FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2051238269> ?p ?o ?g. }

• W2051238269 endingPage "15098" @default.
• W2051238269 startingPage "15090" @default.
• W2051238269 abstract "The semisynthetic plant alkaloid halofuginone (HAL) was reported to prevent and partly reverse experimental liver fibrosis. However, its mechanisms of action are poorly understood. We therefore aimed to determine the antifibrotic potential of HAL and to characterize involved signal transduction pathways in hepatic stellate cells (HSCs). Results were compared with its in vivo effects in a rat model of reversal of established liver fibrosis induced by thioacetamide. In vitro HAL inhibited HSC proliferation and migration dose dependently at submicromolar concentrations. HAL (200 nm) up-regulated matrix metalloproteinase (MMP)-3 and MMP-13 expression between 10- and 50-fold, resulting in a 2- to 3-fold increase of interstitial collagenase activity. Procollagen α1(I) and MMP-2 transcript levels were suppressed 2- to 3-fold, whereas expression of other profibrogenic mRNAs remained unaffected. p38 mitogen-activated protein kinase (p38 MAPK) and nuclear factor κB(NFκB) pathways were activated by HAL, and specific inhibitors of p38 MAPK and NFκB dose dependently inhibited MMP-13 induction. Treatment with HAL did not affect HSC viability, and observed effects were reversible after its removal. In vivo HAL up-regulated MMP-3 and -13 mRNA expression 1.5- and 2-fold, respectively, in cirrhotic rats, whereas tissue inhibitor of metalloproteinase-1 was suppressed by 50%. In conclusion, submicromolar concentrations of HAL inhibit HSC proliferation and migration and up-regulate their expression of fibrolytic MMP-3 and -13 via activation of p38 MAPK and NFκB. The remarkable induction of MMP-3 and -13 makes HAL a promising agent for antifibrotic combination therapies. The semisynthetic plant alkaloid halofuginone (HAL) was reported to prevent and partly reverse experimental liver fibrosis. However, its mechanisms of action are poorly understood. We therefore aimed to determine the antifibrotic potential of HAL and to characterize involved signal transduction pathways in hepatic stellate cells (HSCs). Results were compared with its in vivo effects in a rat model of reversal of established liver fibrosis induced by thioacetamide. In vitro HAL inhibited HSC proliferation and migration dose dependently at submicromolar concentrations. HAL (200 nm) up-regulated matrix metalloproteinase (MMP)-3 and MMP-13 expression between 10- and 50-fold, resulting in a 2- to 3-fold increase of interstitial collagenase activity. Procollagen α1(I) and MMP-2 transcript levels were suppressed 2- to 3-fold, whereas expression of other profibrogenic mRNAs remained unaffected. p38 mitogen-activated protein kinase (p38 MAPK) and nuclear factor κB(NFκB) pathways were activated by HAL, and specific inhibitors of p38 MAPK and NFκB dose dependently inhibited MMP-13 induction. Treatment with HAL did not affect HSC viability, and observed effects were reversible after its removal. In vivo HAL up-regulated MMP-3 and -13 mRNA expression 1.5- and 2-fold, respectively, in cirrhotic rats, whereas tissue inhibitor of metalloproteinase-1 was suppressed by 50%. In conclusion, submicromolar concentrations of HAL inhibit HSC proliferation and migration and up-regulate their expression of fibrolytic MMP-3 and -13 via activation of p38 MAPK and NFκB. The remarkable induction of MMP-3 and -13 makes HAL a promising agent for antifibrotic combination therapies. Liver cirrhosis as a consequence of many forms of chronic liver diseases is associated with a high morbidity and mortality. Treatment for advanced liver fibrosis and cirrhosis is unsatisfactory or inefficient. Thus, there is an urgent need for antifibrotic treatments that can prevent, halt, or even reverse advanced fibrosis. In recent years, significant progress has been made in our understanding of hepatic fibrosis as a dynamic process, characterized by an imbalance between collagen production and degradation, finally leading to distortion of normal hepatic architecture and loss of function (1McCrudden R. Iredale J.P. Histol. Histopathol. 2000; 15: 1159-1168PubMed Google Scholar, 2Kossakowska A.E. Edwards D.R. Lee S.S. Urbanski L.S. Stabbler A.L. Zhang C.L. Phillips B.W. Zhang Y. Urbanski S.J. Am. J. Pathol. 