FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2053443669> ?p ?o ?g. }

• W2053443669 endingPage "2138" @default.
• W2053443669 startingPage "2129" @default.
• W2053443669 abstract "Low density lipoprotein receptor (LDLR) mutations cause familial hypercholesterolemia and early atherosclerosis. ABCA1 facilitates free cholesterol efflux from peripheral tissues. We investigated the effects of LDLR deletion (LDLR-/-) on ABCA1 expression. LDLR-/- macrophages had reduced basal levels of ABCA1, ABCG1, and cholesterol efflux. A high fat diet increased cholesterol in LDLR-/- macrophages but not wild type cells. A liver X receptor (LXR) agonist induced expression of ABCA1, ABCG1, and cholesterol efflux in both LDLR-/- and wild type macrophages, whereas expression of LXRα or LXRβ was similar. Interestingly, oxidized LDL induced more ABCA1 in wild type macrophages than LDLR-/- cells. LDL induced ABCA1 expression in wild type cells but inhibited it in LDLR-/- macrophages in a concentration-dependent manner. However, lipoproteins regulated ABCG1 expression similarly in LDLR-/- and wild type macrophages. Cholesterol or oxysterols induced ABCA1 expression in wild type macrophages but had little or inhibitory effects on ABCA1 expression in LDLR-/- macrophages. Active sterol regulatory element-binding protein 1a (SREBP1a) inhibited ABCA1 promoter activity in an LXRE-dependent manner and decreased both macrophage ABCA1 expression and cholesterol efflux. Expression of ABCA1 in animal tissues was inversely correlated to active SREBP1. Oxysterols inactivated SREBP1 in wild type macrophages but not in LDLR-/- cells. Oxysterol synergized with nonsteroid LXR ligand induced ABCA1 expression in wild type macrophages but blocked induction in LDLR-/- cells. Taken together, our studies suggest that LDLR is critical in the regulation of cholesterol efflux and ABCA1 expression in macrophage. Lack of the LDLR impairs sterol-induced macrophage ABCA1 expression by a sterol regulatory element-binding protein 1-dependent mechanism that can result in reduced cholesterol efflux and lipid accumulation in macrophages under hypercholesterolemic conditions. Low density lipoprotein receptor (LDLR) mutations cause familial hypercholesterolemia and early atherosclerosis. ABCA1 facilitates free cholesterol efflux from peripheral tissues. We investigated the effects of LDLR deletion (LDLR-/-) on ABCA1 expression. LDLR-/- macrophages had reduced basal levels of ABCA1, ABCG1, and cholesterol efflux. A high fat diet increased cholesterol in LDLR-/- macrophages but not wild type cells. A liver X receptor (LXR) agonist induced expression of ABCA1, ABCG1, and cholesterol efflux in both LDLR-/- and wild type macrophages, whereas expression of LXRα or LXRβ was similar. Interestingly, oxidized LDL induced more ABCA1 in wild type macrophages than LDLR-/- cells. LDL induced ABCA1 expression in wild type cells but inhibited it in LDLR-/- macrophages in a concentration-dependent manner. However, lipoproteins regulated ABCG1 expression similarly in LDLR-/- and wild type macrophages. Cholesterol or oxysterols induced ABCA1 expression in wild type macrophages but had little or inhibitory effects on ABCA1 expression in LDLR-/- macrophages. Active sterol regulatory element-binding protein 1a (SREBP1a) inhibited ABCA1 promoter activity in an LXRE-dependent manner and decreased both macrophage ABCA1 expression and cholesterol efflux. Expression of ABCA1 in animal tissues was inversely correlated to active SREBP1. Oxysterols inactivated SREBP1 in wild type macrophages but not in LDLR-/- cells. Oxysterol synergized with nonsteroid LXR ligand induced ABCA1 expression in wild type macrophages but blocked induction in LDLR-/- cells. Taken together, our studies suggest that LDLR is critical in the regulation of cholesterol efflux and ABCA1 expression in macrophage. Lack of the LDLR impairs sterol-induced macrophage ABCA1 expression by a sterol regulatory element-binding protein 1-dependent mechanism that can result in reduced cholesterol efflux and lipid accumulation in