 siRNA in cells treated with Act D was much greater than that in cells without Act D treatment (2.1-fold). Of note, the slight decrease of p53 in L5 siRNA-treated cells was specific to p53; it was caused by global translational inhibition after reduction of L5 by its siRNA. First, the level of another short-living cyclin-dependent kinase inhibitor, p27kip1, was not affected by L5 siRNA treatment (Fig. 5A, fourth panel, lanes 2 and 4) compared with scramble RNA-transfected cells (lanes 1 and 3). Second, as shown in Fig. 5B, L5 siRNA treatment did not significantly reduce the overall protein level (compare lane 2 to lane 1) and protein synthesis (compare lane 4 to lane 3) as determined by silver staining and [35S]methionine pulse labeling experiments, respectively. These results indicate that partial reduction of L5 in a short time (slightly more than half-reduction of L5 level in less than 48 h in our assays) may not significantly affect global translation (Fig. 5A, third lower panel). This phenotype is also supported by a recent knockout study, showing that mice heterozygous for the disrupted ribosomal s19 allele displayed normal growth and organ development though homozygous mice were embryonic lethal (21Matsson H. Davey E.J. Draptchinskaia N. Hamaguchi I. Ooka A. Leveen P. Forsberg E. Karlsson S. Dahl N. Mol. Cell. Biol. 2004; 24: 4032-4037Crossref PubMed Scopus (132) Google Scholar). Next, we examined the interaction between L5 and MDM2 after Act D treatment in U2OS cells. The cells were treated with or without 5 nm of Act D for 8 h and used for immunoprecipitation with either monoclonal anti-MDM2 4B11 or polyclonal anti-L5 antibodies, followed by immunoblotting with anti-MDM2 2A10 or anti-L5 antibodies. Indeed, as shown in Fig. 5C, the interaction between endogenous L5 and MDM2 was observed in cells treated with Act D as detected by co-immunoprecipitation with either anti-L5 or anti-MDM2 antibodies followed by immunoblot with both of the antibodies tj;2(lanes 3–6). The Act D-induced MDM2-L5 interaction was not because of the induced level of MDM2 by Act D. When we treated the cells with a proteasome inhibitor, MG132, to normalize the MDM2 levels between Act D-treated and untreated cells 6 h before harvesting, the enhanced MDM2-L5 interaction was still observed in Act D-treated cells compared with cells without Act D treatment (data not shown). Taken together, these data show that there is an Act D-induced association of L5 and MDM2 in cells, indicating that like L23 and L11 (7Dai M.S. Zeng S.X. Jin Y. Sun X.X. David L. Lu H. Mol. Cell. Biol.,. 2004; 24: 7654-7668Crossref PubMed Scopus (413) Google Scholar, 8Lohrum M.A. Ludwig R.L. Kubbutat M.H. Hanlon M. Vousden K.H." @default.
• W2049667730 created "2016-06-24" @default.
• W2049667730 creator A5061151351 @default.
• W2049667730 creator A5079815253 @default.
• W2049667730 date "2004-10-01" @default.
• W2049667730 modified "2023-10-10" @default.
• W2049667730 title "Inhibition of MDM2-mediated p53 Ubiquitination and Degradation by Ribosomal Protein L5" @default.
• W2049667730 cites W100225602 @default.
• W2049667730 cites W172433167 @default.
• W2049667730 cites W1963795701 @default.
• W2049667730 cites W1965173366 @default.
• W2049667730 cites W1971864853 @default.
• W2049667730 cites W1996675458 @default.
• W2049667730 cites W2002440675 @default.
• W2049667730 cites W2007249806 @default.
• W2049667730 cites W2008922773 @default.
• W2049667730 cites W2039335985 @default.
• W2049667730 cites W2065646551 @default.
• W2049667730 cites W2073936529 @default.
• W2049667730 cites W2082979850 @default.
• W2049667730 cites W2083358720 @default.
• W2049667730 cites W2084692950 @default.
• W2049667730 cites W2087393141 @default.
• W2049667730 cites W2106220910 @default.
• W2049667730 cites W2112706571 @default.
• W2049667730 cites W2116755440 @default.
• W2049667730 cites W2118718951 @default.