1998; 153: 1895-1902Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar). Several studies suggest that human and experimental liver fibrosis may be reversible even at advanced stages, once the pathogenic trigger is eliminated (3Dufour J.F. DeLellis R. Kaplan M.M. Ann. Intern. Med. 1997; 127: 981-985Crossref PubMed Scopus (271) Google Scholar, 4Shiffman M.L. Hofmann C.M. Contos M.J. Luketic V.A. Sanyal A.J. Sterling R.K. Ferreira-Gonzalez A. Mills A.S. Garret C. Gastroenterology. 1999; 117: 1164-1172Abstract Full Text Full Text PDF PubMed Scopus (274) Google Scholar, 5Hammel P. Couvelard A. O'Toole D. Ratouis A. Sauvanet A. Flejou J.F. Degott C. Belghiti J. Bernades P. Valla D. Ruszniewski P. Levy P. N. Engl. J. Med. 2001; 344: 418-423Crossref PubMed Scopus (366) Google Scholar, 6Dienstag J.L. Goldin R.D. Heathcote E.J. Hann H.W. Woessner M. Stephenson S.L. Gardner S. Gray D.F. Schiff E.R. Gastroenterology. 2003; 124: 105-117Abstract Full Text Full Text PDF PubMed Scopus (672) Google Scholar). In hepatic fibrosis the excessive extracellular matrix is produced by activated mesenchymal cells which resemble myofibroblasts and derive from quiescent hepatic stellate cells (HSCs) 4The abbreviations used are: HSC, hepatic stellate cell; HAL, halofuginone; IκB-α, inhibitory κB-α protein; MF, myofibroblast-like cell; MMP, matrix metalloproteinase; NFκB, nuclear factor κB; MAPK, mitogen-activated protein kinase; Erk, extracellular signal-regulated kinase; PI3K, phosphatidylinositol 3-kinase; FCS, fetal calf serum; BrdUrd, bromodeoxyuridine; PDGF, platelet-derived growth factor; RT, reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; APMA, 4-aminophenyl mercuric acetate; TRITC, tetramethylrhodamine isothiocyanate; CREB, cAMP-response element-binding protein; TAA, thioacetamide; HYP, hydroxyproline; TIMP-1, tissue inhibitor of metalloproteinase-1; SAPK, stress-activated protein kinase; JNK, c-Jun N-terminal kinase.4The abbreviations used are: HSC, hepatic stellate cell; HAL, halofuginone; IκB-α, inhibitory κB-α protein; MF, myofibroblast-like cell; MMP, matrix metalloproteinase; NFκB, nuclear factor κB; MAPK, mitogen-activated protein kinase; Erk, extracellular signal-regulated kinase; PI3K, phosphatidylinositol 3-kinase; FCS, fetal calf serum; BrdUrd, bromodeoxyuridine; PDGF, platelet-derived growth factor; RT, reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; APMA, 4-aminophenyl mercuric acetate; TRITC, tetramethylrhodamine isothiocyanate; CREB, cAMP-response element-binding protein; TAA, thioacetamide; HYP, hydroxyproline; TIMP-1, tissue inhibitor of metalloproteinase-1; SAPK, stress-activated protein kinase; JNK, c-Jun N-terminal kinase. and periportal or perivenular fibroblasts (7Reeves H.L. Friedman S.L. Front. Biosci. 2002; 7: d808-d826Crossref PubMed Scopus (424) Google Scholar, 8Knittel T. Kobold D. Piscaglia F. Saile B. Neubauer K. Mehde M. Timpl R. Ramadori G. Histochem. Cell Biol. 1999; 112: 387-401Crossref PubMed Scopus (162) Google Scholar, 9Cassiman D. Libbrecht L. Desmet V. Denef C. Roskams T. J. Hepatol. 2002; 36: 200-209Abstract Full Text Full Text PDF PubMed Scopus (382) Google Scholar). These myofibroblasts are the major target for antifibrotic therapies. Halofuginone (HAL), a semisynthetic quinazolinone alkaloid originally derived from the plant Dichroa febrifuga, has been used to prevent coccidiosis in poultry, when its antifibrotic properties were discovered accidentally, since skin tearing and loss of skin integrity were observed in broilers that received HAL in the diet (10Granot I. Bartov I. Plavnik I. Wax E. Hurwitz S. Pines M. Poult. Sci. 1991; 70: 1559-1563Crossref PubMed Scopus (66) Google Scholar). During the last decade HAL was investigated as an antifibrotic agent in various in vivo fibrosis models (reviewed in Ref. 11Pines M. Nagler A. Gen. Pharmacol. 1998; 30: 445-450Crossref PubMed Scopus (141) Google Scholar) and suggested to be a specific inhibitor of procollagen type I expression for various collagen-expressing cells (12Granot I. Halevy O. Hurwitz S. Pines M. Biochim. Biophys. Acta. 1993; 1156: 107-112Crossref PubMed Scopus (117) Google Scholar, 13Halevy O. Nagler A. Levi-Schaffer F. Genina O. Pines M. Biochem. Pharmacol. 