FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2052207790> ?p ?o ?g. }

• W2052207790 endingPage "21293" @default.
• W2052207790 startingPage "21287" @default.
• W2052207790 abstract "It is generally believed that alterations of calcium homeostasis play a key role in skeletal muscle atrophy and degeneration observed in Duchenne's muscular dystrophy and mdx mice. Mechanical activity is also impaired in gastrointestinal muscles, but the cellular and molecular mechanisms of this pathological state have not yet been investigated. We showed, in mdx duodenal myocytes, that both caffeine- and depolarization-induced calcium responses were inhibited, whereas acetylcholine- and thapsigargin-induced calcium responses were not significantly affected compared with control mice. Calcium-induced calcium release efficiency was impaired in mdx duodenal myocytes depending only on inhibition of ryanodine receptor expression. Duodenal myocytes expressed both type 2 and type 3 ryanodine receptors and were unable to produce calcium sparks. In control and mdx duodenal myocytes, both caffeine- and depolarization-induced calcium responses were dose-dependently and specifically inhibited with the anti-type 2 ryanodine receptor antibody. A strong inhibition of type 2 ryanodine receptor in mdx duodenal myocytes was observed on the mRNA as well as on the protein level. Taken together, our results suggest that inhibition of type 2 ryanodine receptor expression in mdx duodenal myocytes may account for the decreased calcium release from the sarcoplasmic reticulum and reduced mechanical activity. It is generally believed that alterations of calcium homeostasis play a key role in skeletal muscle atrophy and degeneration observed in Duchenne's muscular dystrophy and mdx mice. Mechanical activity is also impaired in gastrointestinal muscles, but the cellular and molecular mechanisms of this pathological state have not yet been investigated. We showed, in mdx duodenal myocytes, that both caffeine- and depolarization-induced calcium responses were inhibited, whereas acetylcholine- and thapsigargin-induced calcium responses were not significantly affected compared with control mice. Calcium-induced calcium release efficiency was impaired in mdx duodenal myocytes depending only on inhibition of ryanodine receptor expression. Duodenal myocytes expressed both type 2 and type 3 ryanodine receptors and were unable to produce calcium sparks. In control and mdx duodenal myocytes, both caffeine- and depolarization-induced calcium responses were dose-dependently and specifically inhibited with the anti-type 2 ryanodine receptor antibody. A strong inhibition of type 2 ryanodine receptor in mdx duodenal myocytes was observed on the mRNA as well as on the protein level. Taken together, our results suggest that inhibition of type 2 ryanodine receptor expression in mdx duodenal myocytes may account for the decreased calcium release from the sarcoplasmic reticulum and reduced mechanical activity. Dystrophin is a cytoskeletal structural protein present in skeletal, cardiac, and smooth muscles (1Gillis J.M. J. Muscle Res. Cell Motil. 1999; 20: 605-625Crossref PubMed Scopus (142) Google Scholar). Although it is well established that the lack of dystrophin expression is the primary genetic defect in Duchenne's muscular dystrophy, functionality of smooth muscles in patients with Duchenne's muscular dystrophy and in mdx mice has received little attention. However, different degrees of disorders have been observed in mdx smooth muscles of the digestive track (impaired nitrergic relaxation and increase of spontaneous tone, Refs. 2Baccari M.C. Romagnani P. Calamai F. Neurosci. Lett. 2000; 282: 105-108Crossref PubMed Scopus (32) Google Scholar and 3Mule F. Serio R. Gastroenterology. 2001; 120: 1430-1437Abstract Full Text Full Text PDF PubMed Google Scholar), and different clinical manifestations, including gastric dilatation and intestinal pseudo-obstructions, have been reported in patients with Duchenne's muscular dystrophy (4Barohn R.J. Levine E.J. Olson J.O. Mendell J.R. N. Engl. J. Med. 1988; 319: 15-18Crossref PubMed Scopus (131) Google Scholar, 5Leon S.H. Schuffler M.D. Kettler M. Rohrmann C.A. Gastroenterology. 