FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2051820912> ?p ?o ?g. }

• W2051820912 endingPage "31008" @default.
• W2051820912 startingPage "31001" @default.
• W2051820912 abstract "The importance of post-translational geranylgeranylation of the GTPase RhoA for its ability to induce cellular proliferation and malignant transformation is not well understood. In this manuscript we demonstrate that geranylgeranylation is required for the proper cellular localization of V14RhoA and for its ability to induce actin stress fiber and focal adhesion formation. Furthermore, V14RhoA geranylgeranylation was also required for suppressing p21WAF transcription, promoting cell cycle progression and cellular proliferation. The ability of V14RhoA to induce focus formation and enhance plating efficiency and oncogenic Ras anchorage-dependent growth was also dependent on its geranylgeranylation. The only biological activity of V14RhoA that was not dependent on its prenylation was its ability to induce serum response element transcriptional activity. Furthermore, we demonstrate that a farnesylated form of V14RhoA was also able to bind RhoGDI-1, was able to induce cytoskeleton organization, proliferation, and transformation, and was just as potent as geranylgeranylated V14RhoA at suppressing p21WAF transcriptional activity. These results demonstrate that RhoA geranylgeranylation is required for its biological activity and that the nature of the lipid modification is not critical. The importance of post-translational geranylgeranylation of the GTPase RhoA for its ability to induce cellular proliferation and malignant transformation is not well understood. In this manuscript we demonstrate that geranylgeranylation is required for the proper cellular localization of V14RhoA and for its ability to induce actin stress fiber and focal adhesion formation. Furthermore, V14RhoA geranylgeranylation was also required for suppressing p21WAF transcription, promoting cell cycle progression and cellular proliferation. The ability of V14RhoA to induce focus formation and enhance plating efficiency and oncogenic Ras anchorage-dependent growth was also dependent on its geranylgeranylation. The only biological activity of V14RhoA that was not dependent on its prenylation was its ability to induce serum response element transcriptional activity. Furthermore, we demonstrate that a farnesylated form of V14RhoA was also able to bind RhoGDI-1, was able to induce cytoskeleton organization, proliferation, and transformation, and was just as potent as geranylgeranylated V14RhoA at suppressing p21WAF transcriptional activity. These results demonstrate that RhoA geranylgeranylation is required for its biological activity and that the nature of the lipid modification is not critical. Rho guanine nucleotide dissociation inhibitor(s) farnesyltransferase geranylgeranyltransferase I glutathione S-transferase Dulbecco's modified Eagle's medium fetal calf serum serum response element (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide Small G proteins of the Ras superfamily are regulatory proteins whose activity is controlled by a GDP/GTP cycle. Several members of the Ras superfamily are regulators of signaling pathways that control cell growth, differentiation, and oncogenic transformation as well as actin cytoskeletal organization (1Hall A. Science. 1998; 279: 509-514Crossref PubMed Scopus (5242) Google Scholar). The Rho protein branch of this superfamily includes at least eight distinct Rho families (RhoA, B, C, D, and G, Rac1 and 2, TC10, Cdc42, and Rnd1, 2, and 3) (2Zohn I.M. Campbell S.L. Khosravi-Far R. Rossman K.L. Der C.J. Oncogene. 1998; 17: 1415-1438Crossref PubMed Scopus (320) Google Scholar) that are regulated by Rho-GTPase activating proteins and a large family of guanine nucleotide exchange factors of the Dbl family proteins. Moreover Rho guanine nucleotide dissociation inhibitors (RhoGDIs)1 stabilize the inactive GDP-bound form of the Rho proteins. Rho proteins notably regulate signal transduction from cell surface receptors to intracellular molecules and are involved in a variety of cellular processes including cell morphology (3Paterson H.F. Self A.J. Garrett M.D. Just J. Aktories K. Hall A. J. Cell Biol. 1990; 111: 1001-1007Crossref PubMed Scopus (571) Google Scholar), motility (4Takaishi K. Kikuchi A. Kuroda S. Kotani K. Sasaki T. Takai Y. Mol. Cell. Biol. 1993; 13: 72-79Crossref PubMed Scopus (173) Google Scholar), cytokinesis (5Aepfelbacher M. Essler M. Dequintana K.L. Weber P.C. Biochem J. 1995; 308: 853-858Crossref PubMed Scopus (13) Google Scholar,6Takaishi K. Sasaki T. Kameyama T. Tsukita S. Tsukita S. Takai Y. Oncogene. 