1996; 52: 1057-1063Crossref PubMed Scopus (85) Google Scholar, 14McGaha T.L. Kodera T. Spiera H. Stan A.C. Pines M. Bona C.A. Arthritis Rheum. 2002; 46: 2748-2761Crossref PubMed Scopus (35) Google Scholar, 15Nagler A. Miao H.Q.A.H. Pines M. Genina O. Vlodavsky I. Arterioscler. Thromb. Vasc. Biol. 1997; 17: 194-202Crossref PubMed Scopus (69) Google Scholar). More recently, HAL was shown to partly reverse established thioacetamide-induced rat liver fibrosis (16Bruck R. Genina O. Aeed H. Alexiev R. Nagler A. Avni Y. Pines M. Hepatology. 2001; 33: 379-386Crossref PubMed Scopus (138) Google Scholar). However, inhibition of procollagen I synthesis alone can hardly explain the ability of HAL to reverse pre-established fibrosis in rats. So far, there exist no experimental studies that explain the mode of action of HAL in hepatic fibrosis and, especially, toward the hepatic fibrogenic effector cells, i.e. activated HSCs and myofibroblasts. Here we present an extensive analysis of the in vitro antifibrotic potential of HAL, study the signal transduction pathways triggered by the drug in HSCs/myofibroblasts, and provide in vivo evidence of its pro-fibrolytic mode of action in a rat model of fibrosis reversal. We show that HAL is a prominent activator of fibrolytic matrix metalloproteinase (MMP)-3 and -13 in HSCs, a hitherto unique property for an antifibrotic agent, which is mediated by activation of p38 mitogen-activated protein kinase (MAPK) and nuclear factor κB(NFκB). HSC Isolation and Culture—CFSC-2G (17Greenwel P. Rubin J. Schwartz M. Hertzberg E.L. Rojkind M. Lab. Invest. 1993; 69: 210-216PubMed Google Scholar), HSC line obtained from cirrhotic rat liver (kind gift from Dr. M. Rojkind, Washington, D. C.) and culture-activated primary rat HSCs were seeded onto 12-, 24-, or 96-well plastic plates at a density 40,000 cells per ml at 95% air/5% CO2 in a humidified atmosphere. Cells were maintained in Dulbecco's modified Eagle's medium (10% FCS, 1% penicillin/streptomycin) and used for experiments at low (0.5% FCS) serum conditions after 12–24 h unless specified otherwise. HAL (kind gift of Dr. M. Pines, Rehovot, Israel) was added directly to the culture medium. All reagents were from Sigma (Taufkirchen, Germany) if not stated otherwise. Primary HSCs were isolated from male Wistar rats (Retired Breeders, 450–500 g, Charles River, Sulzfeld, Germany) according to a previously published procedure (18Niki T. Rombouts K. De Bleser P. De Smet K. Rogiers V. Schuppan D. Yoshida M. Gabbiani G. Geerts A. Hepatology. 1999; 29: 858-867Crossref PubMed Scopus (177) Google Scholar). Briefly, the liver was perfused with 0.1% Pronase E and 0.025% type IV collagenase in Dulbecco's modified Eagle's medium for 10–15 min, followed by digestion with 0.04% Pronase, 0.025% collagenase, and 0.002% DNase at 37 °C for 10–30 min and by a two-step centrifugation through a 11 and 13% gradient of Nycodenz at 1,500 × g for 15 min. Cell viability was assessed by Trypan Blue exclusion and was routinely greater than 95–98%. Purity of HSC isolates was confirmed by their stellate shape, and cytoplasmic lipid-droplets showing greenish autofluorescence at 390 nm excitation. Contamination with Kupffer cells, as assessed by the ability to engulf 3-μm latex beads, was <3–5% after isolation and undetectable after the first passage. Cells were used freshly or after the first passage if not stated otherwise. Myofibroblast-like cells (MF) were obtained by outgrowth from primary HSC cultures (three to fifth passages). Cell Proliferation—DNA synthesis was evaluated measuring BrdUrd incorporation using an enzyme-linked immunosorbent assay (Roche Applied Science). CFSC-2G and culture-activated primary HSCs (5–7 days) were seeded at a density of 2,000 cells/well in 96-well plates in growth medium containing 10% FCS for 24 h. After 24 h of starvation in 0.25% FCS, cells were stimulated by 10% FCS for 24 h in the presence of increasing concentrations of HAL. BrdUrd was added during the last 4 h, and its incorporation was quantified using an anti-BrdUrd peroxidase-labeled antibody. All experiments were done with 6–8 wells in parallel and repeated at least three times. For determination of cell numbers cells were seeded at 40,000 cells/well in 6-well plates and maintained in growth medium for 24 h followed by different periods of treatment in triplicates. After trypsinization cell numbers were determined with a Coulter counter (Coulter® Z1, Coulter Electronics Ltd., Luton, UK). Cell Migration Assay—Cell migration was assessed by measuring the repopulation of a linear wound made in a confluent cell monolayer. Cells were grown in 24-well plates until confluency and starved in serum-free medium for 24 h. Thereafter a linear wound was generated in the monolayer by scraping a sterile 100-μl plastic pipette tip perpendicular to three parallel drawn lines, and medium was changed to remove scraped cells. After 3 h, the distance between the cell fronts was measured with a micrometer, using the three lines as a reference. 