1986; 90: 455-459Abstract Full Text PDF PubMed Google Scholar). The role of dystrophin in smooth muscle contraction is still largely unknown. In skeletal and cardiac muscles, it has been suggested that an elevation in [Ca2+]i under resting conditions may activate Ca2+-dependent proteases inducing muscle damage (1Gillis J.M. J. Muscle Res. Cell Motil. 1999; 20: 605-625Crossref PubMed Scopus (142) Google Scholar). In fact, some groups have found a difference in [Ca2+]i between normal and dystrophic skeletal muscles from patients and mdx mice (6Turner P.R. Westwood T. Regen C.M. Steinhardt R.A. Nature. 1988; 335: 735-738Crossref PubMed Scopus (360) Google Scholar, 7Bakker A.J. Head S.I. Williams D.A. Stephenson D.G. J. Physiol. 1993; 460: 1-13Crossref PubMed Scopus (81) Google Scholar). Other groups have not been able to confirm these data (8Collet C. Allard B. Tourneur Y. Jacquemond V. J. Physiol. 1999; 520: 417-429Crossref PubMed Scopus (61) Google Scholar), although an elevated subsarcolemmal Ca2+ concentration has been reported by studying activation of Ca2+-activated K+ channels (9Mallouk N. Jacquemond V. Allard B. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 4950-4955Crossref PubMed Scopus (137) Google Scholar). An increased Ca2+ influx through cationic channels has been detected in mdx skeletal fibers, suggesting that a dysregulation of channel activity may be involved in this neuromuscular disorder (10Vandebrouck C. Martin D. Colson-Van Schoor M. Debaix H. Gailly P. J. Cell Biol. 2002; 158: 1089-1096Crossref PubMed Scopus (280) Google Scholar). Controversial data also have been reported for the peak Ca2+ responses upon stimulation. Some groups have found larger Ca2+ rises in mdx mice (7Bakker A.J. Head S.I. Williams D.A. Stephenson D.G. J. Physiol. 1993; 460: 1-13Crossref PubMed Scopus (81) Google Scholar), others have found them to be similar to controls (11Head S.I. Williams D.A. Stephenson D.G. Proc. R. Soc. Lond. B Biol. Sci. 1992; 248: 163-169Crossref PubMed Scopus (111) Google Scholar), and some have even reported reductions (12Rivet-Bastide M. Imbert N. Cognard C. Duport G. Rideau Y. Raymond G. Cell Calcium. 1993; 14: 563-571Crossref PubMed Scopus (38) Google Scholar). A key aspect of the Ca2+ signaling pathway is represented by its spatial and temporal complexity. Localized changes in [Ca2+]i are pivotal events in triggering important cellular responses such as contraction, secretion, gene expression, and metabolic activation. In smooth muscle cells, Ca2+ release channels of the sarcoplasmic reticulum (SR) 1The abbreviations used are: SR, sarcoplasmic reticulum; ACh, acetylcholine; CICR, calcium-induced calcium release; RYR, ryanodine receptor; RT, reverse transcription; NSF, nonspecific fluorescence. 1The abbreviations used are: SR, sarcoplasmic reticulum; ACh, acetylcholine; CICR, calcium-induced calcium release; RYR, ryanodine receptor; RT, reverse transcription; NSF, nonspecific fluorescence. modulate the [Ca2+]i in response to activation of voltage-gated Ca2+ channels (13Arnaudeau S. Boittin F.X. Macrez N. Lavie J.L. Mironneau C. Mironneau J. Cell Calcium. 1997; 22: 399-411Crossref PubMed Scopus (38) Google Scholar) and membrane receptors (14Boittin F.X. Macrez N. Halet G. Mironneau J. Am. J. Physiol. 1999; 277: C139-C151Crossref PubMed Google Scholar, 15Boittin F.X. Coussin F. Morel J.L. Halet G. Macrez N. Mironneau J. Biochem. J. 2000; 349: 323-332Crossref PubMed Scopus (45) Google Scholar). In this study, we tested the hypothesis that, in visceral smooth muscle lacking dystrophin, the Ca2+ responses evoked by the Ca2+-induced Ca2+ release (CICR) mechanism could be affected by the mutation. We addressed this issue by using patch clamp technique coupled to confocal microscopy with Fluo-4 to analyze Ca2+ signals, binding experiments, and Western blotting to evaluate the expression of ryanodine receptors (RYRs) in duodenal myocytes from wild-type and mdx mice. We show for the first time that the RYR2 expression is impaired in mdx duodenal myocytes and that this alteration may account for the reduced Ca2+ responses evoked by caffeine and activation of voltage-gated Ca2+ channels. Cell Preparation—The investigation conformed with the European Community and French guiding principles in the care and use of animals. Authorization to perform animal experiments (A-33-063-003) was obtained from the Préfecture de la Gironde (France). Wild-type control (C57BL/10) and mdx (C57BL/10 mdx) mice aged 5-8 months were killed by cervical dislocation. Isolated myocytes were obtained from the longitudinal layer of the duodenum by enzymatic dispersion as described previously (16Morel J.L. Macrez N. Mironneau J. Br. J. Pharmacol. 