FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2050881658> ?p ?o ?g. }

• W2050881658 endingPage "15448" @default.
• W2050881658 startingPage "15441" @default.
• W2050881658 abstract "The platelet collagen receptor glycoprotein VI (GPVI) is structurally homologous to multisubunit immune receptors and signals through the immune receptor adaptor Fc Rγ. Multisubunit receptors are composed of specialized subunits thought to be dedicated exclusively to ligand binding or signal transduction. However, recent studies of the intracellular region of GPVI, a ligand-binding subunit, have suggested the existence of protein-protein interactions that could regulate receptor signaling. In the present study we have investigated the signaling role of the GPVI intracellular domain by stably expressing GPVI mutants in RBL-2H3 cells, a model system that accurately reproduces the GPVI signaling events observed in platelets. Studies of mutant GPVI receptor protein-protein interaction and calcium signaling reveal the existence of discrete domains within the receptor's intracellular tail that mediate interaction with Fc Rγ, calmodulin, and Src family tyrosine kinases. These receptor interactions are modular and mediated by non-overlapping regions of the receptor transmembrane and intracellular domains. GPVI signaling requires all three of these domains as receptor mutants able to couple to only two interacting proteins exhibited severe signaling defects despite normal surface expression. Our results demonstrate that the ligand-binding subunit of the GPVI-Fc Rγ receptor participates directly in receptor signaling by interacting with downstream signaling molecules other than Fc Rγ through an adaptor-like mechanism. The platelet collagen receptor glycoprotein VI (GPVI) is structurally homologous to multisubunit immune receptors and signals through the immune receptor adaptor Fc Rγ. Multisubunit receptors are composed of specialized subunits thought to be dedicated exclusively to ligand binding or signal transduction. However, recent studies of the intracellular region of GPVI, a ligand-binding subunit, have suggested the existence of protein-protein interactions that could regulate receptor signaling. In the present study we have investigated the signaling role of the GPVI intracellular domain by stably expressing GPVI mutants in RBL-2H3 cells, a model system that accurately reproduces the GPVI signaling events observed in platelets. Studies of mutant GPVI receptor protein-protein interaction and calcium signaling reveal the existence of discrete domains within the receptor's intracellular tail that mediate interaction with Fc Rγ, calmodulin, and Src family tyrosine kinases. These receptor interactions are modular and mediated by non-overlapping regions of the receptor transmembrane and intracellular domains. GPVI signaling requires all three of these domains as receptor mutants able to couple to only two interacting proteins exhibited severe signaling defects despite normal surface expression. Our results demonstrate that the ligand-binding subunit of the GPVI-Fc Rγ receptor participates directly in receptor signaling by interacting with downstream signaling molecules other than Fc Rγ through an adaptor-like mechanism. platelet collagen receptor glycoprotein VI fluorescein isothiocyanate 4-morpholinepropanesulfonic acid 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid convulxin Activation of platelets in response to exposed collagen is a critical step in response to vascular injury and the formation of intravascular thrombi associated with stroke and myocardial infarction. A necessary step in the activation of platelets by collagen is signaling by the glycoprotein VI (GPVI)1 receptor (1Sugiyama T. Okuma M. Ushikubi F. Sensaki S. Kanaji K. Uchino H. Blood. 1987; 69: 1712-1720Crossref PubMed Google Scholar, 2Moroi M. Jung S.M. Okuma M. Shinmyozu K. J. Clin. Invest. 