FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2051235227> ?p ?o ?g. }

• W2051235227 endingPage "146" @default.
• W2051235227 startingPage "139" @default.
• W2051235227 abstract "Several species of streptococci produce extracellular polysaccharides in the form of secreted exopolysaccharides or cell-associated capsules. Although the biological properties and repeating unit structures of these polysaccharides are diverse, sequence analysis of the genes required for their production has revealed a surprising degree of conservation among five genes found in the capsule gene cluster of each of several polysaccharide-producing streptococci. To determine the function of these conserved genes, we characterized a series of isogenic mutants derived from a wild-type strain of type Ia group B Streptococcus by selectively inactivating each gene. Inactivation of cpsIaE resulted in an acapsular phenotype, consistent with previous work that identified the cpsIaE product as the glycosyltransferase that initiates synthesis of the polysaccharide repeating unit. Mutants in cpsIaA, cpsIaB, cpsIaC, or cpsIaD produced type Ia capsular polysaccharide, but in reduced amounts compared with the wild type. Analysis of the mutant polysaccharides and of capsule gene transcription in the mutant strains provided evidence that cpsIaA encodes a transcriptional activator that regulates expression of the capsule gene operon. Mutants in cpsIaC or cpsIaD produced polysaccharide of reduced molecular size but with an identical repeating unit structure as the wild-type strain. We conclude that CpsA to -D are not required for polysaccharide repeating unit biosynthesis but rather that they direct the coordinated polymerization and export of high molecular weight polysaccharide. Several species of streptococci produce extracellular polysaccharides in the form of secreted exopolysaccharides or cell-associated capsules. Although the biological properties and repeating unit structures of these polysaccharides are diverse, sequence analysis of the genes required for their production has revealed a surprising degree of conservation among five genes found in the capsule gene cluster of each of several polysaccharide-producing streptococci. To determine the function of these conserved genes, we characterized a series of isogenic mutants derived from a wild-type strain of type Ia group B Streptococcus by selectively inactivating each gene. Inactivation of cpsIaE resulted in an acapsular phenotype, consistent with previous work that identified the cpsIaE product as the glycosyltransferase that initiates synthesis of the polysaccharide repeating unit. Mutants in cpsIaA, cpsIaB, cpsIaC, or cpsIaD produced type Ia capsular polysaccharide, but in reduced amounts compared with the wild type. Analysis of the mutant polysaccharides and of capsule gene transcription in the mutant strains provided evidence that cpsIaA encodes a transcriptional activator that regulates expression of the capsule gene operon. Mutants in cpsIaC or cpsIaD produced polysaccharide of reduced molecular size but with an identical repeating unit structure as the wild-type strain. We conclude that CpsA to -D are not required for polysaccharide repeating unit biosynthesis but rather that they direct the coordinated polymerization and export of high molecular weight polysaccharide. group B Streptococcus erythromycin enzyme-linked immunosorbent assay fast protein liquid chromatography phosphate-buffered saline polymerase chain reaction reverse transcriptase-PCR base pair(s) Several species of streptococci of medical and industrial importance produce extracellular polysaccharides in the form of secreted exopolysaccharides or as cell-associated polysaccharide capsules. For pathogenic streptococci such as Streptococcus pneumoniae and group B Streptococcus(Streptococcus agalactiae or GBS),1 the capsular polysaccharide is a major virulence factor as well as a target for protective immunity. Therefore, considerable attention has focused on characterization of the molecular basis for polysaccharide production. Beginning with the identification of the GBS type III capsule locus over a decade ago (1Rubens C.E. Wessels M.R. Heggen L.M. Kasper D.L. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 7208-7212Crossref PubMed Scopus (174) Google Scholar), rapid progress has been made in uncovering the genetic and biochemical basis for capsular polysaccharide expression in the streptococci. A common theme that has emerged among encapsulated Gram-negative bacteria is that the capsule locus consists of a region encoding polysaccharide-specific genes required for polysaccharide repeating unit biosynthesis flanked by groups of genes involved in broadly conserved functions such as transport and regulation (2Vimr E. Steenbergen S. Cieslewicz M. J. Ind. Microbiol. 1995; 15: 352-360Crossref PubMed Scopus (50) Google Scholar). Similarly, the capsule gene region of several polysaccharide-producing streptococci consists of a group of polysaccharide-specific genes encoding glycosyltransferases and polymerases as well as an adjacent group of genes that is conserved among several species (3Kolkman M.A.B. van der Zeijst B.A.M. Nuijten P.J.M. J. Biochem. (Tokyo). 1998; 123: 937-945Crossref PubMed Scopus (33) Google Scholar, 4Stingele F. Neeser J.-R. Mollet B. J. Bacteriol. 1996; 178: 1680-1690Crossref PubMed Google Scholar, 5Smith H.E. Damman M. Van Der Velde J. Wagenaar F. Wisselink H.J. Stockhofe-Zurwieden N. Smits M.A. Infect. Immun. 1999; 67: 1750-1756Crossref PubMed Google Scholar, 6Yamamoto S. Miyake K. Koike Y. Watanabe M. Machida Y. Ohta M. Iijima S. J. Bacteriol. 1999; 181: 5176-5184Crossref PubMed Google Scholar). The functions of these conserved genes are unproven, but they are thought to direct such common processes as repeating unit polymerization, transport, and regulation. For GBS, nine different capsule serotypes have been described, and the repeating unit structure of each has been determined (7Jennings H.J. Lugowski C. Kasper D.L. Biochemistry. 1981; 20: 4511-4518Crossref PubMed Scopus (82) Google Scholar, 8Jennings H.J. Katzenellenbogen E. Lugowski C. Kasper D.L. Biochemistry. 1983; 22: 1258-1264Crossref PubMed Scopus (66) Google Scholar, 9Jennings H.J. Curr. Top. Microbiol. Immunol. 1990; 150: 97-127PubMed Google Scholar, 10Kogan G. Brisson J.-R. Kasper D.L. von Hunolstein C. Orefici G. Jennings H.J. Carbohydr. Res. 1995; 277: 1-9Crossref PubMed Scopus (45) Google Scholar, 11Kogan G. Uhrı́n D. Brisson J.-R. Paoletti L.C. Blodgett A.E. Kasper D.L. Jennings H.J. J. Biol. Chem. 1996; 271: 8786-8790Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar, 12Di Fabio J.L. Michon F. Brisson J.-R. Jennings H.J. Can. J. Chem. 1989; 67: 877-882Crossref Google Scholar, 13von Hunolstein C. Ascenzi S.D. Wagner B. Jelinkova J. Alfarone G. Recchia S. Wagner M. Orefici G. Infect. Immun. 1993; 61: 1272-1280Crossref PubMed Google Scholar, 14Wessels M.R. Pozsgay V. Kasper D.L. Jennings H.J. J. Biol. Chem. 1987; 262: 8262-8267Abstract Full Text PDF PubMed Google Scholar, 15Wessels M.R. DiFabio J.L. Benedı́ V.-J. Kasper D.L. Michon F. Brisson J.-R. Jelinkova J. Jennings H.J. J. Biol. Chem. 1991; 266: 6714-6719Abstract Full Text PDF PubMed Google Scholar). The type Ia polysaccharide has a linear backbone made up of disaccharide repeat units of →4)-β-d-Glc p-(1→4)-β-d-Gal p-(1→ with a trisaccharide side chain of α-d-Neu pNAc-(2→3)-β-d-Gal p-(1→4)-β-d-Glc pNAc-(1→ linked to C3 of each β-d-galactose residue of the backbone (8Jennings H.J. Katzenellenbogen E. Lugowski C. Kasper D.L. Biochemistry. 1983; 22: 1258-1264Crossref PubMed Scopus (66) Google Scholar). The genetic locus for the synthesis of the type Ia GBS capsule includes at least 16 open reading frames and is predicted to contain two promoters (6Yamamoto S. Miyake K. Koike Y. Watanabe M. Machida Y. Ohta M. Iijima S. J. Bacteriol. 1999; 181: 5176-5184Crossref PubMed Google Scholar). One promoter region is upstream of the first gene, cpsIaA (Fig. 1) (6Yamamoto S. Miyake K. Koike Y. Watanabe M. Machida Y. Ohta M. Iijima S. J. Bacteriol. 1999; 181: 5176-5184Crossref PubMed Google Scholar). RT-PCR and primer extension analysis suggested that a second promoter lies between cpsIaD and cpsIaE (Fig. 1) (6Yamamoto S. Miyake K. Koike Y. Watanabe M. Machida Y. Ohta M. Iijima S. J. Bacteriol. 1999; 181: 5176-5184Crossref PubMed Google Scholar). On the basis of DNA sequence analysis and enzymatic assays of gene products in E. coli, functions have been assigned to many of the genes in the cluster. cpsIaE, cpsIaG, cpsIaI, and cpsIaJ appear to encode all of the specific glycosyltransferases required for biosynthesis of the type Ia polysaccharide repeating unit with the exception of the sialyltransferase, which has not yet been identified (6Yamamoto S. Miyake K. Koike Y. Watanabe M. Machida Y. Ohta M. Iijima S. J. Bacteriol. 