macrophages under hypercholesterolemic conditions. There is a high degree of correlation of plasma cholesterol levels with the incidence of coronary heart disease. It has been shown that plasma cholesterol homeostasis is dependent on ingestion, synthesis, and metabolism of cholesterol (1Calvert G.D. Aust. N. Z. J. Med. 1994; 24: 89-91Crossref PubMed Scopus (4) Google Scholar). Similarly, it has been demonstrated that both the low density lipoprotein receptor (LDLR) 3The abbreviations used are: LDLRlow density lipoprotein (LDL) receptorHDLhigh density lipoproteinAcLDLacetylated LDLOxLDLoxidized LDLABCA1ATP binding cassette transporter A1FHfamilial hypercholesterolemiaLXRliver X receptorLXRELXR response elementSREBPsterol regulatory element-binding proteinPBSphosphate-buffered saline. and the ATP binding cassette transporter A1 (ABCA1) play key regulatory roles in cellular cholesterol metabolism (2Defesche J.C. Semin. Vasc. Med. 2004; 4: 5-11Crossref PubMed Scopus (48) Google Scholar, 3Oram J.F. Heinecke J.W. Physiol. Rev. 2005; 85: 1343-1372Crossref PubMed Scopus (422) Google Scholar). The LDLR is a cell surface-glycoprotein that endocytoses cholesterol bound to LDL, and it is responsible for the clearance of about 70% of plasma LDL cholesterol in human liver (2Defesche J.C. Semin. Vasc. Med. 2004; 4: 5-11Crossref PubMed Scopus (48) Google Scholar, 4Brown M.S. Goldstein J.L. Science. 1986; 232: 34-47Crossref PubMed Scopus (4358) Google Scholar). The LDLR also binds β-VLDL (very low density lipoprotein) and certain intermediate density lipoprotein and HDL (5Yamamoto T. Davis C.G. Brown M.S. Schneider W.J. Casey M.L. Goldstein J.L. Russell D.W. Cell. 1984; 39: 27-38Abstract Full Text PDF PubMed Scopus (979) Google Scholar). low density lipoprotein (LDL) receptor high density lipoprotein acetylated LDL oxidized LDL ATP binding cassette transporter A1 familial hypercholesterolemia liver X receptor LXR response element sterol regulatory element-binding protein phosphate-buffered saline. Human LDLR mutations cause familial hypercholesterolemia (FH), a common autosomal dominant disorder that affects approximately 1 in 500 individuals in the heterozygous form with about a 2-fold elevation in plasma LDL cholesterol (6Civeira F. Atherosclerosis. 2004; 173: 55-68Abstract Full Text Full Text PDF PubMed Scopus (394) Google Scholar, 7van Aalst-Cohen E.S. Jansen A.C. de J.S. de Sauvage Nolting P.R. Kastelein J.J. Semin. Vasc. Med. 2004; 4: 31-41Crossref PubMed Scopus (28) Google Scholar). Without treatment, excess LDL cholesterol can deposit in tendons and arteries. It eventually leads to the formation of tendon xanthomas and atherosclerotic plaques (8Descamps O.S. Leysen X. Van L.F. Heller F.R. Atherosclerosis. 2001; 157: 514-518Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). Clinically overt coronary heart disease caused by heterozygous FH is observed at an age of 45-48 years in males and of 55-58 years in females (9Ose L. Ann. Med. 1999; 31: 13-18Crossref PubMed Scopus (35) Google Scholar). The homozygous FH patients are rare (∼1:106). However, when it occurs, one sees a 4-5-fold elevation in plasma LDL cholesterol with marked cutaneous tuberous xanthomas. Often, there are frequent myocardial infarctions at the age of 20-30 years (9Ose L. Ann. Med. 1999; 31: 13-18Crossref PubMed Scopus (35) Google Scholar). In mice, genetic deletion of the LDLR (LDLR knock-out, LDLR-/-) will cause a moderate increase in plasma LDL cholesterol when these animals are fed a normal chow. However, a severe elevation of LDL plasma cholesterol is associated with aortic lesions when mice are fed a Western diet (10Ishibashi S. Goldstein J.L. Brown M.S. Herz J. Burns D.K. J. Clin. Investig. 1994; 93: 1885-1893Crossref PubMed Scopus (598) Google Scholar). Thus, LDLR-/- mice are used as a model for the study of the pathogenesis of atherosclerosis and FH (11Jawien J. Nastalek P. Korbut R. J. Physiol. Pharmacol. 