1989; 84: 1440-1445Crossref PubMed Scopus (371) Google Scholar, 3Poole A. Gibbins J.M. Turner M. van Vugt M.J. van de Winkel J.G. Saito T. Tybulewicz V.L. Watson S.P. EMBO J. 1997; 16: 2333-2341Crossref PubMed Scopus (398) Google Scholar). The GPVI receptor is homologous to immune receptors and associates non-covalently with Fc Rγ (3Poole A. Gibbins J.M. Turner M. van Vugt M.J. van de Winkel J.G. Saito T. Tybulewicz V.L. Watson S.P. EMBO J. 1997; 16: 2333-2341Crossref PubMed Scopus (398) Google Scholar, 4Nieswandt B. Bergmeier W. Schulte V. Rackebrandt K. Gessner J.E. Zirngibl H. J. Biol. Chem. 2000; 275: 23998-24002Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar), a transmembrane protein that mediates signaling by several immune receptors through an immunoreceptor tyrosine activation motif (ITAM) (5Takai T. Li M. Sylvestre D. Clynes R. Ravetch J.V. Cell. 1994; 76: 519-529Abstract Full Text PDF PubMed Scopus (827) Google Scholar). ITAM signaling is initiated by tyrosine phosphorylation mediated by Src family tyrosine kinases (6Watson S.P. Gibbins J. Immunol. Today. 1998; 19: 260-264Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar), a process associated with receptor movement to specialized regions of the cell membrane known as lipid rafts (7Locke D. Chen H. Liu Y. Liu C. Kahn M.L. J. Biol. Chem. 2002; 277: 18801-18809Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar, 8Holowka D. Baird B. Sem. Immunol. 2001; 13: 99-105Crossref PubMed Scopus (88) Google Scholar). In platelets and other hematopoietic cells ITAM activation ultimately results in phospholipase Cγ activation (9Asselin J. Gibbins J.M. Achison M. Lee Y.H. Morton L.F. Farndale R.W. Barnes M.J. Watson S.P. Blood. 1997; 89: 1235-1242Crossref PubMed Google Scholar) and intracellular calcium release through a series of signaling proteins including the non-receptor tyrosine kinase SYK (3Poole A. Gibbins J.M. Turner M. van Vugt M.J. van de Winkel J.G. Saito T. Tybulewicz V.L. Watson S.P. EMBO J. 1997; 16: 2333-2341Crossref PubMed Scopus (398) Google Scholar, 10Ichinohe T. Takayama H. Ezumi Y. Arai M. Yamamoto N. Takahashi H. Okuma M. J. Biol. Chem. 1997; 272: 63-68Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar) and the adaptors SLP-76 (11Gross B.S. Lee J.R. Clements J.L. Turner M. Tybulewicz V.L. Findell P.R. Koretzky G.A. Watson S.P. J. Biol. Chem. 1999; 274: 5963-5971Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar) and LAT (12Pasquet J.M. Gross B. Quek L. Asazuma N. Zhang W. Sommers C.L. Schweighoffer E. Tybulewicz V. Judd B. Lee J.R. Koretzky G. Love P.E. Samelson L.E. Watson S.P. Mol. Cell. Biol. 1999; 19: 8326-8334Crossref PubMed Google Scholar,13Watson S.P. Asazuma N. Atkinson B. Berlanga O. Best D. Bobe R. Jarvis G. Marshall S. Snell D. Stafford M. Tulasne D. Wilde J. Wonerow P. Frampton J. Thromb. Haemost. 2001; 86: 276-288Crossref PubMed Scopus (119) Google Scholar). We and others (14Zheng Y.M. Liu C. Chen H. Locke D. Ryan J.C. Kahn M.L. J. Biol. Chem. 2001; 276: 12999-13006Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar, 15Berlanga O. Tulasne D. Bori T. Snell D.C. Miura Y. Jung S. Moroi M. Frampton J. Watson S.P. Eur. J. Biochem. 2002; 269: 2951-2960Crossref PubMed Scopus (51) Google Scholar) have shown that mutation of a single transmembrane arginine in GPVI (GPVI R272L) is sufficient to uncouple the receptor from the Fc Rγ chain. GPVI R272L is unable to activate the release of intracellular calcium in RBL-2H3 cells (14Zheng Y.M. Liu C. Chen H. Locke D. Ryan J.C. Kahn M.L. J. Biol. Chem. 2001; 276: 12999-13006Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar), a hematopoietic cell model in which heterologous expression of GPVI confers collagen-dependent calcium signaling (16Chen H. Locke D. Liu Y. Liu C. Kahn M.L. J. Biol. Chem. 2002; 277: 3011-3019Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar). Unexpectedly, and unlike previously studied Fc Rγ partners (17Lanier L.L. Yu G. Phillips J.H. J. Immunol. 1991; 146: 1571-1576PubMed Google Scholar, 18Alber G. Miller L. Jelsema C.L. Varin-Blank N. Metzger H. J. Biol. Chem. 1991; 266: 22613-22620Abstract Full Text PDF PubMed Google Scholar), truncation of the GPVI intracellular domain also abrogated GPVI signaling despite preservation of the critical transmembrane arginine (14Zheng Y.M. Liu C. Chen H. Locke D. Ryan J.C. Kahn M.L. J. Biol. Chem. 2001; 276: 12999-13006Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar, 15Berlanga O. Tulasne D. Bori T. Snell D.C. Miura Y. Jung S. Moroi M. Frampton J. Watson S.P. Eur. J. Biochem. 