1999; 181: 5176-5184Crossref PubMed Google Scholar).cpsIaE encodes the glycosyltransferase thought to initiate biosynthesis of the polysaccharide repeating unit. neuA to -D encode enzymes involved in sialic acid synthesis and activation (6Yamamoto S. Miyake K. Koike Y. Watanabe M. Machida Y. Ohta M. Iijima S. J. Bacteriol. 1999; 181: 5176-5184Crossref PubMed Google Scholar). Upstream of cpsIaE are cpsIaA to cpsIaD, genes that, together with cpsE, are well conserved among the GBS capsule serotypes and among other polysaccharide-producing streptococci such as S. thermophilus, S. pneumoniae, and S. suis(Fig. 1), (4Stingele F. Neeser J.-R. Mollet B. J. Bacteriol. 1996; 178: 1680-1690Crossref PubMed Google Scholar, 6Yamamoto S. Miyake K. Koike Y. Watanabe M. Machida Y. Ohta M. Iijima S. J. Bacteriol. 1999; 181: 5176-5184Crossref PubMed Google Scholar, 16Guidolin A. Morona J.K. Morona R. Hansman D. Paton J.C. Infect. Immun. 1994; 62: 5384-5396Crossref PubMed Google Scholar, 17Garcia E. Garcia P. Lopez R. Mol. Gen. Genet. 1993; 239: 188-195Crossref PubMed Scopus (35) Google Scholar). Homologs of some of these genes are found also in the polysaccharide synthesis gene clusters of other Gram-positive bacteria including Lactococcus lactis and Staphylococcus aureus (18Sau S. Bhasin N. Wann E.R. Lee J.C. Foster T.J. Lee C.Y. Microbiology. 1997; 143: 2395-2405Crossref PubMed Scopus (126) Google Scholar, 19van Kranenburg R. Marugg J.D. van Swam I.I. Willem N.J. de Vos W.M. Mol. Microbiol. 1997; 24: 387-397Crossref PubMed Scopus (231) Google Scholar). Tentative functions have been suggested for cpsA to -D on the basis of sequence similarity to genes in other species. A homolog of the gene product encoded by cpsA, LytR, appears to regulate transcription of the structural genes of the N-acetylmuramoyl-l-alanine amidase operon of Bacillus subtilis (20Lazarevic V. Margot P. Soldo B. Karamata D. J. Gen. Microbiol. 1992; 138: 1946-1961Crossref Scopus (174) Google Scholar). Proteins encoded by homologs of cpsC and cpsD have been implicated in chain length regulation of exopolysaccharide production in R. meliloti and lipopolysaccharide biosynthesis in Escherichia coli (21Batchelor R.A. Haraguchi G.E. Hull R.A. Hull S.I. J. Bacteriol. 1991; 173: 5699-5704Crossref PubMed Scopus (68) Google Scholar, 22Becker A. Niehaus K. Puhler A. Mol. Microbiol. 1995; 16: 191-203Crossref PubMed Scopus (91) Google Scholar). A recent report by Morona et al. (23Morona J.D. Paton J.C. Miller D.C. Morona R. Mol. Microbiol. 2000; 35: 1431-1442Crossref PubMed Scopus (176) Google Scholar) provided the first experimental evidence for the function of these four conserved genes in polysaccharide-producing streptococci. Nonpolar deletion mutations in any of the four genes reduced capsule production by S. pneumoniae type 19f (23Morona J.D. Paton J.C. Miller D.C. Morona R. Mol. Microbiol. 2000; 35: 1431-1442Crossref PubMed Scopus (176) Google Scholar). CpsD was shown to be an autophosphorylating protein-tyrosine kinase, similar to Wzc in E. coli, whose phosphorylation state influences polysaccharide production (23Morona J.D. Paton J.C. Miller D.C. Morona R. Mol. Microbiol. 2000; 35: 1431-1442Crossref PubMed Scopus (176) Google Scholar). CpsC and -B appeared to influence phosphorylation and dephosphorylation, respectively, of CpsD (23Morona J.D. Paton J.C. Miller D.C. Morona R. Mol. Microbiol. 2000; 35: 1431-1442Crossref PubMed Scopus (176) Google Scholar). In this report, we describe the construction and characterization of nonpolar deletion mutants in cpsIaA, cpsIaB,cpsIaC, cpsIaD, and cpsIaE in type Ia GBS. Analysis of the mutants and their purified capsular polysaccharides provided experimental evidence for the involvement of each gene in polysaccharide elongation, export, or regulation. In addition, our data specifically identify CpsIaA as an activator of capsule gene transcription and demonstrate that CpsIaC and CpsIaD both control polysaccharide chain length. Type Ia GBS strain 515 was used as the parent strain for all mutants constructed in this report (24Wessels M.R. Paoletti L.C. Rodewald A.K. Michon F. DiFabio J. Jennings H.J. Kasper D.L. Infect. Immun. 