2004; 55: 503-517PubMed Google Scholar). ABCA1 and ABCG1 belong to the large family of ATP-binding cassette transporters. By using the energy from the hydrolysis of ATP, ABCA1 and ABCG1 facilitate cholesterol efflux from macrophages and other cell types to apoAI and/or HDL (12Takahashi K. Kimura Y. Nagata K. Yamamoto A. Matsuo M. Ueda K. Med. Mol. Morphol. 2005; 38: 2-12Crossref PubMed Scopus (72) Google Scholar). ABCA1 mutations cause Tangier disease, characterized by very low levels of HDL cholesterol, poorly lipidated and rapidly catabolized apoAI, cholesteryl ester accumulation in peripheral tissues, and a high risk of development of coronary heart disease (13Bodzioch M. Orso E. Klucken J. Langmann T. Bottcher A. Diederich W. Drobnik W. Barlage S. Buchler C. Porsch-Ozcurumez M. Kaminski W.E. Hahmann H.W. Oette K. Rothe G. Aslanidis C. Lackner K.J. Schmitz G. Nat. Genet. 1999; 22: 347-351Crossref PubMed Scopus (1345) Google Scholar, 14Brooks-Wilson A. Marcil M. Clee S.M. Zhang L.H. Roomp K. van D.M. Yu L. Brewer C. Collins J.A. Molhuizen H.O. Loubser O. Ouelette B.F. Fichter K. shbourne-Excoffon K.J. Sensen C.W. Scherer S. Mott S. Denis M. Martindale D. Frohlich J. Morgan K. Koop B. Pimstone S. Kastelein J.J. Genest Jr., J. Hayden M.R. Nat. Genet. 1999; 22: 336-345Crossref PubMed Scopus (1505) Google Scholar). In apoE knock-out mice, overexpression of human ABCA1 reduces total cholesterol levels and atherosclerosis, whereas selective suppression of macrophage ABCA1 increases atherosclerosis without affecting total cholesterol levels (15Joyce C.W. Amar M.J. Lambert G. Vaisman B.L. Paigen B. Najib-Fruchart J. Hoyt Jr., R.F. Neufeld E.D. Remaley A.T. Fredrickson D.S. Brewer Jr., H.B. Santamarina-Fojo S. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 407-412Crossref PubMed Scopus (239) Google Scholar, 16Singaraja R.R. Fievet C. Castro G. James E.R. Hennuyer N. Clee S.M. Bissada N. Choy J.C. Fruchart J.C. McManus B.M. Staels B. Hayden M.R. J. Clin. Investig. 2002; 110: 35-42Crossref PubMed Scopus (248) Google Scholar). In contrast, the activation of ABCG1 expression can promote atherosclerotic lesion development whereas inactivation of macrophage ABCG1 expression reduces it in proatherogenic mice (17Baldan A. Pei L. Lee R. Tarr P. Tangirala R.K. Weinstein M.M. Frank J. Li A.C. Tontonoz P. Edwards P.A. Arterioscler. Thromb. Vasc. Biol. 2006; 26: 2301-2307Crossref PubMed Scopus (151) Google Scholar, 18Basso F. Amar M.J. Wagner E.M. Vaisman B. Paigen B. Santamarina-Fojo S. Remaley A.T. Biochem. Biophys. Res. Commun. 2006; 351: 398-404Crossref PubMed Scopus (44) Google Scholar). ABCA1 has a half-life of about 1-2 h. Thus, decreased ABCA1 degradation by apoAI results in increased ABCA1 levels, whereas enhanced ABCA1 degradation by unsaturated fatty acids decreases ABCA1 levels in macrophages (19Arakawa R. Yokoyama S. J. Biol. Chem. 2002; 277: 22426-22429Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar, 20Wang Y. Oram J.F. J. Biol. Chem. 2002; 277: 5692-5697Abstract Full Text Full Text PDF PubMed Scopus (207) Google Scholar). Loading of wild type macrophages with lipoproteins or sterols can increase ABCA1 expression and cholesterol efflux, thus potentially preventing uncontrolled lipid accumulation and formation of lipid-laden macrophage/foam cells (21Cavelier L.B. Qiu Y. Bielicki J.K. Afzal V. Cheng J.F. Rubin E.M. J. Biol. Chem. 2001; 276: 18046-18051Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 22Liao H. Langmann T. Schmitz G. Zhu Y. Arterioscler. Thromb. Vasc. Biol. 2002; 22: 127-132Crossref PubMed Scopus (52) Google Scholar). Several transcription factors have been defined to play a critical role in the regulation of ABCA1 expression and cholesterol efflux (23Schmitz G. Langmann T. Biochim. Biophys. Acta. 2005; 1735: 1-19Crossref PubMed Scopus (181) Google Scholar). LXRα/β (ligand-activated transcription factors) can increase ABCA1/ABCG1 expression (24Chawla A. Boisvert W.A. Lee C.H. Laffitte B.A. Barak Y. Joseph S.B. Liao D. Nagy L. Edwards P.A. Curtiss L.K. Evans R.M. Tontonoz P. Mol. Cell. 2001; 7: 161-171Abstract Full Text Full Text PDF PubMed Scopus (1173) Google Scholar, 25Costet P. Luo Y. Wang N. Tall A.R. J. Biol. Chem. 2000; 275: 28240-28245Abstract Full Text Full Text PDF PubMed Scopus (851) Google Scholar), whereas administration of synthetic LXR ligands to proatherogenic mice will result in significantly reducing atherosclerosis (26Claudel T. Leibowitz M.D. Fievet C. Tailleux A. Wagner B. Repa J.J. Torpier G. Lobaccaro J.M. Paterniti J.R. Mangelsdorf D.J. Heyman R.A. Auwerx J. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 2610-2615Crossref PubMed Scopus (256) Google Scholar, 27Joseph S.B. McKilligin E. Pei L. Watson M.A. Collins A.R. Laffitte B.A. Chen M. Noh G. Goodman J. Hagger G.N. Tran J. Tippin T.K. Wang X. Lusis A.J. Hsueh W.A. Law R.E. Collins J.L. Willson T.M. Tontonoz P. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 7604-7609Crossref PubMed Scopus (779) Google Scholar, 28Terasaka N. Hiroshima A. Koieyama T. Ubukata N. Morikawa Y. Nakai D. Inaba T. FEBS Lett. 2003; 536: 6-11Crossref PubMed Scopus (291) Google Scholar). However, clinical use of LXR ligands has been limited by very low density lipoprotein-triglycerides accumulation in the liver (29Grefhorst A. Elzinga B.M. Voshol P.J. Plosch T. Kok T. Bloks V.W. van der Sluijs F.H. Havekes L.M. Romijn J.A. Verkade H.J. Kuipers F. J. Biol. Chem. 2002; 277: 34182-34190Abstract Full Text Full Text PDF PubMed Scopus (405) Google Scholar). Sterol regulatory element-binding proteins 1 and 2 (SREBP1/2), the nuclei membrane-bound transcription factors, regulate expression of genes involved in cholesterol synthesis, endocytosis of LDL, synthesis of fatty acids, and glucose metabolism. Activity of SREBPs is feedback inhibited by cellular sterol levels (30Brown M.S. Goldstein J.L. Cell. 1997; 89: 331-340Abstract Full Text Full Text PDF PubMed Scopus (2996) Google Scholar, 31Eberle D. Hegarty B. Bossard P. Ferre P. Foufelle F. Biochimie (Paris). 2004; 86: 839-848Crossref PubMed Scopus (1013) Google Scholar). SREBP2 has been reported to inhibit ABCA1 expression in human endothelial cells by binding the E-box in the ABCA1 promoter (32Zeng L. Liao H. Liu Y. Lee T.S. Zhu M. Wang X. Stemerman M.B. Zhu Y. Shyy J.Y. J. Biol. Chem. 2004; 279: 48801-48807Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). However, a separate report suggests that binding of SREBP2 to the E-box does not alter the E-box activity (33Amemiya-Kudo M. Shimano H. Hasty A.H. Yahagi N. Yoshikawa T. Matsuzaka T. Okazaki H. Tamura Y. Iizuka Y. Ohashi K. Osuga J. Harada K. Gotoda T. Sato R. Kimura S. Ishibashi S. Yamada N. J. Lipid Res. 2002; 43: 1220-1235Abstract Full Text Full Text PDF PubMed Google Scholar). Recently, it has been shown that SREBP2 is a positive regulator of ABCA1 expression in transfected CHO-7 cells (34Wong J. Quinn C.M. Brown A.J. Biochem. J. 2006; 400: 485-491Crossref PubMed Scopus (116) Google Scholar). Expression of SREBP1 and SREBP2 is cell type-dependent. SREBP1c and SREBP2 are predominantly expressed by the liver (35Edwards P.A. Tabor D. Kast H.R. Venkateswaran A. Biochim. Biophys. Acta. 2000; 1529: 103-113Crossref PubMed Scopus (264) Google Scholar). In contrast, SREBP1a with 29-additional acidic-rich amino acids at the N terminus and more potent transcriptional activity is widely expressed by most tissues (35Edwards P.A. Tabor D. Kast H.R. Venkateswaran A. Biochim. Biophys. Acta. 2000; 1529: 103-113Crossref PubMed Scopus (264) Google Scholar). Because of the existence of the sterol regulatory element in promoters of SREBP1 and SREBP2, they may cross-regulate each other (36Amemiya-Kudo M. Shimano H. Yoshikawa T. Yahagi N. Hasty A.H. Okazaki H. Tamura Y. Shionoiri F. Iizuka Y. Ohashi K. Osuga J. Harada K. Gotoda T. Sato R. Kimura S. Ishibashi S. Yamada N. J. Biol. Chem. 2000; 275: 31078-31085Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar, 37Sato R. Inoue J. Kawabe Y. Kodama T. Takano T. Maeda M. J. Biol. Chem. 1996; 271: 26461-26464Abstract Full Text Full Text PDF PubMed Scopus (226) Google Scholar). The role of SREBP1 or SREBP2 on expression of ABCA1, particularly in macrophages, is unknown. Although the role of the LDLR in the mediation of