1995; 11: 39-48PubMed Google Scholar), cell proliferation (7Olson M.F. Ashworth A. Hall A. Science. 1995; 269: 1270-1272Crossref PubMed Scopus (1062) Google Scholar, 8Chou M.M. Blenis J. Cell. 1996; 85: 573-583Abstract Full Text Full Text PDF PubMed Scopus (268) Google Scholar), and tumor progression (9Perona R. Esteve P. Jimenez B. Ballestero R.P. Ramon y Cajal S. Lacal J.C. Oncogene. 1993; 8: 1285-1292PubMed Google Scholar, 10Khosravi-Far R. Solski P.A. Clark G.J. Kinch M.S. Der C.J. Mol. Cell. Biol. 1995; 15: 6443-6453Crossref PubMed Scopus (641) Google Scholar, 11Prendergast G.C. Khosravi-Far R. Solski P.A. Kurzawa H. Lebowitz P.F. Der C.J. Oncogene. 1995; 10: 2289-2296PubMed Google Scholar). Ras and Rho proteins are post-translationally modified by the isoprenoid lipids, farnesyl, and geranylgeranyl (12Epstein W. Lever D. Leining L. Bruenger E. Rilling H. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 9668-9670Crossref PubMed Scopus (125) Google Scholar). Two prenyltransferases, farnesyltransferase (FTase) and geranylgeranyltransferase I (GGTase I), catalyze the covalent attachment of the farnesyl and geranylgeranyl groups, respectively, to the carboxyl-terminal cysteine of proteins ending in a CAAXmotif (C is a cysteine, A usually aliphatic amino acid, andX any amino acid). FTase prefers CAAX sequences where X is a serine, methionine, cysteine, alanine, or glutamine, as in Ras or in nuclear lamins (13Reiss Y. Goldstein J.L. Seabra M.C. Casey P.J. Brown M.S. Cell. 1990; 62: 81-88Abstract Full Text PDF PubMed Scopus (705) Google Scholar, 14Reiss Y. Stradley S.J. Gierasch L.M. Brown M.S. Goldstein J.L. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 732-736Crossref PubMed Scopus (312) Google Scholar, 15Moores S.L. Schabber M.D. Mosser S.D. Rands E. O'Hara M.B. Garsky V.M. Marshall M.S. Pompalliano D.L. Gibbs J.B. J. Biol. Chem. 1991; 266: 14603-14610Abstract Full Text PDF PubMed Google Scholar). When Xis a leucine or isoleucine the protein, as in the Rho/Rac family of proteins, is geranylgeranylated by GGTase I (16Yokoyama K. Goodwin G.W. Ghomashchi F. Glomset J.A. Gelb M.H. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 5302-5306Crossref PubMed Scopus (219) Google Scholar, 17Yokoyama K. Gelb M.H. J. Biol. Chem. 1993; 268: 4055-4060Abstract Full Text PDF PubMed Google Scholar). Protein prenylation is important in targeting proteins to cellular membranes but also in protein-protein interactions (18Zhang F.L. Casey P.J. Annu. Rev. Biochem. 1996; 65: 241-269Crossref PubMed Scopus (1746) Google Scholar, 19Marshall C.J. Science. 1993; 259: 1865-1866Crossref PubMed Scopus (308) Google Scholar, 20Seabra M.C. Cell Signal. 1998; 10: 167-172Crossref PubMed Scopus (226) Google Scholar). This process appeared to be critical for the oncoprotein Ras functions as observed with the dependence of its transforming activity on prenylation (21Jackson J.H. Cochrane C.G. Bourne J.R. Solski P.A. Buss J.E. Der C.J. Proc. Natl. Sci. Acad. U. S. A. 1990; 87: 3042-3046Crossref PubMed Scopus (298) Google Scholar,22Kato K. Cox A.D. Hisaka M.M. Graham S.M. Buss J.E. Der C.J. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 6403-6407Crossref PubMed Scopus (557) Google Scholar). Hence, over the past decade the functional role of protein prenylation has been intensively studied for Ras, while a few studies took interest in the other proteins. It has been shown that geranylgeranylation of RhoA is required for its correct subcellular localization (23Adamson P. Paterson H.F. Hall A. J. Cell Biol. 1992; 119: 617-627Crossref PubMed Scopus (332) Google Scholar) and for interaction with its GDP/GTP cycle regulators, guanine nucleotide dissociation inhibitor and guanine nucleotide exchange factor (24Hori Y. Kikuchi A. Isomura M. Katayama M. Miura Y. Fujioka H. Kaibuchi K. Takai Y. Oncogene. 1991; 6: 515-522PubMed Google Scholar, 25Mizuno T. Kaibuchi K. Yamamoto T. Kawamura M. Sakoda T. Fujioka H. Matsuura Y. Takai Y. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 6442-6446Crossref PubMed Scopus (170) Google Scholar). Furthermore, RhoA prenylation is needed for phospholipase D activation (26Kuribara H. Tago K. Yokozeki T. Sasaki T. Takai Y. Morii N. Narumiya S. Katada T. Kanaho Y. J. Biol. Chem. 1995; 270: 25667-25671Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 27Kanaho Y. Yokozeki T. Kuribara H. J. Lipid Mediat. Cell Signal. 1996; 14: 223-227Crossref PubMed Scopus (5) Google Scholar) and potentiation of AP-1 transcription (28Chang J.H. Pratt J.C. Sawasdikosol S. Kapeller R. Burakoff S.J. Mol. Cell. Biol. 1998; 18: 4986-4993Crossref PubMed Scopus (85) Google Scholar). However, although it was demonstrated that the prenylation of the highly homologous Rho protein, RhoB, is required for its cell transforming function but not its ability to activate serum response element-dependent transcription (29Lebowitz P.F. Du W. Prendergast G.C. J. Biol. Chem. 1997; 272: 16093-16095Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar), whether RhoA geranylgeranylation is required for suppression of p21WAF, induction of proliferation, and cytoskeleton organization was still not established. It was only shown that inhibition of protein geranylgeranylation by the GGTase I inhibitor, GGTI-298, resulted in G0/G1 cell cycle arrest, induction of p21WAF transcription, programmed cell death, and disorganization of actin cytoskeleton (30Miquel K. Pradines A. Sun J. Qian Y. Hamilton A.D. Sebti S.A. Favre G. Cancer Res. 1997; 57: 1846-1850PubMed Google Scholar, 31Vogt A. Sun J.Z. Qian Y.M. Hamilton A.D. Sebti S.M. J. Biol. Chem. 1997; 272: 27224-27229Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar, 32Adnane J. Bizouarn F.A. Qian Y. Hamilton A.D. Sebti S.M. Mol. Cell. Biol. 1998; 18: 6962-6970Crossref PubMed Google Scholar). Similar effects observed with the Clostridum botulinum C3 exoenzyme, a specific inhibitor of Rho A, B, and C proteins (32Adnane J. Bizouarn F.A. Qian Y. Hamilton A.D. Sebti S.M. Mol. Cell. Biol. 1998; 18: 6962-6970Crossref PubMed Google Scholar, 33Chardin P. Boquet P. Madaule P. Popoff M.R. Rubin E.J. Gill D.M. EMBO J. 1989; 8: 1087-1092Crossref PubMed Scopus (422) Google Scholar, 34Yamamoto M. Marui N. Sakai T. Morii N. Kozaki S. Ikai K. Imamura S. Narumiya S. Oncogene. 1993; 8: 1449-1455PubMed Google Scholar), as well as with a dominant negative mutants of RhoA (7Olson M.F. Ashworth A. Hall A. Science. 1995; 269: 1270-1272Crossref PubMed Scopus (1062) Google Scholar, 32Adnane J. Bizouarn F.A. Qian Y. Hamilton A.D. Sebti S.M. Mol. Cell. Biol. 1998; 18: 6962-6970Crossref PubMed Google Scholar) have suggested a role of Rho proteins in these process. Specific isoprenoids may facilitate distinct consequences for protein functions. Hence, normal Ras function is critically dependent on modification by a farnesyl group, and a geranylgeranylated normal Ras protein appeared to be a potent inhibitor of cellular proliferation (35Cox A. Hisaka M.M. Buss J.E. Der C.J. Mol. Cell. Biol. 1992; 12: 2606-2615Crossref PubMed Scopus (163) Google Scholar). In contrast either a C15 or a C20 isoprenoid can promote membrane interaction of the oncoprotein Ras necessary for triggering the cell transformation (35Cox A. Hisaka M.M. Buss J.E. Der C.J. Mol. Cell. Biol. 1992; 12: 2606-2615Crossref PubMed Scopus (163) Google Scholar, 36Cox A.D. Graham S.M. Solski P.A. Buss J.E. Der C.J. J. Biol. Chem. 1993; 268: 11548-11552Abstract Full Text PDF PubMed Google Scholar, 37Cox A.D. Garcia A.M. Westwick J.K. Kowalczyk J.J. Lewis M.D. Brenner D.A. Der C.J. J. Biol. Chem. 1994; 269: 19203-19206Abstract Full Text PDF PubMed Google Scholar). On the other hand, it was demonstrated that a specific prenylation of the γ subunits of G protein is needed for the membrane localization, interaction with the Gβ and their effectors (38Kisselev O. Ermolaeva M. Gautam N. J. Biol. Chem. 1995; 270: 25356-25358Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar, 39Inglese J. Koch W.J. Caron M.G. Lefkowitz R.J. Nature. 1992; 359: 147-150Crossref PubMed Scopus (235) Google Scholar, 40Matsuda T. Hashimoto Y. Ueda H. Asano T. Matsuura Y. Doi T. Takao T. Shimonishi Y. Fukada Y. Biochemistry. 1998; 37: 9843-9850Crossref PubMed Scopus (42) Google Scholar, 41Myung C.S. Yasuda H. Liu W.W. Harden T.K. Garrison J.C. J. Biol. Chem. 1999; 274: 16595-16603Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar, 42Mondal M.S. Wang Z. Seeds A.M. Rando R.R. Biochemistry. 