1993; 61: 4760-4766Crossref PubMed Google Scholar). GBS was grown in liquid culture in Todd-Hewitt broth (Difco) supplemented with yeast extract to 0.5% (w/v) (Todd-Hewitt-yeast), on trypticase soy agar supplemented with 5% sheep blood (Becton-Dickinson, Cockeysville, MD), or on Todd-Hewitt-yeast agar plates supplemented with antibiotics and 5% defibrinated sheep blood (PML Microbiologicals, Tulatin, OR). For continuous culture experiments, GBS was grown in a chemically defined medium as described (25Paoletti L.C. Ross R.A. Johnson K.D. J. Bacteriol. 1996; 64: 1220-1226Google Scholar) except that glycine was not added, NaOH was added at 0.4 g/liter, and 7 g/liter of Casitone (Difco) was substituted for the amino acid mix. E. coli strain DH5α MCR (Life Technologies, Inc.) was used for cloning and was grown in Luria-Bertani medium or on Luria-Bertani agar. When appropriate, the medium was supplemented with ampicillin at 100 μg/ml or with erythromycin (erm) at 1 μg/ml for GBS or 250 μg/ml for E. coli. GBS was grown either without shaking in liquid culture or in continuous culture as described previously (25Paoletti L.C. Ross R.A. Johnson K.D. J. Bacteriol. 1996; 64: 1220-1226Google Scholar). E. coli was grown with shaking at 37 °C. Plasmid pGEM-T (Promega, Madison, WI) is an E. coli vector used for the direct cloning of PCR products; pJRS233 is a temperature-sensitive E. coli/Gram-positive shuttle vector (26Perez-Casal J. Price J.A. Maguin E. Scott J.R. Mol. Microbiol. 1993; 8: 809-819Crossref PubMed Scopus (186) Google Scholar). pWKS30 is a low copy number cloning vector encoding ampicillin resistance (27Wang R.F. Kushner S.R. Gene (Amst.). 1991; 100: 195-199Crossref PubMed Scopus (991) Google Scholar). Plasmid DNA was isolated using either the Qiagen midiprep or miniprep kit (Qiagen, Valencia, CA) according to the manufacturer's recommendations. GBS chromosomal DNA was prepared as described (28O'Connor S.P. Cleary P.P. J. Infect. Dis. 1987; 156: 495-504Crossref PubMed Scopus (46) Google Scholar). Restriction endonuclease digestions, DNA ligations, transformation of CaCl2-competent E. coli, agarose gel electrophoresis, and Southern hybridizations (ECL; Amersham Pharmacia Biotech) were performed using standard techniques (29Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). GBS electrocompetent cells were prepared as described (30Caparon M.G. Scott J.R. Methods Enzymol. 1991; 204: 556-586Crossref PubMed Scopus (178) Google Scholar) and transformed by electroporation using a Bio-Rad Gene Pulser II (Bio-Rad) as described (31Albertı́ S. Ashbaugh C.D. Wessels M.R. Mol. Microbiol. 1998; 28: 343-353Crossref PubMed Scopus (42) Google Scholar). For cpsIaA deletion construction, primers 275 and 276 (TableI) were used to amplify by PCR the first 126 bp of cpsIaA and 736 bp of adjacent upstream flanking sequence using GBS strain 515 chromosomal DNA as template. Primers 267 and 277 (Table I) were used to amplify the last 104 bp of cpsIaA and 1535 bp of downstream flanking DNA. Primer 277 contains 18 bp of DNA that is complementary to the sequence in primer 276. The two gel-purified PCR products containing complementary ends were mixed and amplified with primers 275 and 267 to create a 1100-bp internal deletion of cpsIaA by overlap PCR (32Ho S.N. Hunt H.D. Horton R.M. Pullen J.D. Pease L.R. Gene (Amst.). 1989; 77: 51-59Crossref PubMed Scopus (6771) Google Scholar, 33Horton R.M. Hunt H.D. Ho S.N. Pullen J.D. Pease L.R. Gene (Amst.). 1989; 77: 61-68Crossref PubMed Scopus (2614) Google Scholar). The resultant 2500-bp PCR fragment was digested with HindIII and ligated into HindIII-digested pJRS233.Table IOligonucleotides used in this studyNameSequence1-aDNA sequences were derived from type Ia GBS capsule gene cluster (accession number AB028896). Where indicated, additional nucleotides were added to the 5′ terminus to create restriction endonuclease sites. Underlined sequences are complementary to noncontiguous sequence and were used to introduce internal deletions by overlap PCR.Description1-aDNA sequences were derived from type Ia GBS capsule gene cluster (accession number AB028896). Where indicated, additional nucleotides were added to the 5′ terminus to create restriction endonuclease sites. Underlined sequences are complementary to noncontiguous sequence and were used to introduce internal deletions by overlap PCR./Orientation1-bF, forward (coding