2002; 269: 2951-2960Crossref PubMed Scopus (51) Google Scholar). These results suggest that the GPVI intracellular domain might play an important role in GPVI signaling, an idea recently confirmed by the identification of an interaction between the Src family kinase Lyn and the GPVI intracellular domain (19Suzuki-Inoue K. Tulasne D. Shen Y. Bori-Sanz T. Inoue O. Jung S.M. Moroi M. Andrews R.K. Berndt M.C. Watson S.P. J. Biol. Chem. 2002; 277: 21561-21566Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). Biochemical studies have also shown that the GPVI intracellular domain interacts with calmodulin (20Andrews R.K. Suzuki-Inoue K. Shen Y. Tulasne D. Watson S.P. Berndt M.C. Blood. 2002; 99: 4219-4221Crossref PubMed Scopus (79) Google Scholar). The functional importance of these interactions for signal transduction by GPVI, however, is unknown. To further investigate the role of the GPVI intracellular domain during signal transduction we have stably expressed a series of receptor truncation mutants and amino acid substitution mutants in RBL-2H3 cells to analyze receptor signaling and protein-protein interactions. These studies identify two critical functional domains within the GPVI intracellular tail, a highly basic region that mediates interaction with calmodulin and a proline-rich region that mediates interaction with Src family kinases. Interruption of either one of these domains significantly impairs GPVI signaling despite normal association with Fc Rγ. In addition, the function of these domains appeared autonomous,i.e. loss of calmodulin binding, Lyn association or Fc Rγ coupling had little effect on GPVI association with the other two interacting proteins. Our results reveal an important independent role for the GPVI intracellular tail in the regulation of receptor signaling and suggest that the ligand-binding subunit of this receptor functions as an adaptor to bind downstream signaling proteins. The extent to which the intracellular domains of similar multisubunit receptors also function to modulate receptor signaling in an adaptor-like fashion remains to be investigated. All reagents were from Sigma unless stated. Convulxin was purified from the venom of the South American rattlesnake (Crotalus durissus terrificus) by gel filtration as described (14Zheng Y.M. Liu C. Chen H. Locke D. Ryan J.C. Kahn M.L. J. Biol. Chem. 2001; 276: 12999-13006Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). Mouse monoclonal anti-calmodulin and anti-FcRγ antibody were from Upstate Biotechnology, Inc. (Lake Placid, NY). Rabbit anti-Lyn polyclonal antibody was from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Anti-GPVI monoclonal antibody HY101 was made as described (16Chen H. Locke D. Liu Y. Liu C. Kahn M.L. J. Biol. Chem. 2002; 277: 3011-3019Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar) and affinity-purified from hybridoma supernatants by HiTrap Sepharose-protein G affinity chromatograhy (Amersham Biosciences). All GPVI truncation mutants were generated using PCR to insert a premature STOP codon in place of the indicated amino acid as previously described (14Zheng Y.M. Liu C. Chen H. Locke D. Ryan J.C. Kahn M.L. J. Biol. Chem. 2001; 276: 12999-13006Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). Point mutations in the basic domain of GPVI were generated using sequential, overlapping oligonucleotide linkers to replace the region between the BspE1 site (nucleotide 812 of coding sequence) and the STOP codon of FLAG-tagged human GPVI. This was accomplished with the following 5 overlapping oligonucleotides (S, sense oligonucleotide; AS, antisense oligonucleotide; all shown 5′-3′) to generate wild-type and RK mutant receptors: S1, GTCCGGATATGCCTAGGGGCTGTGATCCTAATAATCCTGGCGGGGTTTCTGGCAGAGGAC; AS2, CCCCTGTGCCGCAATCTTTTCCTCCGGCTGTGCCAGTCCTCTGCCAGAAACCC; S3, AGATTGCGGCACAGGGGGCGCGCCGTGCAGAGGCCGCTTCCGCCCCTGCCGCCCCTC; AS4, ACCCCCATGGGATTTCCGGGTCTGCGGGAGGGGCGGCAGGGGCG; S5, CGGAAATCCCATGGGGGTCAGGATGGAGGCCGACAGGATGTTCACAG CCGCGGG; AS2-RK1, CCCCTGTGCCGCAACGCAGCGGCTGCGCTGTGCCAGTCCTCTGCCAGAAACCC; AS2-RK2, CCAGCGTGTGCCAATCTTTTCCTCCGGCTGTGCCAGTCCTCTGCCAGAAACCC; S3-RK2, AGATTGGCACACGCTGGGG- CCGCCGTGCAGAGGCCGCTTCCGCCCCTGCCGCCCCTC. Mutant C-tails were constructed by annealing the 5 oligonucleotides simultaneously followed by ligation and cloning into theBspE1-NotI site of the original FLAG-tagged human GPVI (14Zheng Y.M. Liu C. Chen H. Locke D. Ryan J.C. Kahn M.L. J. Biol. Chem. 2001; 276: 12999-13006Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). GPVI receptor amino acids reported correspond to the sequence predicted by the open reading frame of GenBankTMaccession number AB035073 starting at nucleotide number 13. All GPVI mutations were expressed in pcDNA3.0 (Invitrogen). RBL-2H3 cells were electroporated and stable cell lines generated as previously described (16Chen H. Locke D. Liu Y. Liu C. Kahn M.L. J. Biol. Chem. 2002; 277: 3011-3019Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar). Surface expression of the mutant receptors was determined using flow cytometry with FITC-conjugated anti-FLAG (M2, Sigma) antibody. Human FLAG-tagged GPVI was purified from GPVI-expressing RBL 2H3 cells using the general method of Clemetson et al.