10 ng/ml platelet-derived growth factor-BB (PDGF-BB) or 10% FCS and HAL at increasing concentrations were immediately added, and migration was assessed during the following 12–24 h. Three measurements per well were performed in three wells for each condition, and data are expressed as a reduction of initial scratch width. Real-time RT-PCR—Real-time RT-PCR was performed as described (19Popov Y. Patsenker E. Fickert P. Trauner M. Schuppan D. J. Hepatol. 2005; 43: 1045-1054Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar, 20Benten D. Kumaran V. Joseph B. Schattenberg J. Popov Y. Schuppan D. Gupta S. Hepatology. 2005; 42: 1072-1081Crossref PubMed Scopus (58) Google Scholar, 21Schulze-Krebs A. Preimel D. Popov Y. Bartenschlager R. Lohmann V. Pinzani M. Schuppan D. Gastroenterology. 2005; 129: 246-258Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar). Briefly, total RNA was isolated from the cell lysates or liver homogenates using RNApure (PeqLab, Erlangen, Germany) and 0.5 μg of total RNA was reverse transcribed using Superscript II reverse transcriptase (Invitrogen) with 50 pmol of random hexamer and 100 pmol of oligo(dT) primers (Promega, Mannheim, Germany). Relative mRNA transcript levels were quantified on a LightCycler (Roche Applied Science) using the TaqMan technology. The housekeeping gene GAPDH was amplified in a parallel reaction for normalization. TaqMan probes and primer sets were designed using the Primer Express software (PerkinElmer Life Sciences) based on published sequences as summarized in Table 1. All TaqMan probes are positioned such as spanning exon-exon boundaries of corresponding genes to exclude co-amplification of genomic DNA. Sense and antisense primer (each at 0.5 μm) and 0.125 μm probe, labeled and phosphorylated at its 5′-end with 6-carboxyfluoresceine (6-FAM™) and at the 3′-end with tetramethylrhodamine, were synthesized at MWG Biotech (Ebersberg, Germany) and validated using conventional RT-PCR and agarose chromatography (20Benten D. Kumaran V. Joseph B. Schattenberg J. Popov Y. Schuppan D. Gupta S. Hepatology. 2005; 42: 1072-1081Crossref PubMed Scopus (58) Google Scholar). Relative mRNA transcript levels were expressed in arbitrary units as n-fold versus untreated controls (mean ± S.E.) after normalization to GAPDH mRNA.TABLE 1Primers and probes used in real-time RT-PCRTarget molecule5′-PrimerProbe3′-PrimerProcollagen α1(I)TCCGGCTCCTGCTCCTCTTATTCTTGGCCATGCGTCAGGAGGGGTATGCAGCTGACTTCAGGGATGTProcollagen α1(III)AATGGTGGCTTTCAGTTCAGCTTGGAAAGAAGTCTGAGGAAGGCCAGCTGTGTAATGTTCTGGGAGGCCCMMP-2CCGAGGACTATGACCGGGATAATCTGCCCCGAGACCGCTATGTCCACTTGTTGCCCAGGAAAGTGAAGMMP-3CCGTTTCCATCTCTCTCAAGATGAAGATGGTATTCAATCCCTCTATGGACCTCCCAGAGAGTTAGATTTGGTGGGTACCAMMP-13GGAAGACCCTCTTCTTCTCATCTGGTTAGCATCATCATAACTCCACACGTTCATAGACAGCATCTACTTTGTCTIMP-1TCCTCTTGTTGCTATCATTGATAGCTTTTCTGCAACTCGGACCTGGTTATAAGGCGCTGGTATAAGGTGGTCTCGATTGFβ1AGAAGTCACCCGCGTGCTAAACCGCAACAACGCAATCTATGACAAAACCATCCCGAATGTCTGACGTATTGACTGFATCCCTGCGACCCACACAAGCTCCCCCGCCAACCGCAAGATCAACTGCTTTGGAAGGACTCGCGAPDHCCTGCCAAGTATGATGACATCAAGATGGTGAAGCAGGCGGCCGAGGTAGCCCAGGATGCCCTTTAGT Open table in a new tab MMP Protein Production—MMP protein production was semiquantified by Western blotting as described previously (22Schaefer B. Rivas-Estilla A.M. Meraz-Cruz N. Reyes-Romero M.A. Hernandez-Nazara Z.H. Dominguez-Rosales J.A. Schuppan D. Greenwel P. Rojkind M. Am. J. Pathol. 