2000; 39: 406-412Crossref PubMed Scopus (23) Google Scholar). Thus an evaluation of the role of specific isoprenoid modification in the function of other prenylated protein such as Rho GTPase would be needful for a better understanding of the functional role for specific isoprenoid modification of a protein. In this manuscript, we determined whether RhoA prenylation is required for its activity on cytoskeleton organization, proliferation, transcription, and transformation. Furthermore, we also investigated whether the nature of the prenyl group (i.e. farnesylversus geranylgeranyl) influences the biological activities of RhoA. To this end, we generated RhoA mutants by deleting the CAAX sequence to produce an unprenylated protein as well as by mutating the CAAX box to produce farnesylated RhoA. Standard polymerase chain reaction mutagenesis techniques were used to generate plasmids coding for RhoA with the wild type (RhoA-CLVL), farnesylated, (RhoA-CVLS), or deleted (RhoA-Δ) CAAX sequence. Polymerase chain reaction amplification of pEXVmyc-tagWTRhoA and pEXVmyc-tagV14RhoA (a generous gift of A. Hall, London) were done with the forward primer (CCCAAGCTTGCGGCCGCATGGAGCAGAAGCTGATCTCC) and the reverse primers (RhoA-CLVL, GGAATTCGGATCCTCACAAGACAAGGCAACCAGA; RhoA-CVLS, GGAATTCGGATCCTCACGAAAGGACGCAACCAGATTTTTTCTTCCCACGTC; and RhoA-Δ, GGAATTCGGATCCTCAACCAGATTTTTTCTTCCCACGTCTAGC), respectively. The amplified fragments digested by NotI and BamHI were ligated with pCMV-intronA plasmid (a generous gift of Dr. J. Baar, Pittsburgh, PA) digested by NotI and BamHI, and an Ires-Zeo fragment obtained from a BamHI digestion of the plasmid pUTEMCV (Cayla S.A., Toulouse, France) was added. The coding region of RhoGDI-1 was isolated by reverse transcription-polymerase chain reaction from human fibroblasts by using specific primers (forward primer, 5′-GCTAAGCTTGGGATCCGCTGAGCAGGAG-3′, and reverse primer, 5′-CCGGAATTCGGCTCAGTCCTTCCAGTCCTTCTTGATG-3′) and subcloned into the bacterial glutathione S-transferase (GST) expression vector pGST-Parallel2 (generously provided by P. Sheffield) as anBamHI/EcoRI fragment. pSRE was provided by Dr. R. Jove (H. Lee Moffitt Cancer Center, Tampa, FL) and p21P containing the full-length sequence of p21WAFpromoter was provided by Dr. X.-F. Wang (Duke University Medical Center, Durham, NC). pCMV-βgal was used to normalize for transfection efficiency. COS-7 and NIH-3T3 cells were grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% FCS, at 37 °C in a humidified incubator containing 5% CO2. COS-7 cells and NIH-3T3 cell lines transiently and stably expressing, respectively, the RhoA mutants Ha-RasL61 or Ha-RasL61/V14RhoA were generated by transfection using LipofectAMINETM Reagent Plus method as indicated by the supplier (Life Technologies, Inc.), followed by selection for NIH-3T3 cell lines with 200 μg/ml of ZeocinTM (Cayla S.A.) for RhoA, 1 mg/ml of Geneticin® (Life Technologies, Inc.) for Ha-RasL61 and 200 μg/ml of ZeocinTM plus 1 mg/ml of Geneticin® for Ha-RasL61/RhoA. Cell clones were expanded into mass culture, and RhoA and Ha-RasL61 protein expression were analyzed by Western blotting (as described below). NIH-3T3 cell lines expressing the RhoA constructs were plated in DMEM, 10% FCS with 3 × 105 cells in 100-mm Petri dishes on day 1 and treated with either vehicle, 10 μm FTI-277 or 10 μmGGTI-298, on days 2 and 3. The cells were harvested on day 4 and lysed in lysis buffer (30 mm Hepes, pH 7.5, 1% Triton X-100, 10% glycerol, 10 mm NaCl, 25 mm NaF, 5 mm MgCl2, 2 mm NaVO4, 1 mm EDTA, 10 μg/ml trypsin inhibitor, 25 μg/ml leupeptin, 10 μg/ml pepstatin, 2 mm phenylmethylsulfonyl fluoride, 6.4 mg/ml phosphate substrate; Sigma 104®). 