1997; 121: 451-458Crossref PubMed Scopus (31) Google Scholar). Cells were seeded on glass slides in M199 culture medium containing 10% fetal calf serum, 2 mm glutamine, 1 mm pyruvate, 20 units/ml penicillin, and 20 μg/ml streptomycin. Cells were kept in an incubator gassed with 95% air and 5% CO2 at 37 °C and used within 8 h. Reverse Transcription-Polymerase Chain Reaction—Total RNA was extracted from freshly isolated mouse duodenal smooth muscle cells using an RNeasy minikit (Qiagen, Hilden, Germany) following the instructions of the supplier. The reverse transcription (RT) reaction was performed using a Sensiscript RT kit (Qiagen). Total RNA was incubated with oligo(dT) primers (Promega, Lyon, France) at 65 °C for 5 min. After a cooling time of 15 min at 25 °C, RT mixture was added, and the total mixture was incubated for 60 min at 37 °C. The resulting cDNA was stored at -20 °C. The PCR was performed with 1 μg of cDNA, 1.25 units of HotStart Taq DNA polymerase (Qiagen), a 1 μm concentration of each primer, and a 200 μm concentration of each deoxynucleotide triphosphate in a final volume of 50 μl. The PCR conditions were 95 °C for 15 min, then 25-35 cycles at 94 °C for 1 min, 60 °C (RYR1 and RYR2) or 56 °C (RYR3) for 1 min, and 72 °C for 1 min. At the end of PCR, samples were kept at 72 °C for 10 min for final extension and then stored at 4 °C. Reverse transcription and PCR were performed with a thermal cycler (Eppendorf, Le Pecq, France). Amplification products were separated by electrophoresis (2% agarose gel) and visualized by ethidium bromide staining. The minimum detection of RYR amplification products was obtained with 15 ng of cDNA. Gels were photographed with EDAS 120 and analyzed with KDS1D 2.0 software (Kodak Digital Science, Paris, France). The relative amount of the amplification products was determined and normalized to that of the glyceraldehyde-3-phosphate dehydrogenase fragment. The identity of the PCR products was verified by DNA sequencing. Sense (s) and antisense (as) primer pairs specific for RYR1, RYR2, and RYR3 were designed on the known cloned receptor sequences deposited in the GenBank™ sequence data base (accession numbers X83932, X83933, and X83934, respectively) with Lasergene software (DNASTAR, Madison, WI). The nucleotide sequence and the length of the expected PCR products (in parentheses), respectively, for each primer pair were as follows: RYR1(s), GAAGGTTCTGGACAAACACGGG; RYR1(as), TCGCTCTTGTTGTAGAATTTGCGG (435 bp); RYR2(s), GAATCAGTGAGTTACTGGGCATGG; RYR2(as), CTGGTCTGAGTTCTCCAAAAGC (635 bp); RYR3(s), AGAAGAGGCCAAAGCAGAGG; RYR3(as), GGAGGCCAACGGTCAGA (269 bp) (17Coussin F. Macrez N. Morel J.L. Mironneau J. J. Biol. Chem. 2000; 275: 9596-9603Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). Western Blot—The longitudinal layer of the duodenum from wild-type and mdx mice was homogenized in an appropriate volume of 10% SDS. After centrifugation (10 min, 2700 rpm), supernatants were collected, and the protein content was measured according to Bradford (18Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (215589) Google Scholar). Equal amounts of protein (50 μg) from wild-type and mdx tissues were heated at 95 °C for 3 min in Laemmli buffer, separated by 6% SDS-polyacrylamide gel electrophoresis, and electrically transferred to polyvinylidene difluoride membranes (70 min, 100 V, 4 °C). Nonspecific binding was blocked by incubating membrane in phosphate buffer/Tween 20 (0.1%) containing 5% nonfat dry milk for 1 h, and blots were incubated (overnight, 4 °C) with anti-RYR1 (1:1000), anti-RYR2 (1:500), or anti-RYR3 (1:500) antibody (19Jeyakumar L.H. Copello J.A. O'Malley A.M. Wu G.M. Grassucci R. Wagenknecht T. Fleischer S. J. Biol. Chem. 1998; 273: 16011-16020Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar, 20Jeyakumar L.H. Ballester L. Cheng D.S. McIntyre J.O. Chang P. Olivey H.E. Rollins-Smith L. Barnett J.V. Murray K. Xin H.B. Fleischer S. Biochim. Biophys. Res. Commun. 