2003; 162: 1771-1780Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar) in 20-fold concentrated conditioned media (for MMP-13) or in cell lysates (for MMP-3) of CFSC-2G cells treated with or without HAL for 0–36 h. Pro-MMP-13 (60 kDa) from conditioned media of rat keratinocytes (CCL-4 cells) served as positive control (MMP-13 antigen and anti-MMP-13 antibody from Lab Vision, Westinghouse, CA; rabbit anti-human MMP-3 from AnaSpec, San Jose, CA). Conditioned media and cell lysates were standardized by equal cell numbers and volume of media (1 × 106cells/ml). Equal loading was confirmed by Ponceau S staining of membranes after protein transfer and/or concomitant blotting for β-actin. Interstitial Collagenase Activity Assay—Conditioned media were activated with 2 μm 4-aminophenyl mercuric acetate (APMA) at 37 °C for 5 h to measure total interstitial collagenase activity using degradation of native bovine biotinylated type I collagen as substrate (ECM710, Chemicon, Hampshire, UK). 100 μl of APMA-activated conditioned media was incubated with substrate for 2 h at 37 °C, and solubilized biotinylated fragments were transferred to a biotin-binding 96-well plate followed by streptavidin-peroxidase detection according to the manufacturer's recommendations. APMA-activated human recombinant MMP-1 was used as a standard. Determination of NFκB Activation—Cells were seeded in 75-cm2 flasks, grown until confluence, starved in serum-free medium for 24 h, and treated with HAL at 200 nm for various periods of time. After centrifugation in phosphate-buffered saline at 4 °C and 1200 rpm for 5 min, 2 × 106 cells were resuspended in ice-cold nuclear extraction buffer (5 mm HEPES-KOH, 0.75 mm MgCl2, 5 mm KCl, 0.25 mm dithiothreitol, 0.1 mm PMSF, pH 7.9), incubated for 10 min, and vortexed for 1 min. Nuclei were collected at 1200 rpm for 30 s at 4 °C. The nuclear pellet was resuspended in 300 μl of cell lysis buffer (see MAPK activation assay below), boiled for 10 min under reducing conditions, and frozen at –20 °C until use. The p65-subunit was detected in nuclear extracts by Western blotting (see MAPK activation assay) using an anti-p65 antibody (1:200, from Delta Biolabs). Inhibitory κB protein (IκB-α) degradation was assessed by Western blotting using anti-IκBα antibody (1:1000, from Rockland Inc., Gilbertsville, PA) in CFSC-2G cell lysates 30 min obtained after addition of HAL. For immunofluorescence, subconfluent cells were starved in 0.25% FCS/Dulbecco's modified Eagle's medium for 24 h and treated with 200 nm HAL for 0.5–6 h, washed with ice-cold phosphate buffer, and fixed in cold methanol for 10 min. p65 NFκB was detected by incubating with the anti-p65 antibody (1:100) for 30 min followed by TRITC-conjugated anti-rabbit IgG (1:200, Dako, Germany). Subcellular localization of p65 was assessed, and representative images were documented using a scanning confocal microscope (Carl Zeiss, Germany). To inhibit NFκB nuclear translocation (23Hellerbrand C. Jobin C. Iimuro Y. Licato L. Sartor R.B. Brenner D.A. Hepatology. 1998; 27: 1285-1295Crossref PubMed Scopus (174) Google Scholar), the proteasome inhibitor MG132 (Rockland Inc.) was used. MAPK Activation Assays—Confluent, starved cells were stimulated with 10 ng/ml PDGF-BB for 10 min with or without pretreatment with HAL for 4 h. Cell extracts were prepared on ice using cell lysis buffer (50 mm Tris-HCl, 1% Tween 20, 0.25% SDS, 150 mm NaCl, 1 mm EGTA, 1 mm Na3VO4, 1 mm NaF) and Complete™ protease inhibitor mixture (Roche Applied Science), boiled for 10 min under reducing conditions, and frozen at –20 °C until use. To inhibit activation of individual kinases, several specific inhibitors were used: SB203580 (p38 MAPK), U0126 (Erk1/2), and LY294002 (PI3K) (all from LC Labs, Woburn, MA). Total and phosphorylated MAPKs, Akt-1, and phospho-CREB were visualized by Western blotting using respective antibodies recognizing phosphorylated and total kinases (from Cell Signaling Technology, Beverly, MA). 