(21Clemetson J.M. Polgar J. Magnenat E. Wells T.N. Clemetson K.J. J. Biol. Chem. 1999; 274: 29019-29024Abstract Full Text Full Text PDF PubMed Scopus (366) Google Scholar), with minor changes. Cells were lysed in an equal volume of 20 mm Tris, pH 7.4, 200 mm NaCl and 4% nonanoylN-methylglucamide (MEGA-9, Dojindo Molecular Technologies Inc, Gaithersburg, MD) containing protease inhibitors added from 100× final concentration (Sigma, mammalian protease inhibitor). Detergent-insoluble cellular debris was pelleted at 10,000 ×gav for 15 min, and 20% v/v convulxin (CVX)-Sepharose beads or HY101-conjugated beads used to precipitate GPVI from the supernatant in an overnight incubation. CVX is a C-lectin type snake venom derived from the South American rattlesnakeC. durissus terrificus that binds GPVI with high affinity and activates GPVI signaling (22Polgar J. Clemetson J.M. Kehrel B.E. Wiedemann M. Magnenat E.M. Wells T.N.C. Clemetson K.J. J. Biol. Chem. 1997; 272: 13576-13583Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar). The beads were loaded into a disposable 0.7 × 10-cm column and washed with 2% nonanoylN-methylglucamide buffer containing high (300 mm) and low (100 mm) salt to remove proteins associated with GPVI or CVX through ionic interaction. GPVI was eluted from CVX beads using a solution of 0.10% w/v SurfectAmps SDS (Pierce-Endogen), 10 mm Tris-HCl, pH 7.4. Aliquots of the elution fractions were checked for protein by gold staining and for GPVI using HY101 and/or anti-FLAG. Selected fractions were concentrated (Amicon 30; Amicon, Beverly, MA) for electrophoresis (8% gel, non-reducing conditions). Preparative recovery of GPVI was achieved using a model 422 electroeluter according to the manufacturer's instructions (Bio-Rad, Hercules, CA). The purified protein was lyophilized, weighed, and re-hydrated in 10 mm Tris, pH 7.4, 100 mm NaCl, pH 7.4, 0.1% nonanoylN-methylglucamide. For gold staining membranes were washed 3× for 10 min in phosphate-buffered saline, 0.5% Tween and then developed using membragold (Bioworld, Dublin, OH) Emission spectra were obtained at 25 °C using a Varian Cary Eclipse Fluorescence spectrophotometer with well-plate attachment (Varian, Walnut Creek, CA). Measurements were taken at an excitation wavelength of 295 nm (5-nm slit) and with scanning emission (1.5-nm slit) under various experimental conditions. Buffer conditions were kept constant at 10 mm Tris-HCl, 100 mm NaCl, pH 7.4, and 0.1% nonanoylN-methylglucamide. For all assays 10 μmpurified GPVI was incubated with increasing concentrations of bovine brain calmodulin (Molecular Probes, Eugene, OR) as outlined in the text. Magnesium, calcium, or EDTA was added to their final concentrations from stock. The final volume was kept constant at 200 μl. Each data point was determined by two individual measurements and was plotted as the fraction of a maximum emission shift. Data were transformed from fluorescence titration experiments and values calculated by linear regression (SigmaPlot 2002). Determination ofKD for the association was obtained from transforming Equation 1,KD=(1−f)([calmodulin]−f[6PVI])/fEq. 1 into Equation 2,log(f/1−f)=log([calmodulin]−f[6PVI])−logKDEq. 