2001; 281: 979-986Crossref PubMed Scopus (100) Google Scholar). Primary antibodies were detected with a horseradish peroxidase-coupled secondary antibody (Santa Cruz Biotechnology, 1:3000). RYR subtypes were detected using an enhanced chemoluminescence kit (Amersham Biosciences), and proteins were quantified using the KDS1D 2.0 software. Fluorescence and Patch Clamp Measurements—Measurements of [Ca2+]i were performed, in part, with an Indo-1 setup as described elsewhere (16Morel J.L. Macrez N. Mironneau J. Br. J. Pharmacol. 1997; 121: 451-458Crossref PubMed Scopus (31) Google Scholar). Briefly cells were loaded either with 1 μm Indo-1 acetoxymethyl ester for 30 min or with 50 μm Indo-1 added to the pipette solution and entering the cells after establishment of the whole-cell recording mode. [Ca2+]i was estimated from the 405/480 nm fluorescence ratio using a calibration determined within cells (16Morel J.L. Macrez N. Mironneau J. Br. J. Pharmacol. 1997; 121: 451-458Crossref PubMed Scopus (31) Google Scholar). Briefly fluorescence ratios were calculated for each cell with a pipette solution containing 10 mm EGTA (Rmin) or after application of a 200-mV hyper-polarizing step causing membrane breakdown (Rmax). Rmin and Rmax values from control (n = 94) and mdx myocytes (n = 95) were 0.36 ± 0.05, 4.27 ± 0.03, 0.38 ± 0.05, and 4.44 ± 0.09, respectively. An intracellular value for the quantity K = Kdβ was determined according to Almers and Neher (21Almers W. Neher E. FEBS Lett. 1985; 192: 13-18Crossref PubMed Scopus (245) Google Scholar) in control and mdx duodenal myocytes. β is defined as F480 (at Rmin)/F480 (at Rmax). K values from control (n = 94) and mdx myocytes (n = 95) were 979 ± 116 and 1357 ± 376 nm, respectively. These parameters were used to calculate the [Ca2+]i values according to Grynkiewicz's formula (22Grynkiewicz G. Poenie M. Tsien R.Y. J. Biol. Chem. 1985; 260: 3440-3450Abstract Full Text PDF PubMed Scopus (80) Google Scholar). All measurements were made at 25 ± 1 °C. For other experiments, Fluo-4 (50 μm) was dialyzed into the cell through the patch clamp pipette. Images were acquired using the line scan mode of a confocal Bio-Rad MRC1024 microscope connected to a Nikon Diaphot microscope. Excitation light was delivered by a 25-milliwatt argon ion laser (Ion Laser Technology, Salt Lake City, UT) through a Nikon Plan Apo ×60, 1.4 numerical aperture objective lens. Fluo-4 was excited at 488 nm, and emitted fluorescence was filtered and measured at 522 ± 35 nm. At the setting used to detect Fluo-4 fluorescence, the resolution of the microscope was near 0.4 × 0.4 × 1.5 μm (x, y, and z axis). Scanned lines were plotted vertically, and each line was added to the right of the preceding line to form the line scan image. Fluorescence signals are expressed as pixel per pixel fluorescence ratios (F/F0) where F is the fluorescence during a response and F0 is the rest level fluorescence of the same pixel. Image processing and analysis were performed by using Lasersharp 2000 (Bio-Rad) and IDL softwares (Research Systems, Inc., Boulder, CO). Voltage clamp was made with a standard patch clamp technique using a List EPC-7 patch clamp amplifier (Darmstadt-Eberstadt, Germany). Patch pipettes had resistances of 3-4 megaohms. Anti-ryanodine receptor antibodies were added to the pipette solution to allow dialysis of the cell after a breakthrough in whole-cell recording mode for at least 5 min, a time longer than that expected for diffusion of substances in solution (23Viard P. Exner T. Maier U. Mironneau J. Nurnberg B. Macrez N. FASEB J. 1999; 13: 685-694Crossref PubMed Scopus (108) Google Scholar). Flash Photolysis—Caged Ca2+, 1-(4,5-dimethoxy-2-nitrophenyl) EDTA (1 mm, in the presence of 0.25 mm CaCl2) was introduced into the cell via the patch clamp pipette with 5 min allowed for equilibration. Photolysis was produced by a 1-ms pulse from a xenon flash lamp (Hi-Tech Scientific, Salisbury, UK) focused to a ∼2-mm-diameter spot around the cell. Light was band pass-filtered with a UG11 glass between 300 and 350 mm. Flash intensity could be adjusted by varying the capacitor-charging voltage between 0 and 380 V, which corresponded to a change in the energy input into the flash lamp from 0 to 240 J. On flash photolysis, Ca2+ was released within 2-4 ms, and the small percentage of conversion of the caged compound (∼20%) allows the application of a second pulse without altering the Ca2+ responses (13Arnaudeau S. Boittin F.X. Macrez N. Lavie J.L. Mironneau C. Mironneau J. Cell Calcium. 