10 μg of cell lysates standardized by cell number was run on a 14% SDS-polyacrylamide gel, blotted onto nitrocellulose, and stained with 0.5% Ponceau S to assure equal protein loading and transfer. Membranes were blocked with 5% powdered milk in TBS-T (25 mm Tris-HCl, pH 8.0, 144 mm NaCl, 0.1% Tween 20), incubated overnight at 4 °C with primary antibodies, washed, and incubated for 2 h with their corresponding peroxidase-conjugated secondary antibodies. Immunodetected proteins were visualized utilizing the enhanced chemiluminescence assay kit (Amersham Biosciences). Animal Experimentation—48 male Wistar rats (300–330 g) were purchased from Charles River (Sulzfeld, Germany). The protocol for animal experimentation was approved by the Government of Lower Franconia (permission number 621.2531.31-20/00). Cirrhosis was induced in 40 rats by intraperitoneal administration of thioacetamide (TAA) dissolved in saline, 200 mg/kg twice a week, for 12 weeks. Four rats died during induction and were not included in the study, and eight rats which received saline instead of TAA served as controls. After 12 weeks of TAA treatment, cirrhotic rats were randomly divided into three groups: PF (peak of fibrosis, n = 12), SR (spontaneous recovery, n = 12), and HAL (SR and treatment with HAL, n = 12). Group PF was sacrificed 5 days after the last TAA injection, and the HAL group received halofuginone (0.05 mg/kg), dissolved in 3% carboxymethylcellulose, by daily oral gavage for the following 8 weeks, while the SR group received equal amounts of vehicle for 8 weeks. Thereafter animals were sacrificed, and fibrosis parameters were evaluated. Total (milligrams/liver) and relative (milligrams/g of liver) hydroxyproline (HYP) was determined biochemically from 250 mg of liver as described previously (19Popov Y. Patsenker E. Fickert P. Trauner M. Schuppan D. J. Hepatol. 2005; 43: 1045-1054Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar, 24Cho J.J. Hocher B. Herbst H. Jia J.D. Ruehl M. Hahn E.G. Riecken E.O. Schuppan D. Gastroenterology. 2000; 118: 1169-1178Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). Relative mRNA expression was quantified by real-time RT-PCR from total RNA, extracted from liver homogenates (∼100 mg of tissue) as described above. Histological staining for connective tissue (Sirius Red) was performed in formalin-fixed, paraffin-embedded liver specimens from two different lobes of each animal according to the routine protocol of Department of Pathology, University of Erlangen. Statistical Analysis—Statistical analyses were performed using Microsoft EXCEL software. Data are expressed as means ± S.E. The statistical significance of differences was evaluated using the unpaired, non-parametric Student's t test. Halofuginone Inhibits Hepatic Stellate Cell Proliferation and Migration—HAL dose dependently inhibited serum-stimulated cell proliferation as measured by BrdUrd incorporation, with a maximal inhibition at 200 nm in both CFSC-2G and primary rat HSCs (Fig. 1, A and B). Inhibition of DNA synthesis was consistent with reduction in cell number (Fig. 1C). The effect of HAL on serum-induced migration of HSCs, as measured in an in vitro wounding assay, was completely blocked in the presence of 100 nm HAL, with significant inhibition already at 10 nm (Fig. 1D). PDGF-BB-induced migration was inhibited similarly (not shown). Cell morphology, as visualized by phase-contrast microscopy, and cell viability, as assessed by Trypan Blue exclusion, were not affected by HAL. Moreover, the antiproliferative effect of 200 nm HAL added for 24 h was readily reversible after removal of the drug (Fig. 1E). Halofuginone Affects Expression of Fibrolytic Genes in HSCs—In CFSC-2G cells 200 nm HAL strongly up-regulated MMP-3 and MMP-13 mRNA expression between 10- and 50-fold (Fig. 2, A and B). MMP-13 mRNA was maximal at 12 h after addition and slowly declined to basal levels after 36 h (Fig. 2A), whereas MMP-3 mRNA peaked at 36 h (Fig. 2B). In freshly isolated, early culture-activated HSCs (≤14 days) MMP-13 mRNA was almost undetectable in both untreated and HAL-treated cells (data not shown), whereas HAL induced MMP-3 mRNA 6-fold at 36 h (Fig. 2C), similar to its effect in CFSC-2G cells. Myofibroblasts obtained by outgrowth from long term cultured primary HSCs were found to be positive for MMP-13 mRNA. Here, HAL up-regulated MMP-3 and -13 mRNAs 12- and 19-fold, respectively, after 36 h of treatment (Fig. 2, D and E). Western blotting of concentrated CFSC-2G conditioned media and cell lysates confirmed an increase in (pro-) MMP-3 and -13 protein expression, respectively, upon treatment with HAL (Fig. 2, F and G). In CFSC cells and culture-activated HSCs, HAL down-regulated procollagen α1(I) and MMP-2 transcripts 2- and 3-fold, respectively, within 24 and 36 h (Fig. 3, A–D). Similar results were obtained for myofibroblasts (not shown). These findings confirm previous observations by others in avian fibroblasts and a rat HSC line for procollagen α1(I) (12Granot I. Halevy O. Hurwitz S. Pines M. Biochim. Biophys. Acta. 1993; 1156: 107-112Crossref PubMed Scopus (117) Google Scholar, 16Bruck R. Genina O. Aeed H. Alexiev R. Nagler A. Avni Y. Pines M. Hepatology. 