30 μg of the cleared lysates were separated on a 12.5% SDS-polyacrylamide gel, blotted to nitrocellulose membranes (Gelman), and incubated with antibodies against RhoA (26-C4, Santa Cruz Biotechnology), Rap1A/Krev-1 (C-065, Santa Cruz Biotechnology), or Ha-Ras (C-20, Santa Cruz Biotechnology), respectively. Detection was performed using peroxidase-conjugated secondary antibodies (Bio-Rad) and an ECL chemiluminescence detection kit (Amersham Pharmacia Biotech) Cells were harvested in 20 mm Tris, pH 8, 5 mm MgCl2, 10 mm NaCl, 1 mm EDTA, with 1 mm dithiothreitol, 1% Triton X-114, and protease and phosphatase inhibitors as above. Membrane and cytosolic proteins were separated in two phases (pellet containing membranes and supernatant containing cytosolic proteins) by Triton X-114 partitioning at 30 °C as described by Bordier (43Bordier C. J. Biol. Chem. 1981; 256: 1604-1607Abstract Full Text PDF PubMed Google Scholar), which were separated by SDS-polyacrylamide gel electrophoresis and blotted to nitrocellulose membranes. Nitrocellulose membranes were then incubated with antibodies against the Myc tag of RhoA proteins (mouse anti-c-Myc from Calbiochem). Detection was performed as described above. GST-RhoGDI-1 fusion protein expression and purification was done as described by Sheffield et al. (44Sheffield P. Garrard S. Derewenda Z. Protein Expression Purif. 1999; 15: 34-39Crossref PubMed Scopus (539) Google Scholar). For in vitro interaction assay 30 μl of glutathione-Sepharose beads (Amersham Pharmacia Biotech) were preincubated with 100 μg of bacterial overexpressed GST-RhoGDI soluble extract for 2 h at 4 °C, washed with interaction buffer (50 mm Tris-HCl pH 8.5, 150 mm NaCl), then incubated with 100 μg of cell homogenates diluted in 500 μl of interaction buffer, and incubated overnight at 4 °C. Sepharose beads were next washed twice with interaction buffer and resuspended directly in Laemmli buffer. RhoA content was analyzed by SDS-polyacrylamide gel electrophoresis followed by Western blot with anti-Myc antibodies. Cells were seeded on glass coverslips into six-well plates (Nunc) at a density of 8 × 104cells/well in DMEM 10% FCS. 48 h later cells were serum-starved for 48 h. Then cells were fixed in 3% paraformaldehyde and permeabilized into 0.1% Triton X-100 in phosphate-buffered saline. Actin fibers were detected by incubation with tetramethylrhodamine isothiocyanate-labeled phalloidin (Molecular Probes). RhoA and vinculin were detected with anti-c-Myc (Calbiochem) or anti-vinculin antibodies (Sigma Immuno Chemical), respectively, and fluorescein isothiocyanate-conjugated anti-mouse IgG antibody (Sigma Immuno Chemical). Cells were viewed on a Zeiss Axiophot microscope, and pictures were taken with a Princeton camera. NIH-3T3 cells were seeded at 2000 cells/well in a 96-well plates six times on day 0 in DMEM containing 10% or 2.5% FCS, and the amount of cells was evaluated on day 0 (6 h post-plating) and at the intervals indicated in the figure legends by a MTT test as described previously (45Berton M. Sixou S. Kravtzoff R. Dartigues C. Imbertie L. Allal C. Favre G. Biochim. Biophys. Acta. 1997; 1355: 7-19Crossref PubMed Scopus (29) Google Scholar). NIH-3T3 cell lines expressing the V14RhoA constructs were seeded at 25000 cells in a 25-cm2flask. Cell foci were scored 15 days after confluence after fixing with AFA (ethanol/formol/acetic acid, 75/20/5) and staining with crystal violet. For plating efficiency assays, NIH-3T3 cells were seeded at 400 cells/60-mm culture dishes in DMEM 10% or 2.5% FCS. Cell plating efficiency was scored 10 or 15 days later, respectively, by fixing with AFA and staining with crystal violet. Cells were seeded at 16,000 cells/well in 12-well plates in triplicate in 0.3% agar over a 0.6% agar layer as described elsewhere (46Lerner E.A. Zhang T.-T. Knowles D.B. Qian Y. Hamilton A.D. Sebti S.M. Oncogene. 1997; 15: 1283-1288Crossref PubMed Scopus (217) Google Scholar). Cells were fed twice weekly until colonies grew to a suitable size for observation (about 12 days). Colonies were photographed after 4 h of incubation with 1 mg/ml MTT in DMEM at 37 °C. The growth of colonies of cell lines expressing V14RhoA or Ha-RasL61/V14RhoA constructs was compared with the control colonies expressing Ha-RasL61. NIH-3T3 cells were seeded at 2 × 105/well in six-well plates. 24 h later they were transfected with 0.5 μg of pSRE or p21WAF, 0.2 μg of pCMV-βgal and 1 μg of pCMV-V14RhoA-CLVL, pCMV-V14RhoA-CVLS, or pCMV-V14RhoA-Δ using LipofectAMINETM Reagent Plus as indicated by the supplier. 