1997; 22: 399-411Crossref PubMed Scopus (38) Google Scholar, 24Escobar A.L. Cifuentes F. Vergara J.L. FEBS Lett. 1995; 364: 335-338Crossref PubMed Scopus (42) Google Scholar). RYR Immunostaining—Myocytes were washed with phosphate-buffered saline, fixed with 4% (v/v) formaldehyde and 0.5% glutaraldehyde for 10 min at room temperature, and permeabilized in phosphate-buffered saline containing 3% fetal calf serum and 1 mg/ml saponin for 20 min. Cells were incubated with phosphate-buffered saline, saponin (1 mg/ml), and either specific anti-RYR2 or anti-RYR3 antibody (1 μg/ml) overnight at 4 °C (25Mironneau J. Coussin F. Jeyakumar L.H. Fleischer S. Mironneau C. Macrez N. J. Biol. Chem. 2001; 276: 11257-11264Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). Then cells were washed (4 × 5 min) and incubated with the appropriate secondary antibody conjugated to fluorescein isothiocyanate for 45 min at room temperature. After washing in phosphate-buffered saline, cells were mounted in Vectashield (Ab-Cys, Paris, France). Images of the stained cells were obtained with a confocal microscope (Bio-Rad MRC1024), and fluorescence was estimated by gray level analysis using Laserpix software (Bio-Rad) in 0.5-μm confocal sections. On each cell, fluorescence was acquired from a z-series analysis (20 ± 5 sections) using Lasersharp software (Bio-Rad) and expressed by volume unit. Cells were compared by keeping acquisition parameters (gray scale, exposure time, iris aperture, gain, laser power, etc.) constant. Nonspecific fluorescence (NSF) was determined when specific anti-RYR subtype antibody was preincubated with its antigen peptide for 1 h before application of the immunostaining protocol. When the cell fluorescence obtained with the anti-RYR sub-type antibody was higher than NSF, the cell was considered to be immunopositive, and specific fluorescence (F - NSF) was estimated. [3H]Ryanodine Binding Assay—Microsomal membranes from the longitudinal layer of mouse duodenum were prepared by homogenization with a Kontes Potter-Elvehjem pestle in a solution containing 20 mm Tris-HCl, 1 mm EGTA, and 1 mm phenylmethylsulfonyl fluoride, pH 7. The homogenate was centrifuged at 1200 rpm for 10 min at 4 °C. Microsomal membranes were obtained as a pellet by centrifugation of the supernatant at 40,000 rpm for 90 min at 4 °C. Microsomal membranes were then resuspended in the buffer and stored at -80 °C. Protein concentration was determined according to Bradford (18Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (215589) Google Scholar). [3H]Ryanodine binding was carried out as described previously (26Morel J.L. Boittin F.X. Halet G. Arnaudeau S. Mironneau C. Mironneau J. Am. J. Physiol. 1997; 273: H2867-H2875PubMed Google Scholar). For saturation experiments, the incubation medium contained 1 m KCl, 25 mm HEPES (pH 7.4 at 37 °C), and 0.1 mm CaCl2. After a 3-h incubation at 37 °C, aliquots were filtered through Whatmann GF/C glass fiber filters and washed three times with 8 ml of ice-cold 0.1 m Tris (pH 7.4 at 4 °C). The filters were placed into scintillation vials containing 4 ml of liquid scintillation mixture, and the retained radioactivity was measured in a Packard 1500 Tri-Carb counter. The specific binding was defined as the difference between binding in the absence (total binding) and in the presence (nonspecific binding) of 10 μm ruthenium red. Nonspecific binding accounted for less than 5% of total binding at 2 nm [3H]ryanodine. Solutions—The physiological solution contained 130 mm NaCl, 5.6 mm KCl, 1 mm MgCl2, 2 mm CaCl2, 11 mm glucose, and 10 mm HEPES, pH 7.4 with NaOH. The basic pipette solution contained 130 mm CsCl, 10 mm HEPES, pH 7.3 with CsOH. Acetylcholine and active compounds were applied to the recorded cell by pressure ejection for the period indicated on the records. Chemicals and Drugs—Collagenase was obtained from Worthington (Freehold, NJ). M199 medium, streptomycin, penicillin, glutamine, and pyruvate were from Invitrogen. Fetal calf serum was from BioMedia (Boussens, France). Indo-1 and Indo-1 acetoxymethyl ester were from Calbiochem. Fluo-4 was from Molecular Probes (Interchim, Montluçon, France). All other products were from Sigma. The rabbit anti-RYR3-specific antibody was directed against the deduced amino acid sequence, residues 4326-4336 (11 amino acids), of rabbit RYR3 (19Jeyakumar L.H. Copello J.A. O'Malley A.M. Wu G.M. Grassucci R. Wagenknecht T. Fleischer S. J. Biol. Chem. 1998; 273: 16011-16020Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). The rabbit anti-RYR2-specific antibody was directed against the deduced amino acid sequence, residues 1344-1365 (22 amino acids), of rabbit RYR2 (20Jeyakumar L.H. Ballester L. Cheng D.S. McIntyre J.O. Chang P. Olivey H.E. Rollins-Smith L. Barnett J.V. Murray K. Xin H.B. Fleischer S. Biochim. Biophys. Res. Commun. 