strand); R, reverse (noncoding strand).5′-Terminal restriction endonuclease site119TTGATGCGGATACTAGG708 bp upstream of cpsE start/FNone121AAGTGTGCTAGATGACC1245 bp downstream of cpsEstart/RNone190CCCCGAATTCAATGTTAATGTAGAGGCAC28 bp downstream of cpsE start/FEcoRI191CCCCAAGCTTACCTTTACTTAGCTCCTG1182 bp downstream of cpsE start/RHindIII252GGAAGGATCCCGACATCACATAGAAGAAAAGGTATG625 bp upstream of cpsC start/FBamHI253GGATGGTACCCTTTGTTCCATCTGTTCTTTTGC1267 bp downstream of cpsC start/RKpnI254GGAAGGATCCACATTTGTTGCCATTGCATTTGC622 bp upstream of cpsD start/FBamHI257GGATGGTACCCTTAGCGTAAGAATATTTCG1072 bp downstream of cpsD start/RKpnI267GGCCCTGCAGGGATTTTCCTTCCCCTTCCC3000 bp downstream of cpsA start/RPstI273GCTAAACTTGTTGAAGTAGTGGATTTTCCTTCCCCTTCCC130 bp downstream f cpsD start/RNone274ACTACTTCAACAAGTTTAGCGCAAAAGAACAGATGGAACAAAG565 bp downstream of cpsD start/FNone275CCTTAAGCTTGGGATTGGATTTGCTC736 bp upstream of cspA start/FHindIII276ATGGTGACGATACATAAG111 bp downstream of cpsAstart/RNone277CTTATGTATCGTCACCATGAGTCACAAGCATTAAC1300 bp downstream of cpsA start/FNone280GAAACAATTATTCTAACACCTTGTCG115 bp downstream of cpsB start/RNone284CGACAAGGTGTTAGAATAATTGTTTCGATTATCTGTAGAGATTTCGG544 downstream of cpsB start/FNone314GGCCGGATCCCAGAAAAAGGAATCTCTATTAC997 bp upstream of cpsB start/FBamHI315GGCCCTGCAGGGTGGTAGATCTGCATTACC1734 bp downstream of cpsB start/RPstI333GCCCTTCATGCCGTAGCTCAA147 bp downstream of recA start/FNone334ACCAGTCCCCTTGATTTG617 bp downstream of recA start/RNone335GACTCGTTTAGAAATAG2 bp downstream of cpsDstart/FNone336CAATTAGAACAAACAATAAATC841 bp downstream of cpsD start/RNone1-a DNA sequences were derived from type Ia GBS capsule gene cluster (accession number AB028896). Where indicated, additional nucleotides were added to the 5′ terminus to create restriction endonuclease sites. Underlined sequences are complementary to noncontiguous sequence and were used to introduce internal deletions by overlap PCR.1-b F, forward (coding strand); R, reverse (noncoding strand). Open table in a new tab A deletion mutant in cpsIaB was constructed as above, except that primer pairs 280 and 314 (Table I) were used to amplify the 5′-terminal 100 and 900 bp of adjacent upstream flanking DNA. Primers 284–315 (Table I) were used to amplify the 3′-terminal 100 and 900 bp of downstream flanking DNA, with primer 284 containing 26 bp of DNA that is complementary to primer 280. The cpsIaBamplification products were used in an overlap PCR with primers 314 and 315 to introduce a 500-bp deletion of cpsIaB. The 2200-bp overlap PCR product was digested with BamHI and PstI and ligated into BamHI/PstI-digested pJRS233. To construct a cpsIaC deletion, primers 252 and 253 (TableI) were used to amplify a 1900-bp fragment containing the coding sequences for cpsIaC and 600 bp of upstream and downstream flanking DNA. The cpsIaC amplification product was ligated into pGEM-T, and an internal 200-bp fragment of cpsIaC was released by digesting with XbaI and EcoRV. The 5′ overhangs were filled in using the large fragment of DNA polymerase 1 (Klenow) to create blunt ends. The plasmid was then religated to create an internal cpsIaC deletion. The 1600-bp fragment containing the cpsIaC deletion and flanking sequences was released from pGEM-T by digestion with BamHI and KpnI and ligated into BamHI/KpnI-digested pJRS233. An internal deletion of cpsIaD was constructed as described for cpsIaA and cpsIaB except that primer pairs 254 and 273 and 257 and 274 (Table I) were used to amplify the flanking PCR products, and primers 254 and 257 were used for the overlap extension reaction. The overlap amplification product was digested with BamHI and KpnI and ligated into BamHI/KpnI-digested pJRS233. For construction of an internal deletion of cpsIaE, primers 119 and 121(Table I) were used to amplify a 1900-bp fragment containing the complete coding sequence of cpsIaE. The amplification product was digested with BglII and EcoRI to remove all but the first 100 bp of cpsE and 600 bp of upstream flanking DNA. This fragment was ligated into BamHI/EcoRI-digested pWKS30 to produce pWKS30-cpsIaE containing a BamHI site at the 5′-end of the insert and an EcoRI site at the 3′-end of the insert. Primers 190 and 191 (Table I) were used to amplify a 670-bp fragment containing the last 570 bp of cpsIaE and 100 bp of downstream flanking DNA. The amplification product of the 3′-end of cpsIaE was digested