15 h after transfection, the cells were replenished with fresh growth medium. For p21WAF promoter activity analysis cells were harvested 30 h later and lysed in 200 μl of lysis buffer (Promega). For SRE activity analysis, 24 h after transfection cells were washed twice with phosphate-buffered saline and incubated in DMEM supplemented with 0.5% FCS during the next 24 h, before harvesting and lysis. Cell extracts were used for β-galactosidase (CLONTECH) and luciferase (Promega) assays. To evaluate the role of prenyl group and of its nature (C15 farnesyl or C20 geranylgeranyl) in RhoA functions we generated RhoA mutants by altering the CAAX sequence to render RhoA a substrate either of geranylgeranyltransferase I or farnesyltransferase or not prenylated. Using standard polymerase chain reaction mutagenesis, the CLVL sequence of RhoA (Rho-CLVL) was either replaced by the CAAX box of the farnesylated Ha-Ras protein (RhoA-CVLS) or deleted (RhoA-Δ). The plasmids encoding these RhoA mutants were transfected in the murine NIH-3T3 fibroblasts. Expression of RhoA was controlled by Western blot in 10 different clones picked for each construction. Representative clones with similar expression level to each other were selected (Fig.1). We determined the prenylation status of each V14RhoA mutant by using FTI-277 and GGTI-298, specific inhibitors of FTase and GGTase I, respectively. NIH-3T3 cells expressing either V14RhoA-CLVL or V14RhoA-CVLS were treated with FTI-277 or GGTI-298, and the lysates were analyzed for inhibition of prenylation of Ha-Ras (exclusively farnesylated control), Rap1A (exclusively geranylgeranylated control), RhoA-CLVL, and RhoA-CVLS, by Western blotting as described under “Experimental Procedures.” As expected, treatment with FTI-277 resulted in inhibition of farnesylation of Ha-Ras but had no effects on the geranylgeranylation of Rap1A (Fig. 1). Similarly, GGTI-298 inhibited the geranylgeranylation of Rap1A without any effects on the farnesylation of Ha-Ras. Fig. 1 also shows that FTI-277 inhibited the prenylation of RhoA-CVLS but not RhoA-CLVL, whereas GGTI-298 inhibited the prenylation of RhoA-CLVL but not RhoA-CVLS. These results suggest that RhoA-CVLS is exclusively farnesylated, whereas RhoA-CLVL is exclusively geranylgeranylated. The prenylation status of a protein being important for its proper subcellular localization (23Adamson P. Paterson H.F. Hall A. J. Cell Biol. 1992; 119: 617-627Crossref PubMed Scopus (332) Google Scholar), we checked the localization of the RhoA mutants by immunofluorescence. V14RhoA-CLVL cells displayed a diffuse staining throughout the cytoplasmic compartment (Fig.2 A) with an increased staining in the perinuclear area of some cells. RhoA-CVLS cells showed a similar pattern of fluorescence (Fig. 2 A). In contrast RhoA-Δ staining was not confined to a specific subcellular compartment but was rather spread throughout the whole cell (Fig. 2 A). This pattern was also observed when all of RhoA mutants were treated with lovastatin, a potent inhibitor of prenylation (data not shown), confirming that prenylation is essential for proper protein subcellular localization. We next analyzed the subcellular localization of RhoA mutants by Western blot after separation of cell homogenates in cytosol and membrane proteins by Triton X114 partitioning as described under “Experimental Procedures.” As shown in Fig. 2 Bunprenylated V14RhoA was essentially associated with the cytosolic fraction, whereas prenylated RhoA, either farnesylated or geranylgeranylated, was distributed in both fractions. About 40% of prenylated V14RhoA expressed in NIH-3T3 cells was observed in membrane fraction. When analyzed in COS-7 cells after transient expression, prenylated V14RhoA display a similar subcellular distribution, whereas wild type RhoA was essentially found in cytosol fraction (data not shown), illustrating the shift toward the membrane of RhoA GTPase after activation but only when prenylated. These results together confirmed that prenylation is essential for proper protein subcellular localization and also indicated that farnesyl can substitute for geranylgeranyl without any dramatic effect on RhoA subcellular localization. Although it was well established that isoprenoid modification of RhoA is required for interaction with RhoGDI (24Hori Y. Kikuchi A. Isomura M. Katayama M. Miura Y. Fujioka H. Kaibuchi K. Takai Y. Oncogene. 