2001; 281: 979-986Crossref PubMed Scopus (100) Google Scholar). Data Analysis—Data are expressed as means ± S.E.; n represents the number of cells or experiments. Significance was tested by means of paired Student's t test when cells were their own control; otherwise an unpaired t test was used. p values <0.05 were considered significant. Ca2+ Responses in Duodenal Myocytes from mdx Mice—In control duodenal myocytes from C57BL/10 mice, dystrophin was present and located at the periphery of the cell sections, whereas dystrophin was absent in mdx mice (not shown). In freshly isolated single myocytes from control and mdx mice, the resting [Ca2+]i levels were estimated to be 61 ± 5 nm (n = 94) and 59 ± 5nm (n = 95), respectively, and were not significantly different (p > 0.05). Applications of caffeine (10 mm) or acetylcholine (ACh, 10 μm) activated transient increases in [Ca2+]i that have been shown to depend essentially on Ca2+ release from the SR (16Morel J.L. Macrez N. Mironneau J. Br. J. Pharmacol. 1997; 121: 451-458Crossref PubMed Scopus (31) Google Scholar). With time intervals of 3 min between successive applications of the stimulating substances, similar Ca2+ responses were obtained in the same cell, indicating complete refilling of the internal Ca2+ store within 3 min (16Morel J.L. Macrez N. Mironneau J. Br. J. Pharmacol. 1997; 121: 451-458Crossref PubMed Scopus (31) Google Scholar). As shown in Fig. 1, the caffeine-induced Ca2+ responses were decreased by about 50% in mdx duodenal myocytes, whereas the ACh-induced Ca2+ responses were not significantly reduced when compared with control mice. As caffeine is known as a pharmacological activator of RYRs, we tested the effects of membrane depolarizations on Ca2+-induced Ca2+ release. In control mice, maximal Ca2+ inward currents in response to depolarizing steps from -70 to 0 mV triggered maximal transient Ca2+ responses (Fig. 2A). In mdx mice, the Ca2+ responses were reduced by about 45%, whereas the Ca2+ currents were similar (Fig. 2, A and B). Quantitative results indicated that Ca2+ current densities evoked by a depolarizing step from -70 to 0 mV were similar in control (13.4 ± 1.4 pA/picofarad, n = 13) and mdx mice (14.1 ± 1.1 pA/picofarad, n = 14). This current is due to activation of two different types of calcium channels: a typical L-type calcium channel and a second type resistant to dihydropyridines but inhibited by mapacalcine (27Morel J.L. Drobecq H. Sautière P. Tartar A. Mironneau J. Quar J. Lavie J.L. Hugues M. Mol. Pharmacol. 1997; 51: 1042-1052Crossref PubMed Scopus (16) Google Scholar). It is noteworthy that, in the presence of a mixture of 1 μm oxodipine and 5 μm mapacalcine for 5 min to block sarcolemmal Ca2+ channels, both inward current and increase in [Ca2+]i were suppressed during test depolarizations in control and mdx mice (not shown). As illustrated by the current-voltage relationships in Fig. 2B, the threshold potential and the potential corresponding to peak current were not different in control and mdx mice. The Δ[Ca2+]i-voltage relationship revealed that, in mdx mice, the peak Ca2+ responses were significantly reduced in the voltage range from -10 to +20 mV (Fig. 2B). To establish whether mdx mutation may reduce the loading of the intracellular Ca2+ store, we studied the effect of thapsigargin (a SR Ca2+ ATPase inhibitor) to deplete the SR. In myocytes from control mice, application of 1 μm thapsigargin (in Ca2+-free 0.5 mm EGTA-containing solution for 30 s) evoked a sustained increase in [Ca2+]i of 112 ± 14 nm (n = 11). In mdx mice, the thapsigargin-induced Ca2+ response was not significantly affected (110 ± 21 nm, n = 13). Taken together, these results indicate that, in mdx mice, the decrease of Ca2+ responses evoked by caffeine and depolarizing steps did not appear to be due to an inhibition of voltage-dependent Ca2+ channels or Ca2+ loading of the SR.Fig. 2Ca2+ current and increase in [Ca2+]i as a function of membrane potential in control and mdx mice. A, typical