2001; 33: 379-386Crossref PubMed Scopus (138) Google Scholar), and in bladder carcinoma cells for MMP-2 (25Elkin M. Reich R. Nagler A. Aingorn E. Pines M. de-Groot N. Hochberg A. Vlodavsky I. Clin. Cancer Res. 1999; 5: 1982-1988PubMed Google Scholar). Procollagen α1(III) expression was suppressed similarly as procollagen α1(I) mRNA, whereas transforming growth factor β1, CTGF (connective tissue growth factor), and TIMP-1 and -2 transcript levels remained unaffected in both CFSC-2G cells and primary HSCs (data not shown). Halofuginone Stimulates Collagenolytic Activity of HSCs—Total (APMA-activated) collagenolytic activity was measured in conditioned media of myofibroblasts, obtained by outgrowth from primary HSCs. HAL enhanced degradation of native collagen type I by hepatic myofibroblasts in a time- and dose-dependent manner, with a 2- to 3-fold increase by 200 nm HAL after 12–18 h (Fig. 4, A and B). Intrinsic (without APMA activation) collagenolytic activity was below the detection limit of our system (not shown). Halofuginone Acts via Activation of p38 MAPK and NFκB—To explore the mechanisms that lead to MMP-3 and MMP-13 induction by HAL, we studied activation of several MAPKs and NFκB. Incubation of cells with HAL alone without subsequent stimulation by PDGF-BB did not modulate phosphorylation of kinases as compared with untreated controls (not shown). However, stimulation of the cells with 10 ng of PDGF for 10 min after preincubation with 200 nm HAL for 2 h induced a strong increase of p38 MAPK phosphorylation, without a change of extracellular signal-regulated kinase 1/2 (Erk1/2) phosphorylation as compared with cells, stimulated with PDGF-BB alone (Fig. 5A). Activation of SAPK/JNK or PI3K/Akt was unaffected by HAL (not shown). In addition, HAL caused a time-dependent increase of nuclear p65-NFκB compared with untreated controls as detected by semiquantitative Western blot (Fig. 5B). Anti-p65 immunohistochemistry on CFSC-2G cells exposed to 200 nm HAL confirmed nuclear translocation of p65 already at 1 h and peaking at 6 h. p65 nuclear translocation was abrogated by pre-treatment with the proteasome inhibitor MG132 (Fig. 5C). This was preceded by degradation of IκB-α at 30 min (Fig. 6D).FIGURE 6p38 MAPK and NFκB are causally involved in the induction of MMP-13 in HSCs. A, lack of effect of the Erk1/2 inhibitor U0126 (U, 5 μg/ml) and the PI3K inhibitor LY294002 (LY, 5 μg/ml), in contrast to complete abrogation of MMP-13 induction by SB203580 (SB, 5 μg/ml) and MG132 (MG, 15 μg/ml). Cells were treated with 200 nm HAL for 12 h 30 min after addition of inhibitors in 0.5% FCS Dulbecco's modified Eagle's medium. B, Western blots demonstrating efficient and specific inhibition of respective kinases by preincubation with inhibitors at doses as used in Fig. 6A. Cells were stimulated with 10 ng/ml PDGF-BB for 10 min and analyzed as described under “Materials and Methods.” Total p38 MAPK served as a loading control. C, inhibition of activation of p38 MAPK (upper band) and its downstream target phospho-CREB (middle band) by SB203580 in CFSC-2G cells in the presence of 0.5% FCS and 200 nm HAL. The phosphorylation state of kinases was evaluated after 10 min of stimulation with PDGF-BB (10 ng/ml) or fetal calf serum (0.5%). C, MMP-13 mRNA expression in CFSC-2G cells treated with HAL at 200 nm for 12 h in presence of 0.5% FCS after a 30-min pre-treatment with increasing concentrations of the specific p38 MAPK and NFκB-inhibitors, SB203580 (SB) and MG132 (MG). mRNA data are representative of three independent experiments performed in triplicates (means ± S.E., arbitrary units relative to GAPDH).View Large Image Figure V" @default.
• W2051238269 created "2016-06-24" @default.
• W2051238269 creator A5001467787 @default.
• W2051238269 creator A5022092357 @default.
• W2051238269 creator A5024893596 @default.
• W2051238269 creator A5035469019 @default.
• W2051238269 creator A5053461292 @default.
• W2051238269 creator A5073755467 @default.
• W2051238269 date "2006-06-01" @default.
• W2051238269 modified "2023-10-02" @default.