uptake and clearance of LDL cholesterol by hepatocytes has been well defined, it is unclear if the LDLR plays a role in macrophage ABCA1 expression and cholesterol efflux. Cellular endocytosis of LDL cholesterol is reduced in the absence of the LDLR. However, deletion of LDLR leads to atherosclerosis in hypercholesterolemic mice. In addition to the contribution by scavenger receptor-mediated uptake of modified LDL, we hypothesized that lesion development is also due to the defect in macrophage cholesterol efflux. In this study we tested the hypothesis that lack of LDLR will impair sterol-induced macrophage ABCA1 expression. We demonstrate for the first time that the LDLR plays an important role in regulating macrophage cholesterol efflux. We show that LDLR deletion reduces basal levels of ABCA1, ABCG1, and cholesterol efflux from macrophages and significantly reduces sterol-induced ABCA1 expression in macrophages. Furthermore, we show that these effects are mediated by an abnormal response of SREBP1 to sterols. Reagents—All chemicals were purchased from Sigma-Aldrich. A high fat diet (21% fat and 0.2% cholesterol) was purchased from Harlan Teklad (Madison, WI). [3H]Cholesterol was purchased from PerkinElmer Life Sciences. Total and free cholesterol assay kits were obtained from Wako Chemicals USA, Inc. (Richmond, VA). Rabbit anti-mouse ABCA1 and ABCG1 polyclonal antibodies were purchased from Novus Biologicals, Inc. (Littleton, CO). Rabbit anti-mouse SREBP-2 specific polyclonal antibody was a kind gift from Dr. Joseph Goldstein of The University of Texas Southwestern Medical Center. All other antibodies were polyclonal, and they were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Cell Culture—Adult mice (both wild type (C57BL) and LDLR knock-out with the same background as C57BL, 10-12 weeks) were purchased from The Jackson Laboratory (Bar Harbor, ME) and maintained in fully accredited facilities (Assessment and Accreditation of Laboratory Animal Care) at Weill Cornell Medical College. Mice were injected intraperitoneal (3 ml/mouse) with 4% autoclaved thioglycolate solution and kept for 5 days with free access to drinking water and chow. Peritoneal macrophages were isolated by lavage of the abdomen with PBS (2 × 8 ml) after sacrifice. They were cultured (density at 300 × 103 cells/cm2) in complete RPMI medium containing 10% fetal calf serum, 50 μg/ml penicillin and streptomycin, and 2 mm glutamine. After 3 h culture, floating cells (most are red blood cells) were removed by washing with PBS. Adherent cells were maintained in complete medium. Peritoneal macrophages were isolated from mice fed a normal chow except indicated. Determination of Free and Total Cholesterol Levels in Peritoneal Macrophages—Wild type or LDLR-/- mice at 10 weeks of age were fed a normal chow or a high fat diet for 4 weeks. Peritoneal macrophages from each mouse were individually collected. After extraction, macrophage cellular lipids were used to determine free and total cholesterol levels as described (38Han J. Hajjar D.P. Tauras J.M. Nicholson A.C. J. Lipid Res. 1999; 40: 830-838Abstract Full Text Full Text PDF PubMed Google Scholar). Isolation of LDL and HDL and Preparation of ApoAI, Acetylated LDL (AcLDL), and Oxidized LDL (OxLDL)—LDL (1.019-1.063 g/ml) and HDL (1.063-1.21 g/ml) were isolated from normal human plasma by sequential ultracentrifugation, dialyzed against PBS containing 0.3 mm EDTA, sterilized by filtration through a 0.22-μm filter, and stored under N2 gas at 4 °C. Protein content was determined by the Lowry method. ApoAI was isolated from purified HDL by removal of lipids with an extraction solution of acetone and ethanol (1:1) (39Brinton E.A. Eisenberg S. Breslow J.L. J. Clin. Investig. 1989; 84: 262-269Crossref PubMed Scopus (124) Google Scholar). Purity of apoAI was determined by SDS-PAGE. AcLDL and OxLDL were prepared as described elsewhere (40Han J. Parsons M. Zhou X. Nicholson A.C. Gotto Jr., A.M. Hajjar D.P. Circulation. 