recordings obtained from control and mdx duodenal myocytes in response to depolarizing steps from -70 to 0 mV. B, Ca2+ current and Δ[Ca2+]i against membrane potential. Holding potential, -70 mV. Data are means ± S.E. for three to seven cells in control (•) and mdx duodenal myocytes (○). Myocytes were loaded with Indo-1 and held at -70 mV. ★, p < 0.05.View Large Image Figure ViewerDownload (PPT) Confocal Ca2+ Signals Evoked by Activation of Voltage-gated Ca2+ Channels and Flash Photolysis of Caged Ca2+—Spontaneous Ca2+ sparks were not detected in control and mdx duodenal myocytes (n = 155). Various experimental conditions, such as applications of low concentrations of caffeine or Bay K 8644 (an L-type Ca2+ channel agonist) or low membrane depolarizations, have been reported to trigger and increase the frequency of Ca2+ sparks in vascular myocytes (17Coussin F. Macrez N. Morel J.L. Mironneau J. J. Biol. Chem. 2000; 275: 9596-9603Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). Applications of 5 nm Bay K 8644 (n = 79), low depolarizations (from -70 to -50 mV or from -50 to -20 mV, n = 41), or 1 mm caffeine (n = 35) were ineffective in inducing generation of Ca2+ sparks in control and mdx mice. In contrast, depolarizing steps applied from -70 mV elicited propagated Ca2+ waves. As shown in Fig. 3, A and B, Ca2+ responses evoked by depolarizing steps from -70 to -30 mV were not statistically different in control and mdx mice, whereas Ca2+ responses evoked by higher depolarizing steps (from -70 to 0 mV) were reduced by about 40% in mdx mice compared with control mice (Fig. 3, A-C). These results show that inhibition of Ca2+ responses in mdx myocytes can also be detected in line scan images. RYRs can be directly activated by an increase in [Ca2+]i in the vicinity of the receptors as demonstrated previously in vascular myocytes (13Arnaudeau S. Boittin F.X. Macrez N. Lavie J.L. Mironneau C. Mironneau J. Cell Calcium. 1997; 22: 399-411Crossref PubMed Scopus (38) Google Scholar). Flash photolysis of DM-nitrophen (caged Ca2+) instantaneously elevated (within 2 ms) the Ca2+ concentration and evoked Ca2+ transients in the entire line scan image (Fig. 4A). Plotting the peak of the Ca2+ transients as a function of flash intensity revealed that the Ca2+-induced increase in [Ca2+]i in mdx mice was significantly reduced compared with control mice, particularly for high UV flash intensities (Fig. 4B). The Ca2+ sensitivity of RYRs can be estimated by plotting the ratio between the peak Ca2+ transients and the maximal Ca2+ transient at different UV flash intensities for control and mdx mice. The points appeared to be superimposed suggesting no changes in the Ca2+ sensitivity of RYRs in mdx mice (Fig. 4C). Applications of 10 mm caffeine evoked propagating Ca2+ waves in duodenal myocytes from control and mdx mice. The peak amplitude of these responses was reduced by about 40% in mdx compared with control mice (Fig. 8) in good agreement with the results obtained from experiments using whole-cell Indo-1 fluorescence. [3H]Ryanodine Binding in Duodenal Microsomes—The [3H]ryanodine binding in microsomal preparations was saturable, reached equilibration after 90 min of incubation, and remained stable for at least 180 min in control and mdx mice. Typical saturation isotherms of [3H]ryanodine binding to control and mdx mice are shown in Fig. 5A. Scatchard plots of specific [3H]ryanodine binding (Fig. 5B) revealed that the maximal binding capacity decreased by about 40% (control: 633 ± 47 fmol/mg of protein, n = 4; mdx: 382 ± 14 fmol/mg of protein, n = 4), whereas the dissociation consta" @default.
• W2052207790 created "2016-06-24" @default.
• W2052207790 creator A5006688316 @default.
• W2052207790 creator A5016750178 @default.
• W2052207790 creator A5017864907 @default.
• W2052207790 creator A5038108527 @default.
• W2052207790 creator A5058673488 @default.
• W2052207790 creator A5068911885 @default.
• W2052207790 date "2004-05-01" @default.
• W2052207790 modified "2023-09-30" @default.
• W2052207790 title "Decreased Expression of Ryanodine Receptors Alters Calcium-induced Calcium Release Mechanism in mdx Duodenal Myocytes" @default.
• W2052207790 cites W1621090453 @default.
• W2052207790 cites W1734285252 @default.
• W2052207790 cites W1798350464 @default.
• W2052207790 cites W1946415498 @default.
• W2052207790 cites W1971617455 @default.