• W2051238269 title "Halofuginone Induces Matrix Metalloproteinases in Rat Hepatic Stellate Cells via Activation of p38 and NFκB" @default.
• W2051238269 cites W1212464357 @default.
• W2051238269 cites W1552424392 @default.
• W2051238269 cites W1569195097 @default.
• W2051238269 cites W1598270217 @default.
• W2051238269 cites W1969051655 @default.
• W2051238269 cites W1970372703 @default.
• W2051238269 cites W1972055370 @default.
• W2051238269 cites W1974144714 @default.
• W2051238269 cites W1979372049 @default.
• W2051238269 cites W1980748566 @default.
• W2051238269 cites W1983422438 @default.
• W2051238269 cites W1985980869 @default.
• W2051238269 cites W1989868286 @default.
• W2051238269 cites W1990206356 @default.
• W2051238269 cites W1991718040 @default.
• W2051238269 cites W1992963028 @default.
• W2051238269 cites W1995168933 @default.
• W2051238269 cites W1996677487 @default.
• W2051238269 cites W2001398345 @default.
• W2051238269 cites W2004508940 @default.
• W2051238269 cites W2007141982 @default.
• W2051238269 cites W2010988303 @default.
• W2051238269 cites W2032745614 @default.
• W2051238269 cites W2034110625 @default.
• W2051238269 cites W2039876496 @default.
• W2051238269 cites W2048221993 @default.
• W2051238269 cites W2058564945 @default.
• W2051238269 cites W2060660978 @default.
• W2051238269 cites W2067435274 @default.
• W2051238269 cites W2073653948 @default.
• W2051238269 cites W2077508723 @default.
• W2051238269 cites W2081135727 @default.
• W2051238269 cites W2082579037 @default.
• W2051238269 cites W2089221443 @default.
• W2051238269 cites W2093604720 @default.
• W2051238269 cites W2095290717 @default.
• W2051238269 cites W2120643436 @default.
• W2051238269 cites W2127971542 @default.
• W2051238269 cites W2129303004 @default.
• W2051238269 cites W2144789534 @default.
• W2051238269 cites W2144921016 @default.
• W2051238269 cites W2145717463 @default.
• W2051238269 cites W2179560225 @default.
• W2051238269 cites W2335841220 @default.
• W2051238269 cites W4236147141 @default.
• W2051238269 cites W4248424458 @default.
• W2051238269 doi "https://doi.org/10.1074/jbc.m600030200" @default.
• W2051238269 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16489207" @default.
• W2051238269 hasPublicationYear "2006" @default.
• W2051238269 type Work @default.
• W2051238269 sameAs 2051238269 @default.
• W2051238269 citedByCount "93" @default.
• W2051238269 countsByYear W20512382692012 @default.
• W2051238269 countsByYear W20512382692013 @default.
• W2051238269 countsByYear W20512382692014 @default.
• W2051238269 countsByYear W20512382692015 @default.
• W2051238269 countsByYear W20512382692016 @default.
• W2051238269 countsByYear W20512382692017 @default.
• W2051238269 countsByYear W20512382692018 @default.
• W2051238269 countsByYear W20512382692019 @default.
• W2051238269 countsByYear W20512382692020 @default.
• W2051238269 countsByYear W20512382692021 @default.
• W2051238269 countsByYear W20512382692022 @default.
• W2051238269 countsByYear W20512382692023 @default.
• W2051238269 crossrefType "journal-article" @default.
• W2051238269 hasAuthorship W2051238269A5001467787 @default.
• W2051238269 hasAuthorship W2051238269A5022092357 @default.
• W2051238269 hasAuthorship W2051238269A5024893596 @default.
• W2051238269 hasAuthorship W2051238269A5035469019 @default.
• W2051238269 hasAuthorship W2051238269A5053461292 @default.
• W2051238269 hasAuthorship W2051238269A5073755467 @default.
• W2051238269 hasBestOaLocation W20512382691 @default.
• W2051238269 hasConcept C106487976 @default.
• W2051238269 hasConcept C109523444 @default.
• W2051238269 hasConcept C142724271 @default.
• W2051238269 hasConcept C176891718 @default.
• W2051238269 hasConcept C185592680 @default.
• W2051238269 hasConcept C43617362 @default.
• W2051238269 hasConcept C55493867 @default.
• W2051238269 hasConcept C71924100 @default.
• W2051238269 hasConcept C86803240 @default.
• W2051238269 hasConcept C95444343 @default.
• W2051238269 hasConceptScore W2051238269C106487976 @default.
• W2051238269 hasConceptScore W2051238269C109523444 @default.
• W2051238269 hasConceptScore W2051238269C142724271 @default.
• W2051238269 hasConceptScore W2051238269C176891718 @default.
• W2051238269 hasConceptScore W2051238269C185592680 @default.

• next