with EcoRI and HindIII and ligated into EcoRI/HindIII-digested pWKS30-cpsIaEto create a 360-bp internal deletion of cpsIaE. The fragment including the cpsIaE deletion and flanking DNA was released from pWKS30-cpsIaEΔ by digestion with HindIII and XbaI and was ligated into HindIII/XbaI-digested pJRS233. Each of the cps deletion constructs in the temperature-sensitive shuttle vector pJRS233 was introduced into GBS strain 515 by electroporation, and transformants were selected by growth at 30 °C in the presence of erm. A single erm-resistant colony was used to inoculate a liquid culture supplemented with erm. After overnight incubation at 30 °C, the culture was diluted 10-fold with fresh broth containing erm and incubated at 37 °C to select organisms in which the recombinant plasmid had integrated in the cps locus of the GBS chromosome by homologous recombination (Fig.2). Dilutions of each culture were plated on medium containing erm and incubated overnight; erm-resistant colonies representing plasmid integrants were serially passaged twice on solid medium at 37 °C. Integrant strains were serially passaged at least five times in broth at 30 °C in the absence of erm; excision of the plasmid from the chromosome via a second recombination event either completed the allelic exchange or reconstituted the wild-type genotype (Fig. 2). erm-sensitive colonies were screened for the expected deletion mutation by PCR amplification using primer pairs that flank the target gene. Candidate deletion mutants were characterized by Southern hybridization analysis of HindIII-digested chromosomal DNA probed with the target gene to confirm the expected internal deletion and with pJRS233 to confirm loss of plasmid sequences from the mutant strain. For immunoblot analysis to assess type Ia polysaccharide production by potential cps deletion mutants, bacterial colonies were lifted onto nitrocellulose filters (Schleicher and Schuell), fixed in 70% ethanol for 5 min, and blocked with 5% skim milk in PBS containing 0.5% Tween 20 (Sigma) (PBS-Tween). Filters were washed with PBS-Tween between subsequent steps. Type Ia polysaccharide was detected using rabbit antiserum evoked by immunization with GBS type Ia polysaccharide conjugated to tetanus toxoid (Ia-TT antiserum) (24Wessels M.R. Paoletti L.C. Rodewald A.K. Michon F. DiFabio J. Jennings H.J. Kasper D.L. Infect. Immun. 1993; 61: 4760-4766Crossref PubMed Google Scholar). This antiserum has been shown to be highly specific for type Ia GBS polysaccharide; it binds less well to the closely related type Ib polysaccharide but does not recognize type II or III GBS polysaccharides (24Wessels M.R. Paoletti L.C. Rodewald A.K. Michon F. DiFabio J. Jennings H.J. Kasper D.L. Infect. Immun. 1993; 61: 4760-4766Crossref PubMed Google Scholar). Filters were incubated with Ia-TT antiserum diluted 1:3000 in PBS-Tween, followed by incubation with alkaline phosphatase-conjugated goat anti-rabbit IgG (ICN/Cappel, Costa Mesa, CA) diluted 1:1000 in PBS-Tween and 5-bromo-4-chloroindolyl-3-phosphate/ nitro blue tetrazolium substrate (Kirkegaard and Perry Laboratories, Gaithersburg, MD). Competition ELISA was used to quantify type Ia capsular polysaccharide production by mutant strains. Serial dilutions of a mutanolysin extract (see below) of the test strain were mixed with Ia-TT antiserum (final dilution, 1:500,000) in microtiter wells coated with type Ia polysaccharide conjugated to human serum albumin. The remainder of the ELISA procedure was performed as described (34Guttormsen H.-K. Baker C.J. Edwards M.S. Paoletti L.C. Kasper D.L. J. Infect. Dis. 1996; 173: 142-150Crossref PubMed Scopus (64) Google Scholar). Type Ia polysaccharide and group B carbohydrate were detected in chromatography column fractions by double diffusion in agarose using Ia-TT antiserum and antisera to group B carbohydrate, respectively (35Ouchterlony O. Prog. Allergy. 1958; 5: 1-78PubMed Google Scholar). For measurement of cell-associated capsular polysaccharide produced by mutant strains, cells from a 100-ml overnight culture were washed in PBS and resuspended in 1 ml of protoplast buffer (30 mmNaHPO4, 40% sucrose (w/v), 10 mmMgCl2). Capsular polysaccharide was released from the cells by the addition of 1000 units of mutanolysin (Sigma). After 6 h of incubation at 37 °C, the protoplasts were removed by centrifugation at 3800 × g for 15 min. The amount of type Ia polysaccharide in the extract was determined using serial dilutions of the extract in a competition ELISA by comparison with a standard curve generated with purified type Ia capsular polysaccharide as described above. GBS wild-type strain 515 and mutant strains were grown in continuous culture as described (25Paoletti L.C. Ross R.A. Johnson K.D. J. Bacteriol. 