• W2052207790 cites W1975088280 @default.
• W2052207790 cites W1982188757 @default.
• W2052207790 cites W1982930017 @default.
• W2052207790 cites W1990140279 @default.
• W2052207790 cites W2000551229 @default.
• W2052207790 cites W2000855370 @default.
• W2052207790 cites W2003059195 @default.
• W2052207790 cites W2007320632 @default.
• W2052207790 cites W2043208590 @default.
• W2052207790 cites W2056358122 @default.
• W2052207790 cites W2057165491 @default.
• W2052207790 cites W2062912208 @default.
• W2052207790 cites W2071613709 @default.
• W2052207790 cites W2072953011 @default.
• W2052207790 cites W2076067402 @default.
• W2052207790 cites W2088265860 @default.
• W2052207790 cites W2091148180 @default.
• W2052207790 cites W2093907840 @default.
• W2052207790 cites W2101673030 @default.
• W2052207790 cites W2122864516 @default.
• W2052207790 cites W2141260882 @default.
• W2052207790 cites W2158347147 @default.
• W2052207790 cites W2327246736 @default.
• W2052207790 cites W2332159849 @default.
• W2052207790 cites W4237929093 @default.
• W2052207790 cites W4293247451 @default.
• W2052207790 doi "https://doi.org/10.1074/jbc.m311124200" @default.
• W2052207790 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14985349" @default.
• W2052207790 hasPublicationYear "2004" @default.
• W2052207790 type Work @default.
• W2052207790 sameAs 2052207790 @default.
• W2052207790 citedByCount "20" @default.
• W2052207790 countsByYear W20522077902012 @default.
• W2052207790 countsByYear W20522077902014 @default.
• W2052207790 countsByYear W20522077902015 @default.
• W2052207790 countsByYear W20522077902016 @default.
• W2052207790 countsByYear W20522077902021 @default.
• W2052207790 countsByYear W20522077902022 @default.
• W2052207790 crossrefType "journal-article" @default.
• W2052207790 hasAuthorship W2052207790A5006688316 @default.
• W2052207790 hasAuthorship W2052207790A5016750178 @default.
• W2052207790 hasAuthorship W2052207790A5017864907 @default.
• W2052207790 hasAuthorship W2052207790A5038108527 @default.
• W2052207790 hasAuthorship W2052207790A5058673488 @default.
• W2052207790 hasAuthorship W2052207790A5068911885 @default.
• W2052207790 hasBestOaLocation W20522077901 @default.
• W2052207790 hasConcept C111472728 @default.
• W2052207790 hasConcept C113217602 @default.
• W2052207790 hasConcept C12554922 @default.
• W2052207790 hasConcept C126322002 @default.
• W2052207790 hasConcept C134018914 @default.
• W2052207790 hasConcept C138885662 @default.
• W2052207790 hasConcept C170493617 @default.
• W2052207790 hasConcept C178790620 @default.
• W2052207790 hasConcept C185592680 @default.
• W2052207790 hasConcept C207200792 @default.
• W2052207790 hasConcept C519063684 @default.
• W2052207790 hasConcept C55493867 @default.
• W2052207790 hasConcept C71924100 @default.
• W2052207790 hasConcept C86803240 @default.
• W2052207790 hasConcept C89611455 @default.
• W2052207790 hasConcept C95444343 @default.
• W2052207790 hasConceptScore W2052207790C111472728 @default.
• W2052207790 hasConceptScore W2052207790C113217602 @default.
• W2052207790 hasConceptScore W2052207790C12554922 @default.
• W2052207790 hasConceptScore W2052207790C126322002 @default.
• W2052207790 hasConceptScore W2052207790C134018914 @default.
• W2052207790 hasConceptScore W2052207790C138885662 @default.
• W2052207790 hasConceptScore W2052207790C170493617 @default.
• W2052207790 hasConceptScore W2052207790C178790620 @default.
• W2052207790 hasConceptScore W2052207790C185592680 @default.
• W2052207790 hasConceptScore W2052207790C207200792 @default.
• W2052207790 hasConceptScore W2052207790C519063684 @default.
• W2052207790 hasConceptScore W2052207790C55493867 @default.
• W2052207790 hasConceptScore W2052207790C71924100 @default.
• W2052207790 hasConceptScore W2052207790C86803240 @default.
• W2052207790 hasConceptScore W2052207790C89611455 @default.
• W2052207790 hasConceptScore W2052207790C95444343 @default.
• W2052207790 hasIssue "20" @default.
• W2052207790 hasLocation W20522077901 @default.
• W2052207790 hasOpenAccess W2052207790 @default.
• W2052207790 hasPrimaryLocation W20522077901 @default.

• next