2004; 110: 3472-3479Crossref PubMed Scopus (52) Google Scholar). Determination of Free Cholesterol Efflux from Macrophages—Macrophages in 12-well plates were labeled in macrophage serum-free medium (Invitrogen, 1.5 ml/well) containing 50 μg/ml AcLDL and 150 nCi/ml [3H]cholesterol for 24 h. After removal of labeling medium, cells were washed twice with PBS and incubated for 1 h in serum-free medium, then switched to serum-free medium or medium containing purified apoAI or HDL (1.5 ml/well). After 5 h of incubation at 37 °C, medium from each well was collected for the determination of radioactivity in the supernatants. Remaining cells in the wells and Eppendorf tubes were lysed by addition of 0.2 n NaOH, and the combined lysate was determined for protein content which was used to normalize cholesterol efflux (dpm/μg of protein). Northern Blot Analysis of ABCA1, ABCG1, LXRα, and LXRβ mRNA Expression—Total cellular RNA was extracted from cells in 60-mm dishes and used to determine expression of ABCA1, ABCG1, LXRα, and LXRβ mRNA by Northern blot as described (40Han J. Parsons M. Zhou X. Nicholson A.C. Gotto Jr., A.M. Hajjar D.P. Circulation. 2004; 110: 3472-3479Crossref PubMed Scopus (52) Google Scholar). The probes for mouse ABCA1, ABCG1, LXRα, and LXRβ were generated by reverse transcription-PCR using the following primers: ABCA1, forward (F)-TGGACATCCTGAAGCCAG and backward (B)-TTCTTCCCACATGCCCT; ABCG1, F-GCTGGGAAGTCCACACTC, B-GATACGGCACGAGATTGG; LXRα, F-GGCAACACTTGCATCCTC, B-CTGTAGGAAGCCAGGGAG; LXRβ, F-GAGCCAGAGGATGAGCCT and B-GACTTTGGGCTGGTCGGAG. Western Blot Analysis of ABAC1, ABCG1, SREBP1, and SREBP2 Protein Expression—Total cellular proteins were extracted as described (40Han J. Parsons M. Zhou X. Nicholson A.C. Gotto Jr., A.M. Hajjar D.P. Circulation. 2004; 110: 3472-3479Crossref PubMed Scopus (52) Google Scholar) and separated on a 7% (for ABCA1) or 12% (for ABCG1, SREBP1, and SREBP2) SDS-PAGE followed by Western blot analysis. To determine the nuclear form of SREBP1, nuclear proteins were extracted as follows. Cells were suspended in cold buffer A (20 mm Hepes, pH 7.9, 10 mm NaCl, 3 mm MgCl2, 0.1% Nonidet P-40, 10% glycerol, 0.2 mm EDTA, 50 μg/ml each of aprotinin, and leupeptin) and incubated on ice for 20 min followed by centrifugation for 5 min with a microcentrifuge at 3000 rpm and 4 °C. Pellets of nuclei were washed once with buffer A and then buffer B (20 mm Hepes, pH 7.9, 20% glycerol, 0.2 mm EDTA, 50 μg/ml each of aprotinin and leupeptin). Nuclear pellets were resuspended in buffer C (20 mm Hepes, pH 7.9, 0.4 m NaCl, 20% glycerol, 0.2 mm EDTA, 50 μg/ml each of aprotinin and leupeptin) and incubated on ice for 1 h with vortexing several times. The suspension was centrifuged for 30 min at 14,000 rpm and 4 °C. The supernatants were collected, separated into aliquots, and stored at -20 °C until assay. Plasmid DNA Preparation and Transfection—cDNA encoding nuclear form of mouse SREBP1a (N-terminal 1-460 amino acids) was generated by PCR using the clone purchased from Invitrogen (cDNA clone MGC:66503 IMAGE:6824948) as a template DNA and the primers F-ACTCAGATCTCGATGGACGAGCTGGCCTTCG and B-CCGCGGTACCCTAGACCTGGCTATCCTCAAAGG. After the sequence was confirmed, the PCR product was digested with BglII and KpnI and then subcloned into an expression vector, pEGFP-C2 (pEGFP-nSREBP1a). Mouse ABCA1 promoters were constructed by PCR using the mouse genomic DNA and primers as shown in Table 1. For promoter activity assay, about 95% of the confluent 293 cells in 24-well plates were co-transfected with the DNA for the ABCA1 promoter, nSREBP1a, and Renilla (for internal normalization) by using Lipofectamine™ 2000 (Invitrogen). After 24 h of transfection, cells were lysed, and the cellular lysate was used to determine the activity of firefly and Renilla luciferases by using the Dual-Luciferase® Reporter Assay System (Promega, Madison, WI).TABLE 1Sequences of primers for ABCA1 promotersPromoterTemplate DNA5′-primer3′-primerAaAfter sequence was confirmed, the PCR product was digested by XhoI and HindIII and then subcloned into pGL4 luciferase reporter vector (Promega) followed by transformation