1996; 64: 1220-1226Google Scholar). Bacterial cells were collected by centrifugation and washed with PBS, and the capsular polysaccharide was extracted from the cell pellets by shaking at 37 °C for 30 h with 0.25n NaOH. Cell extracts were neutralized with HCl and clarified by centrifugation at 13,000 × g for 20 min. After dialysis, extracts were filtered sterile and lyophilized. Each sample was resuspended in 30 ml of 69 mm sodium borate, and the pH was raised to greater than 10 by the addition of 10n NaOH. The polysaccharide was reacetylated by the addition of 1.8 ml of acetic anhydride at room temperature; pH was maintained at 10 or higher by the addition of 10 N NaOH. The mixture was stirred for 2 h, neutralized with HCl, dialyzed, filtered sterile, and lyophilized. Samples were dissolved in 20 ml of enzyme treatment buffer (10 mm Tris, pH 7.4, 10 mm CaCl2, 10 mm MgCl2) and incubated with DNase (1 mg) and RNase (5 mg) overnight at 37 °C. Samples were incubated with Pronase (2 mg) at 37 °C overnight, dialyzed, and lyophilized. Polysaccharide samples were dissolved in water at a concentration of 25 mg/ml and purified by gel filtration chromatography on a 5 × 100-cm column of Sephacryl S-200 (Amersham Pharmacia Biotech) with PBS as eluant. Column fractions were screened for the presence of type Ia capsular polysaccharide and for group B carbohydrate by Ouchterlony immunodiffusion as described above. If necessary, capsular polysaccharides were further purified by anion exchange chromatography on a column of DEAE-Sepharose (Amersham Pharmacia Biotech) equilibrated with 10 mm Tris, pH 7.5, and eluted with a 0–0.4m NaCl gradient. Fractions were assayed as above. Samples were analyzed by high performance anion exchange chromatography using a gradient system (Dionex, Sunnyvale, CA) equipped with a pulsed amperometric detector (model PAD2) and a pellicular anion exchange column (PA-1; 4 × 250 mm). The detector sensitivity was set at 300 nA with a 0.05-V applied pulse potential. Samples were hydrolyzed with 0.5 mtrifluoroacetic acid at 100 °C for 18 h for analysis of neutral and amino sugars. After the removal of trifluoroacetic acid by repeated evaporation in water, hydrolyzed samples were applied through a microinjection valve with a 50-μl loop. Neutral sugars were eluted with 20 mm sodium hydroxide at a flow rate of 1 ml/min. For detection of sialic acid, samples were treated with 6% acetic acid at 80 °C for 2 h. After removal of acetic acid by repeated evaporation in water, samples were dissolved in water, applied to the column as above, and eluted with 90 mm sodium acetate and 100 mm sodium hydroxide. Purified polysaccharide samples were dissolved in deuterium oxide at a concentration of 3 mg/ml and subjected to1H NMR analysis on a Varian Unity 500 spectrometer (Varian Medical Systems, Palo Alto, CA) with a frequency of 500 MHz. Spectra generated by each sample at 60 °C were recorded with chemical shifts referenced relative to water resonance at 4.42 ppm. Water resonance was calibrated externally using dioctyl sodium sulfosuccinate as the standard. Purified capsular polysaccharide was analyzed by gel filtration FPLC on a column of Superose 12 HR 10/30 (Amersham Pharmacia Biotech) equilibrated in PBS. Samples were eluted in the same buffer at a fl" @default.
• W2051235227 created "2016-06-24" @default.
• W2051235227 creator A5024064130 @default.
• W2051235227 creator A5053727204 @default.
• W2051235227 creator A5074817052 @default.
• W2051235227 creator A5086156918 @default.
• W2051235227 date "2001-01-01" @default.
• W2051235227 modified "2023-10-12" @default.
• W2051235227 title "Functional Analysis in Type Ia Group B Streptococcusof a Cluster of Genes Involved in Extracellular Polysaccharide Production by Diverse Species of Streptococci" @default.
• W2051235227 cites W1010047185 @default.
• W2051235227 cites W1485258041 @default.
• W2051235227 cites W1514938122 @default.
• W2051235227 cites W1566173772 @default.