1991; 6: 515-522PubMed Google Scholar, 47Hancock J.F. Hall A. EMBO J. 1993; 12: 1915-1921Crossref PubMed Scopus (100) Google Scholar), it is still not known whether prenylation of RhoA has to be specific. To assess the role of isoprenoid the in vitro interaction of RhoA mutants with GST-RhoGDI-1 was examined. Because it was described that RhoGDI-1 binds poorly RhoA-GTP (48Ueda T. Kikuchi A. Ohga N. Yamamoto J. Takai Y. J. Biol. Chem. 1990; 265: 9373-9380Abstract Full Text PDF PubMed Google Scholar, 49Sasaki T. Kato M. Takai Y. J. Biol. Chem. 1993; 268: 23959-23963Abstract Full Text PDF PubMed Google Scholar), we used COS-7 cells transfected transiently with wild type RhoA bearing or deleted of the different CAAX boxes. We found as expected that nonprenylated RhoA was unable to bind GST-RhoGDI-1 (Fig.3). In contrast geranylgeranylated as well as farnesylated RhoA strongly interacted with GST-RhoGDI-1. As illustrated by the quantitation of the signal of precipitated RhoA normalized by the signal of total RhoA on Western blot, GST-RhoGDI-1 appeared to bind equal levels of both farnesylated and geranylgeranylated RhoA (Fig. 3). The Rho protein family whose members include RhoA has been shown to influence a number of cellular processes including actin stress fiber organization, cell adhesion, cell proliferation, and transformation. We next determined whether prenylation and moreover the nature of the added prenyl group play a role on RhoA implication on actin stress fibers and focal adhesions. We observed that whereas NIH-3T3 fibroblasts transfected with the empty vector (mock) or V14RhoA-Δ have conserved a typical fibroblast morphology, V14RhoA-CLVL and V14RhoA-CLVS expressing cells were smaller and displayed a more epithelial-like morphology (Fig.4 A). Similar changes of cell size were observed in Swiss 3T3 cells microinjected with active RhoA (3Paterson H.F. Self A.J. Garrett M.D. Just J. Aktories K. Hall A. J. Cell Biol. 1990; 111: 1001-1007Crossref PubMed Scopus (571) Google Scholar) as well as in murine tumor cells (50Ghosh P.M. Ghosh-Choudhury N. Moyer M.L. Mott G.E. Thomas C.A. Foster B.A. Greenberg N.M. Kreisberg J.I. Oncogene. 1999; 18: 4120-4130Crossref PubMed Scopus (93) Google Scholar). To examine the effect of the V14RhoA mutants on stress fibers and focal adhesions, the cells were serum-starved for 48 h before analysis. Indeed removal of growth factors and LPA (a well known stimulator of RhoA functions) from culture medium led to the reduction of actin stress fiber content in mock and V14RhoA-Δ cells (Fig.4 B). In contrast, under these conditions V14RhoA-CLVL and V14RhoA-CLVS cells displayed well preserved stress fibers (Fig.4 B). In parallel experiments, vinculin immunostaining showed that in V14RhoA-CLVL and V14RhoA-CLVS but not V14RhoA-Δ expressing cells a retention of numerous focal adhesions in the absence of serum (Fig. 4 B). These results would indicate that prenylation is required for RhoA implication in stress fibers and focal adhesions and that geranylgeranylation could be substituted for by farnesylation. We next assessed the role of the prenylation of RhoA on cell growth. Mock-transfected NIH-3T3 cells and those expressing V14RhoA-CLVL, V14RhoA-CVLS, or V14RhoA-Δ maintained in DMEM supplemented with 10% FCS displayed similar growth rate (Fig.5 A). However, in lower serum concentration (2.5%), V14RhoA-CLVL and -CVLS cells showed a significantly higher growth rate than mock and V14RhoA-Δ cells (Fig.5 B), indicating that prenylated V14RhoA expression reduced the serum requirement of the NIH-3T3 cells as described by Peronaet al. (9Perona R. Esteve P. Jimenez B. Ballestero R.P. Ramon y Cajal S. Lacal J.C. Oncogene. 1993; 8: 1285-1292PubMed Google Scholar). We next determined whether the ability of RhoA to transform cells depends on its geranylgeranylation and whether farnesylated RhoA remains transforming. To this end, we have compared various V14RhoA mutants in focus formation, plating efficiency, and anchorage-independent growth assays. For the focus formation assay, NIH-3T3 cells stably expressing V14RhoA mutants were seeded at 25,000 cells/25-cm2 flask, and cell foci were scored 12 days later. Whereas mock and V14RhoA-Δ cells grew in a monolayer, V14RhoA-CLVL or CVLS cells grew at higher density and forme" @default.
• W2051820912 created "2016-06-24" @default.
• W2051820912 creator A5006552617 @default.
• W2051820912 creator A5009088330 @default.
• W2051820912 creator A5016714363 @default.
• W2051820912 creator A5020171805 @default.
• W2051820912 creator A5025392006 @default.