and amplification (–179 to +227)Mouse genomic DNATAGCCTCGAGGTCGCCGGTTTAAGGGGCGTGCCAAGCTTCCTCTTACCTGTTTTCCACTTTGBbThe hexanucleotides of the E-box (CACGTG) was deleted in primers for promoter B or replaced by underlined hexanucleotides in primers for promoter C. PCR was performed by using QuikChange® II site-directed mutagenesis kit (Stratagene, La Jolla, CA) and DNA of promoter A (E-box deleted)Promoter AGGCCATGTCTCCTTTCGCGCAGAAAGGAGACATGGCCCbThe hexanucleotides of the E-box (CACGTG) was deleted in primers for promoter B or replaced by underlined hexanucleotides in primers for promoter C. PCR was performed by using QuikChange® II site-directed mutagenesis kit (Stratagene, La Jolla, CA) and DNA of promoter A (E-box mutated)Promoter AGGCGGGCCATGTCTCACTAGACTTTCTGCGCAGAAAGTCTAGTGAGACATGGCCCGCCD (–113 to +227)Mouse genomic DNATAGCCTCGAGCAGAGGCCGGGAACGGGGCGSame as promoter AE (–38 to +227)Mouse genomic DNATAGCCTCGAGCCAGTAATTCCGAGGGCGAGSame as promoter AF (–179 to –94)Mouse genomic DNASame as promoter ATGCCAAGCTTCGCCCCCTTCCCGGCCa After sequence was confirmed, the PCR product was digested by XhoI and HindIII and then subcloned into pGL4 luciferase reporter vector (Promega) followed by transformation and amplificationb The hexanucleotides of the E-box (CACGTG) was deleted in primers for promoter B or replaced by underlined hexanucleotides in primers for promoter C. PCR was performed by using QuikChange® II site-directed mutagenesis kit (Stratagene, La Jolla, CA) and DNA of promoter A Open table in a new tab Data Analysis—All experiments were repeated at least three times, and representative results are presented. Data were generated from the cholesterol assays, and the cholesterol efflux studies or the activity assays involving the ABCA1 promoters were analyzed by paired t test. High Fat Diet Induces Cholesterol Accumulation in LDLR-/- Macrophages—To determine whether LDLR deletion alters macrophage cholesterol levels, both wild type and LDLR-/- mice were fed a normal chow or a high fat diet. After 4 weeks of feeding, mice were used to collect samples of plasma as well as peritoneal macrophages. The high fat diet increased total and free cholesterol levels in the plasma of both types of mice but with a greater effect in the LDLR-/- mice (Table 2). For instance, both total and free cholesterol levels in the plasma of the wild type mice were increased ∼2-fold in those fed a high fat diet. In contrast, the high fat diet resulted in about a 4- and 5-fold increase in total and free plasma cholesterol levels in LDLR-/- mice.TABLE 2A high fat diet induces plasma and macrophage cholesterol accumulation in LDLR–/– mice Blood and peritoneal macrophages were collected from individual mice after 4 weeks of normal chow or a high-fat diet feeding. Total and free cholesterol were determined by using an assay kit from Wako Chemicals.GenotypeSerumMacrophageNormal chowHigh fat dietNormal chowHigh fat dietTotalFreeTotalFreeTotalFreeTotalFreemg/dlμg/mg of proteinWild type51 ± 713 ± 1109 ± 10aHigh fat diet vs. normal chow in wild type27 ± 2aHigh fat diet vs. normal chow in wild type50 ± 747 ± 548 ± 546 ± 3LDLR–/–235 ± 23bLDL–/– vs. wild type in serum75 ± 8bLDL–/– vs. wild type in serum1092 ± 108bLDL–/– vs. wild type in serum,cHigh fat diet vs. normal chow in LDL–/–366 ± 42bLDL–/– vs. wild type in serum,cHigh fat diet vs. normal chow in LDL–/–48 ± 645 ± 4114 ± 8dLDL–/– vs. wild type in macrophages41 ± 2a High fat diet vs. normal chow in wild typeb LDL–/– vs. wild type in serumc High fat diet vs. normal chow in LDL–/–d LDL–/– vs. wild type in macrophages Open table in a new tab Interestingly, the total or free cellular cholesterol levels in macrophages were similar between wild type and LDLR-/- mice when they were fed a normal chow, albeit the plasma total and free cholesterol level in LDLR-/- mice were about 5-fold higher than wild type mice. Administration of a high fat diet increased plasma cholesterol levels in wild type mice, but it did not affect the cellular total or free cellular cholesterol levels in these macrophages (Table 