2 where f is the fraction of the maximal emission change and [X] is the protein concentration. Data were fit using a one and two site Hill plot for the determination of the dissociation constant (KD) and coefficient of binding (slope). The two-site model was more appropriate for the data as judged by the fitting coefficients and the residuals between the experimental and expected values. Adherent cells were detached from culture plates using 5 mm EDTA and resuspended in RHB medium (RPMI 1640 medium containing 25 mm HEPES and 1 mg/ml bovine serum albumin) at 2 × 107 cells/ml. Fura-2/AM (Molecular Probes, Inc.) was added to 4 μg/ml, and cells were incubated at 37 °C for 30 min. Excess Fura-2/AM was removed by washing in RHB medium. Fluorescence was measured using an Aminco-Bowman Series-2 luminescence spectrometer (SLM-Aminco, Urbana, IL). Fluorescence was measured at 340 and 380 nm for excitation and at 510 nm for emission. Cells (2 × 106) were stirred continuously during the fluorescence recording. The data were recorded as the relative ratio of fluorescence excited at 340/380 nm and the concentration of mobilized calcium using a dissociation constant of 224 nmol/liter for Fura-2/Ca2+. RBL-2H3 cells were lysed for 2 h at 4 °C in ice-cold lysis buffer (1% w/v digitonin (Calbiochem), 0.12% v/v SurfectAmps Triton X-100 (Pierce-Endogen), 150 mm NaCl, 0.01% w/v sodium azide, 20 mm triethanolamine, pH 7.8). Detergent-insoluble cellular debris was pelleted at 10,000 ×gav for 15 min, and CVX-Sepharose beads were used to immunoprecipitate GPVI and associated proteins from the supernatant in another 2-h incubation period. For live cell immunoprecipitations, HY101 was used to saturate the extracellular domain of GPVI prior to lysis and recovered from cell lysate using protein A-protein G beads (Amersham Biosciences). Of note, binding of HY101 to GPVI is non-activating and does not compete with or block subsequent CVX binding to the receptor (16Chen H. Locke D. Liu Y. Liu C. Kahn M.L. J. Biol. Chem. 2002; 277: 3011-3019Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar). Beads were pelleted by centrifugation and washed three times in ice-cold washing buffer (50 mm Tris, 150 mm NaCl, pH 8.0, 5 mmCHAPS). Finally, beads were heated to 100 °C in an equal volume of 2× Laemmli sample buffer (1 m Tris-HCl, pH 6.8, 0.2m dithiothreitol, 4% w/v SDS, 0.004% bromphenol blue, 20% glycerol), and run on 5–20% v/v gradient SDS-polyacrylamide gels using a standard electrophoresis buffer (25 mm Tris-HCl, 0.25 m glycine, and 0.1% w/v SDS). A crude membrane pellet was obtained from RBL 2H3 GPVI cells by Dounce homogenization (∼30 times on ice) in 10 mm Tris-HCl, pH 7.4, 1 mmEGTA, containing protease inhibitors. The homogenate was centrifuged at 1500 × gav for 10 min at 4 °C and the supernatant stored on ice. The pellet was resuspended in half the original volume of homogenization buffer supplemented with 5 mm magnesium chloride, pH 8.0 and disrupted by Dounce homogenization. The homogenate was centrifuged at 1500 ×gav for 10 min at 4 °C. The pooled supernatants were centrifuged at 109,000 ×gav for 1 h at 4 °C. The supernatant was discarded and the pellet resuspended to a protein concentration of ∼10 mg/ml in 250 mm sucrose, 50 mm potassium chloride, 0.1 mm calcium chloride, 20 mmMOPS-Tris, pH 7.2. Affinity chromatography of cell membrane lysates on calmodulin-Sepharose (Amersham Biosciences) was performed using a method described by Klaerke et al. (23Klaerke D.A. Rojkjaer R. Christensen L. Schousboe I. Biochim. Biophys. Acta. 1997; 1339: 203-216Crossref PubMed Scopus (20) Google Scholar). CHAPS was added to the crude membrane preparation from a 0.5 m stock to a detergent protein ratio of 5:1 (w/w). After 60 min the unsolubilized protein was removed by centrifugation. Sepharose-calmodulin beads, which had been equilibrated with 50 mm HEPES pH 7.4, 1 μm magnesium chloride, 1 mm dithiothreitol, 10 mm CHAPS, were added to the supernatent to 30% (v/v). Beads-lysate were supplemented with 1 mm calcium chloride and incubated at 30 °C for 120 min. The beads were loaded into a disposable 0.7 × 10-cm column, washed in 10 mm CHAPS buffer containing calcium and 200 mm sodium chloride, and proteins eluted from the beads by 10 mm EDTA. Elution fractions were analyzed for GPVI by Western blotting. A theoretical calmodulin-binding region in GPVI was identified by screening for a basic amphipathic sequence between the transmembrane and cytoplasmic receptor domains. A 14 amino acid sequence between amino acids Trp-292 and Val-306 shares homology to classical calmodulin-binding motifs and to the recently identified calmodulin-binding site on glycoprotein Ibβ (GPIbβ, Fig.1). As for GPIbβ, helical wheel projection of the membrane-proximal region of the GPVI C-tail suggested that these charged residues might be arranged along a single face of a helix in a manner similar to that recently reported for GPIbβ (Fig. 1and Ref. 24Andrews R.K. Munday A.D. Mitchell C.A. Berndt M.C. Blood. 