• W2049667730 cites W2119288883 @default.
• W2049667730 cites W2134937174 @default.
• W2049667730 cites W2147852942 @default.
• W2049667730 cites W2150833695 @default.
• W2049667730 cites W2154863348 @default.
• W2049667730 cites W2158107656 @default.
• W2049667730 cites W2158795036 @default.
• W2049667730 cites W2170494099 @default.
• W2049667730 doi "https://doi.org/10.1074/jbc.m403722200" @default.
• W2049667730 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15308643" @default.
• W2049667730 hasPublicationYear "2004" @default.
• W2049667730 type Work @default.
• W2049667730 sameAs 2049667730 @default.
• W2049667730 citedByCount "477" @default.
• W2049667730 countsByYear W20496677302012 @default.
• W2049667730 countsByYear W20496677302013 @default.
• W2049667730 countsByYear W20496677302014 @default.
• W2049667730 countsByYear W20496677302015 @default.
• W2049667730 countsByYear W20496677302016 @default.
• W2049667730 countsByYear W20496677302017 @default.
• W2049667730 countsByYear W20496677302018 @default.
• W2049667730 countsByYear W20496677302019 @default.
• W2049667730 countsByYear W20496677302020 @default.
• W2049667730 countsByYear W20496677302021 @default.
• W2049667730 countsByYear W20496677302022 @default.
• W2049667730 countsByYear W20496677302023 @default.
• W2049667730 crossrefType "journal-article" @default.
• W2049667730 hasAuthorship W2049667730A5061151351 @default.
• W2049667730 hasAuthorship W2049667730A5079815253 @default.
• W2049667730 hasBestOaLocation W20496677301 @default.
• W2049667730 hasConcept C104317684 @default.
• W2049667730 hasConcept C153911025 @default.
• W2049667730 hasConcept C185592680 @default.
• W2049667730 hasConcept C190283241 @default.
• W2049667730 hasConcept C25602115 @default.
• W2049667730 hasConcept C2776192174 @default.
• W2049667730 hasConcept C2779679103 @default.
• W2049667730 hasConcept C2992195973 @default.
• W2049667730 hasConcept C3020813896 @default.
• W2049667730 hasConcept C38062823 @default.
• W2049667730 hasConcept C41008148 @default.
• W2049667730 hasConcept C55493867 @default.
• W2049667730 hasConcept C67705224 @default.
• W2049667730 hasConcept C76155785 @default.
• W2049667730 hasConcept C86803240 @default.
• W2049667730 hasConcept C88478588 @default.
• W2049667730 hasConcept C95444343 @default.
• W2049667730 hasConceptScore W2049667730C104317684 @default.
• W2049667730 hasConceptScore W2049667730C153911025 @default.
• W2049667730 hasConceptScore W2049667730C185592680 @default.
• W2049667730 hasConceptScore W2049667730C190283241 @default.
• W2049667730 hasConceptScore W2049667730C25602115 @default.
• W2049667730 hasConceptScore W2049667730C2776192174 @default.
• W2049667730 hasConceptScore W2049667730C2779679103 @default.
• W2049667730 hasConceptScore W2049667730C2992195973 @default.
• W2049667730 hasConceptScore W2049667730C3020813896 @default.
• W2049667730 hasConceptScore W2049667730C38062823 @default.
• W2049667730 hasConceptScore W2049667730C41008148 @default.
• W2049667730 hasConceptScore W2049667730C55493867 @default.
• W2049667730 hasConceptScore W2049667730C67705224 @default.
• W2049667730 hasConceptScore W2049667730C76155785 @default.
• W2049667730 hasConceptScore W2049667730C86803240 @default.
• W2049667730 hasConceptScore W2049667730C88478588 @default.
• W2049667730 hasConceptScore W2049667730C95444343 @default.
• W2049667730 hasIssue "43" @default.
• W2049667730 hasLocation W20496677301 @default.
• W2049667730 hasOpenAccess W2049667730 @default.
• W2049667730 hasPrimaryLocation W20496677301 @default.
• W2049667730 hasRelatedWork W1139238487 @default.
• W2049667730 hasRelatedWork W1604210099 @default.
• W2049667730 hasRelatedWork W2008993245 @default.

• next