• W2051235227 cites W1806485528 @default.
• W2051235227 cites W1923584206 @default.
• W2051235227 cites W1927748861 @default.
• W2051235227 cites W1969345310 @default.
• W2051235227 cites W1970232889 @default.
• W2051235227 cites W1972936923 @default.
• W2051235227 cites W1977370563 @default.
• W2051235227 cites W1981040794 @default.
• W2051235227 cites W1982468094 @default.
• W2051235227 cites W1990019612 @default.
• W2051235227 cites W1998518804 @default.
• W2051235227 cites W1998591058 @default.
• W2051235227 cites W2054941036 @default.
• W2051235227 cites W2060913542 @default.
• W2051235227 cites W2076165314 @default.
• W2051235227 cites W2087992212 @default.
• W2051235227 cites W2088743223 @default.
• W2051235227 cites W2089400010 @default.
• W2051235227 cites W2110042660 @default.
• W2051235227 cites W2112248316 @default.
• W2051235227 cites W2113939119 @default.
• W2051235227 cites W2118953678 @default.
• W2051235227 cites W2134360332 @default.
• W2051235227 cites W2142384764 @default.
• W2051235227 cites W2146987443 @default.
• W2051235227 cites W2148030286 @default.
• W2051235227 cites W2159920973 @default.
• W2051235227 cites W2160104627 @default.
• W2051235227 cites W2167629962 @default.
• W2051235227 cites W2321913894 @default.
• W2051235227 cites W286643749 @default.
• W2051235227 cites W63484486 @default.
• W2051235227 doi "https://doi.org/10.1074/jbc.m005702200" @default.
• W2051235227 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11027683" @default.
• W2051235227 hasPublicationYear "2001" @default.
• W2051235227 type Work @default.
• W2051235227 sameAs 2051235227 @default.
• W2051235227 citedByCount "152" @default.
• W2051235227 countsByYear W20512352272012 @default.
• W2051235227 countsByYear W20512352272013 @default.
• W2051235227 countsByYear W20512352272014 @default.
• W2051235227 countsByYear W20512352272015 @default.
• W2051235227 countsByYear W20512352272016 @default.
• W2051235227 countsByYear W20512352272017 @default.
• W2051235227 countsByYear W20512352272018 @default.
• W2051235227 countsByYear W20512352272019 @default.
• W2051235227 countsByYear W20512352272020 @default.
• W2051235227 countsByYear W20512352272021 @default.
• W2051235227 countsByYear W20512352272022 @default.
• W2051235227 crossrefType "journal-article" @default.
• W2051235227 hasAuthorship W2051235227A5024064130 @default.
• W2051235227 hasAuthorship W2051235227A5053727204 @default.
• W2051235227 hasAuthorship W2051235227A5074817052 @default.
• W2051235227 hasAuthorship W2051235227A5086156918 @default.
• W2051235227 hasBestOaLocation W20512352271 @default.
• W2051235227 hasConcept C100817775 @default.
• W2051235227 hasConcept C104317684 @default.
• W2051235227 hasConcept C126322002 @default.
• W2051235227 hasConcept C164866538 @default.
• W2051235227 hasConcept C199360897 @default.
• W2051235227 hasConcept C2780678043 @default.
• W2051235227 hasConcept C28406088 @default.
• W2051235227 hasConcept C2994085863 @default.
• W2051235227 hasConcept C36857842 @default.
• W2051235227 hasConcept C41008148 @default.
• W2051235227 hasConcept C54355233 @default.
• W2051235227 hasConcept C55493867 @default.
• W2051235227 hasConcept C71924100 @default.
• W2051235227 hasConcept C86803240 @default.
• W2051235227 hasConcept C89423630 @default.
• W2051235227 hasConceptScore W2051235227C100817775 @default.
• W2051235227 hasConceptScore W2051235227C104317684 @default.
• W2051235227 hasConceptScore W2051235227C126322002 @default.
• W2051235227 hasConceptScore W2051235227C164866538 @default.
• W2051235227 hasConceptScore W2051235227C199360897 @default.
• W2051235227 hasConceptScore W2051235227C2780678043 @default.
• W2051235227 hasConceptScore W2051235227C28406088 @default.
• W2051235227 hasConceptScore W2051235227C2994085863 @default.
• W2051235227 hasConceptScore W2051235227C36857842 @default.
• W2051235227 hasConceptScore W2051235227C41008148 @default.
• W2051235227 hasConceptScore W2051235227C54355233 @default.
• W2051235227 hasConceptScore W2051235227C55493867 @default.
• W2051235227 hasConceptScore W2051235227C71924100 @default.
• W2051235227 hasConceptScore W2051235227C86803240 @default.
• W2051235227 hasConceptScore W2051235227C89423630 @default.

• next