2001; 98: 681-687Crossref PubMed Scopus (98) Google Scholar). Previous studies using purified peptides corresponding to this region of GPVI (His-293–Pro-311, amino acid numbering from the start methionine of the immature protein) have also suggested that GPVI may interact with bovine calmodulin, an observation confirmed by co-immunoprecipitation of these two proteins (20Andrews R.K. Suzuki-Inoue K. Shen Y. Tulasne D. Watson S.P. Berndt M.C. Blood. 2002; 99: 4219-4221Crossref PubMed Scopus (79) Google Scholar). To more precisely define the interaction between GPVI and calmodulin we measured the intrinsic tryptophan fluorescence of GPVI before and after addition of calmodulin. Because calmodulin has no tryptophan residues, this technique provides information about the environment surrounding tryptophan residues of calmodulin-binding proteins. Affinity chromatography of GPVI-expressing RBL-2H3 cell lysates on CVX-Sepharose yielded a major protein component identified by Western blotting as GPVI, migrating at 66 kDa under reducing conditions (Fig.2a). Minor protein components were removed by extensive salt washing and were further eliminated by non-denaturing preparative PAGE (data not shown). Purified GPVI had an emission peak at 352 nm after excitation of tryptophan at 295 nm. Calmodulin titrations were performed in the presence of calcium, magnesium, and/or EDTA. In the presence of calcium, addition of bovine calmodulin to purified GPVI resulted in a decrease on the emission maxima (a “blue shift”) to 344 nm that did not occur in the presence of EDTA or when magnesium was present in place of calcium (Fig. 2b and data not shown). Titration experiments (Fig. 2,c and d) revealed approximately molar saturation between the two proteins and a high affinity interaction between GPVI and calmodulin (KD of 35 nm). Thus calmodulin interacts with GPVI in living cells in a high affinity and specific manner. The basic amino acids within the GPVI intracellular domain are predicted to form the calmodulin-binding site if arranged in the shape of an α-helix (Fig.1). To directly test the role of these amino acids for calmodulin binding and for signal transduction by GPVI we generated GPVI mutants in which: (i) the four amino-terminal basic residues were mutated to alanines (GPVI RK1), (ii) the four carboxyl-terminal basic residues were mutated to alanines (GPVI RK2), and (iii) all eight basic amino acids were mutated to alanines (GPVI RK1/2). Significantly, all mutations of this domain were made in the context of the full-length receptor rather than in cognate peptides or through receptor truncation. Mutant receptors were expressed stably at roughly equivalent levels in RBL-2H3 cells and co-immunoprecipitation studies used to identify the residues critical for interaction with calmodulin in live cells. Mutation of either the amino-terminal or carboxyl-terminal basic amino acids alone (GPVI RK1 or GPVI RK2) did not interrupt calmodulin binding, but mutation of all eight basic amino acids (GPVI RK 1/2) abrogated the interaction of these two proteins (Fig. 3b). GPVI truncation mutants lacking residues carboxyl to these basic amino acids (A303STOP and T318STOP) or the transmembrane domain critical for Fc Rγ coupling (R272L) bound calmodulin normally, but a truncation mutant lacking the basic domain (R295STOP) did not. These results demonstrate that the basic amino acids between Trp-292 and Val-306 in the GPVI intracellular domain mediate calmodulin interaction and that calmodulin interaction is independent of either Fc Rγ or Lyn association (discussed further below). To determine the role played by calmodulin during GPVI signaling we analyzed calmodulin-GPVI interaction before and after receptor stimulation with CVX, a high affinity GPVI ligand that activates strong calcium signaling in GPVI-expressing but not wild-type RBL-2H3 cells (14Zheng Y.M. Liu C. Chen H. Locke D. Ryan J.C. Kahn M.L. J. Biol. Chem. 2001; 276: 12999-13006Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). In resting cells, calmodulin could be co-immunoprecipitated with GPVI (Fig. 3, b and d). Following stimulation of GPVI with CVX, however, calmodulin was released from GPVI within 30–60 s (Fig. 3, b and c). As seen in Fig.3b, calmodulin