• W2051820912 creator A5041795619 @default.
• W2051820912 creator A5043171058 @default.
• W2051820912 creator A5044268981 @default.
• W2051820912 creator A5056350826 @default.
• W2051820912 date "2000-10-01" @default.
• W2051820912 modified "2023-09-27" @default.
• W2051820912 title "RhoA Prenylation Is Required for Promotion of Cell Growth and Transformation and Cytoskeleton Organization but Not for Induction of Serum Response Element Transcription" @default.
• W2051820912 cites W129191972 @default.
• W2051820912 cites W135693399 @default.
• W2051820912 cites W1485670014 @default.
• W2051820912 cites W1503798699 @default.
• W2051820912 cites W1508733750 @default.
• W2051820912 cites W1524121247 @default.
• W2051820912 cites W1562863690 @default.
• W2051820912 cites W1602846778 @default.
• W2051820912 cites W1656440259 @default.
• W2051820912 cites W1784068511 @default.
• W2051820912 cites W1805425496 @default.
• W2051820912 cites W1860329500 @default.
• W2051820912 cites W1949772429 @default.
• W2051820912 cites W1967237098 @default.
• W2051820912 cites W1967787845 @default.
• W2051820912 cites W1970338715 @default.
• W2051820912 cites W1972049776 @default.
• W2051820912 cites W1972317299 @default.
• W2051820912 cites W1981693330 @default.
• W2051820912 cites W1982933055 @default.
• W2051820912 cites W1985169370 @default.
• W2051820912 cites W1985238450 @default.
• W2051820912 cites W1993418815 @default.
• W2051820912 cites W1999371689 @default.
• W2051820912 cites W1999760871 @default.
• W2051820912 cites W2001330472 @default.
• W2051820912 cites W2001626727 @default.
• W2051820912 cites W2006740795 @default.
• W2051820912 cites W2010207338 @default.
• W2051820912 cites W2014018734 @default.
• W2051820912 cites W2017098460 @default.
• W2051820912 cites W2018724145 @default.
• W2051820912 cites W2029872541 @default.
• W2051820912 cites W2030317576 @default.
• W2051820912 cites W2032045788 @default.
• W2051820912 cites W2041797751 @default.
• W2051820912 cites W2047193832 @default.
• W2051820912 cites W2053257956 @default.
• W2051820912 cites W2059585924 @default.
• W2051820912 cites W2060264934 @default.
• W2051820912 cites W2061302578 @default.
• W2051820912 cites W2065129648 @default.
• W2051820912 cites W2070075606 @default.
• W2051820912 cites W2074385612 @default.
• W2051820912 cites W2075398040 @default.
• W2051820912 cites W2082595075 @default.
• W2051820912 cites W2086589373 @default.
• W2051820912 cites W2087172814 @default.
• W2051820912 cites W2090305070 @default.
• W2051820912 cites W2096791952 @default.
• W2051820912 cites W2098806204 @default.
• W2051820912 cites W2104297703 @default.
• W2051820912 cites W2108915404 @default.
• W2051820912 cites W2133837411 @default.
• W2051820912 cites W2146055738 @default.
• W2051820912 cites W2165297096 @default.
• W2051820912 cites W2168062869 @default.
• W2051820912 cites W2170906235 @default.
• W2051820912 cites W2176744910 @default.
• W2051820912 cites W2343488873 @default.
• W2051820912 doi "https://doi.org/10.1074/jbc.m005264200" @default.
• W2051820912 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10896672" @default.
• W2051820912 hasPublicationYear "2000" @default.
• W2051820912 type Work @default.
• W2051820912 sameAs 2051820912 @default.
• W2051820912 citedByCount "102" @default.
• W2051820912 countsByYear W20518209122012 @default.
• W2051820912 countsByYear W20518209122013 @default.
• W2051820912 countsByYear W20518209122014 @default.
• W2051820912 countsByYear W20518209122015 @default.
• W2051820912 countsByYear W20518209122016 @default.
• W2051820912 countsByYear W20518209122017 @default.
• W2051820912 countsByYear W20518209122018 @default.
• W2051820912 countsByYear W20518209122019 @default.
• W2051820912 countsByYear W20518209122020 @default.
• W2051820912 countsByYear W20518209122021 @default.
• W2051820912 countsByYear W20518209122022 @default.
• W2051820912 countsByYear W20518209122023 @default.
• W2051820912 crossrefType "journal-article" @default.
• W2051820912 hasAuthorship W2051820912A5006552617 @default.
• W2051820912 hasAuthorship W2051820912A5009088330 @default.
• W2051820912 hasAuthorship W2051820912A5016714363 @default.
• W2051820912 hasAuthorship W2051820912A5020171805 @default.
• W2051820912 hasAuthorship W2051820912A5025392006 @default.

• next