could be easily co-immunoprecipitated with GPVI from resting cell lysate when using HY101, a non-clustering anti-GPVI antibody (16Chen H. Locke D. Liu Y. Liu C. Kahn M.L. J. Biol. Chem. 2002; 277: 3011-3019Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar). When GPVI was precipitated using the clustering ligand CVX, however, very little calmodulin was co-precipitated. These results suggest that calmodulin associates with GPVI in resting cells and calmodulin-GPVI interaction is regulated by receptor-ligand interaction in a manner that may be independent of downstream GPVI signaling. Although the interaction of calmodulin with several platelet receptors has recently been identified, the role of calmodulin during signal transduction by platelet receptors remains unknown. To detect a role for calmodulin in GPVI signal transduction we examined the calcium signals stimulated by the high affinity GPVI ligand CVX in cells expressing wild-type GPVI (hGPVI), GPVI lacking one-half the basic residues of the calmodulin-binding domain (GPVI RK1 and GPVI RK2) and GPVI lacking all basic residues in the calmodulin-binding domain and unable to bind calmodulin (GPVI RK1/2). As previously observed, expression of GPVI in RBL-2H3 cells conferred robust calcium signaling in response to CVX (Fig. 4 and Ref. 14Zheng Y.M. Liu C. Chen H. Locke D. Ryan J.C. Kahn M.L. J. Biol. Chem. 2001; 276: 12999-13006Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). GPVI receptors lacking only half the basic residues of the calmodulin-binding domain but still able to bind calmodulin demonstrated wild-type calcium responses to CVX with the exception of a lag in the time required to initiate calcium signaling for the GPVI RK2 mutant receptor (Fig. 4). GPVI receptors unable to bind calmodulin, however, demonstrated severely reduced calcium responses to CVX despite a receptor surface expression equivalent to that of wild-type GPVI (Fig.4). These results suggest that the GPVI receptor domain required for interaction of calmodulin with GPVI is also required for normal receptor signaling. Previous studies have revealed an unexpected role for the intracellular GPVI C-tail in mediating association of GPVI with Fc Rγ (14Zheng Y.M. Liu C. Chen H. Locke D. Ryan J.C. Kahn M.L. J. Biol. Chem. 2001; 276: 12999-13006Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar, 15Berlanga O. Tulasne D. Bori T. Snell D.C. Miura Y. Jung S. Moroi M. Frampton J. Watson S.P. Eur. J. Biochem. 2002; 269: 2951-2960Crossref PubMed Scopus (51) Google Scholar), raising the possibility that the loss of signaling observed in GPVI RK1/2-expressing RBL-2H3 cells might be caused by loss of Fc Rγ association rather than loss of a specific function mediated by the calmodulin-binding domain of GPVI. To test this possibility we performed co-immunoprecipitation assays to compare the ability of wild-type GPVI (WT GPVI) and the GPVI RK mutants to associate with Fc Rγ in RBL-2H3 cells. As expected, Fc Rγ co-precipitated with wild-type GPVI but not with the GPVI R272L mutant in which a transmembrane arginine critical for Fc Rγ association is mutated (Fig. 5). Significantly, Fc Rγ was also co-precipitated with all the RK mutants, including the GPVI receptor lacking all of the basic amino acids (GPVI RK1/2) required for calmodulin interaction. Similarly co-immunoprecipitation studies also demonstrated preserved interaction with the Src family kinase Lyn (Fig.5). These results suggest that the loss of GPVI signaling associated with loss of the calmodulin-binding domain is not merely the result of loss of Fc Rγ or Lyn association and that interaction with calmodulin or an unidentified protein may" @default.
• W2050881658 created "2016-06-24" @default.
• W2050881658 creator A5024037670 @default.
• W2050881658 creator A5026982666 @default.
• W2050881658 creator A5045474515 @default.
• W2050881658 creator A5064530138 @default.
• W2050881658 creator A5068260072 @default.
• W2050881658 date "2003-04-01" @default.
• W2050881658 modified "2023-09-26" @default.
• W2050881658 title "Fc Rγ-independent Signaling by the Platelet Collagen Receptor Glycoprotein VI" @default.
• W2050881658 cites W1526116399 @default.
• W2050881658 cites W1539756723 @default.
• W2050881658 cites W1624531078 @default.
• W2050881658 cites W1827533136 @default.
• W2050881658 cites W1965112825 @default.
• W2050881658 cites W1970573661 @default.
• W2050881658 cites W1971349333 @default.
• W2050881658 cites W1972108403 @default.
• W2050881658 cites W1974703721 @default.
• W2050881658 cites W1998117461 @default.
• W2050881658 cites W2021156311 @default.
• W2050881658 cites W2022316473 @default.
• W2050881658 cites W2025827931 @default.
• W2050881658 cites W2029004784 @default.
• W2050881658 cites W2041326156 @default.
• W2050881658 cites W2043823402 @default.
• W2050881658 cites W2057372364 @default.
• W2050881658 cites W2063587792 @default.
• W2050881658 cites W2064154619 @default.
• W2050881658 cites W2066826486 @default.
• W2050881658 cites W2073966706 @default.
• W2050881658 cites W2080644669 @default.
• W2050881658 cites W2118971976 @default.
• W2050881658 cites W2136847875 @default.
• W2050881658 cites W242818551 @default.
• W2050881658 cites W61691205 @default.
• W2050881658 doi "https://doi.org/10.1074/jbc.m212338200" @default.
• W2050881658 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12594225" @default.
• W2050881658 hasPublicationYear "2003" @default.
• W2050881658 type Work @default.
• W2050881658 sameAs 2050881658 @default.
• W2050881658 citedByCount "39" @default.
• W2050881658 countsByYear W20508816582012 @default.
• W2050881658 countsByYear W20508816582013 @default.
• W2050881658 countsByYear W20508816582018 @default.
• W2050881658 countsByYear W20508816582019 @default.
• W2050881658 countsByYear W20508816582023 @default.
• W2050881658 crossrefType "journal-article" @default.
• W2050881658 hasAuthorship W2050881658A5024037670 @default.
• W2050881658 hasAuthorship W2050881658A5026982666 @default.
• W2050881658 hasAuthorship W2050881658A5045474515 @default.
• W2050881658 hasAuthorship W2050881658A5064530138 @default.
• W2050881658 hasAuthorship W2050881658A5068260072 @default.
• W2050881658 hasBestOaLocation W20508816581 @default.
• W2050881658 hasConcept C108625454 @default.
• W2050881658 hasConcept C119524353 @default.
• W2050881658 hasConcept C170493617 @default.
• W2050881658 hasConcept C185592680 @default.
• W2050881658 hasConcept C195687474 @default.
• W2050881658 hasConcept C203014093 @default.
• W2050881658 hasConcept C26828662 @default.
• W2050881658 hasConcept C55493867 @default.
• W2050881658 hasConcept C86803240 @default.
• W2050881658 hasConcept C89560881 @default.
• W2050881658 hasConcept C95444343 @default.
• W2050881658 hasConceptScore W2050881658C108625454 @default.
• W2050881658 hasConceptScore W2050881658C119524353 @default.
• W2050881658 hasConceptScore W2050881658C170493617 @default.
• W2050881658 hasConceptScore W2050881658C185592680 @default.
• W2050881658 hasConceptScore W2050881658C195687474 @default.
• W2050881658 hasConceptScore W2050881658C203014093 @default.
• W2050881658 hasConceptScore W2050881658C26828662 @default.
• W2050881658 hasConceptScore W2050881658C55493867 @default.
• W2050881658 hasConceptScore W2050881658C86803240 @default.
• W2050881658 hasConceptScore W2050881658C89560881 @default.
• W2050881658 hasConceptScore W2050881658C95444343 @default.
• W2050881658 hasIssue "17" @default.
• W2050881658 hasLocation W20508816581 @default.
• W2050881658 hasOpenAccess W2050881658 @default.
• W2050881658 hasPrimaryLocation W20508816581 @default.
• W2050881658 hasRelatedWork W1825988241 @default.
• W2050881658 hasRelatedWork W1991760539 @default.
• W2050881658 hasRelatedWork W2054029627 @default.
• W2050881658 hasRelatedWork W2057372364 @default.
• W2050881658 hasRelatedWork W2075059983 @default.
• W2050881658 hasRelatedWork W2160689691 @default.
• W2050881658 hasRelatedWork W2887412459 @default.
• W2050881658 hasRelatedWork W2949767406 @default.
• W2050881658 hasRelatedWork W2997627044 @default.
• W2050881658 hasRelatedWork W3015148478 @default.
• W2050881658 hasVolume "278" @default.
• W2050881658 isParatext "false" @default.
• W2050881658 isRetracted "false" @default.
• W2050881658 magId "2050881658" @default.
• W2050881658 workType "article" @default.