2). In contrast, a high fat diet increased total cholesterol levels ∼2-fold in LDLR-/- macrophages (Table 2). The increase was due to the accumulation of cholesteryl esters since the free cholesterol levels were not changed. LDLR Deletion Does Not Change Expression of Scavenger Receptors but Reduces Efflux of Free Cholesterol and Expression of ABCA1 and ABCG1 in Macrophages—To study the pathways by which the high fat diet induced cholesterol accumulation in LDLR-/- macrophages, we initially focused on the effects of LDLR deletion on the expression of scavenger receptors. Type A and type B scavenger receptors (SRA and CD36) are major proteins responsible for the binding and internalization of modified LDL in macrophages (41Febbraio M. Hajjar D.P. Silverstein R.L. J. Clin. Investig. 2001; 108: 785-791Crossref PubMed Scopus (932) Google Scholar, 42Platt N. Gordon S. J. Clin. Investig. 2001; 108: 649-654Crossref PubMed Scopus (256) Google Scholar). Data in Fig. 1A indicated that the expression of SRA or CD36 was not affected by LDLR deletion. Type BI scavenger receptor (SR-BI), a molecule mediating both free cholesterol efflux to HDL from cells and selective uptake of cholesteryl esters by cells (43Krieger M. J. Clin. Investig. 2001; 108: 793-797Crossref PubMed Scopus (334) Google Scholar), was also not changed (Fig. 1A). Thus, the major pathways for uptake of cholesterol remained unaffected in the absence of LDLR. ABCA1 and ABCG1 facilitate macrophage-free chol" @default.
• W2053443669 created "2016-06-24" @default.
• W2053443669 creator A5007205089 @default.
• W2053443669 creator A5028507446 @default.
• W2053443669 creator A5029645367 @default.
• W2053443669 creator A5068202304 @default.
• W2053443669 creator A5072816186 @default.
• W2053443669 creator A5089053594 @default.
• W2053443669 date "2008-01-01" @default.
• W2053443669 modified "2023-10-12" @default.
• W2053443669 title "Genetic Deletion of Low Density Lipoprotein Receptor Impairs Sterol-induced Mouse Macrophage ABCA1 Expression" @default.
• W2053443669 cites W1570388980 @default.
• W2053443669 cites W1607399348 @default.
• W2053443669 cites W1860908381 @default.
• W2053443669 cites W1875102167 @default.
• W2053443669 cites W1964285581 @default.
• W2053443669 cites W1985196273 @default.
• W2053443669 cites W1986053870 @default.
• W2053443669 cites W1986256219 @default.
• W2053443669 cites W1987052134 @default.
• W2053443669 cites W1990840172 @default.
• W2053443669 cites W1995032745 @default.
• W2053443669 cites W1996168740 @default.
• W2053443669 cites W2003798182 @default.
• W2053443669 cites W2012647353 @default.
• W2053443669 cites W2015805615 @default.
• W2053443669 cites W2017506227 @default.
• W2053443669 cites W2025991358 @default.
• W2053443669 cites W2026587556 @default.
• W2053443669 cites W2031595603 @default.
• W2053443669 cites W2031801520 @default.
• W2053443669 cites W2037131341 @default.
• W2053443669 cites W2039999119 @default.
• W2053443669 cites W2042489459 @default.
• W2053443669 cites W2054736204 @default.
• W2053443669 cites W2055315631 @default.
• W2053443669 cites W2056165873 @default.
• W2053443669 cites W2059256286 @default.
• W2053443669 cites W2061255861 @default.
• W2053443669 cites W2084744450 @default.
• W2053443669 cites W2086453930 @default.
• W2053443669 cites W2099324889 @default.
• W2053443669 cites W2105908673 @default.
• W2053443669 cites W2116181534 @default.
• W2053443669 cites W2116385509 @default.
• W2053443669 cites W2119188461 @default.
• W2053443669 cites W2119343066 @default.
• W2053443669 cites W2124205593 @default.
• W2053443669 cites W2128594838 @default.
• W2053443669 cites W2134567364 @default.
• W2053443669 cites W2135007868 @default.
• W2053443669 cites W2144377792 @default.
• W2053443669 cites W2147359941 @default.
• W2053443669 cites W2148390363 @default.
• W2053443669 cites W2159332620 @default.
• W2053443669 cites W2164724187 @default.
• W2053443669 cites W2168300371 @default.
• W2053443669 cites W2169823417 @default.
• W2053443669 cites W2171705910 @default.
• W2053443669 cites W2402979022 @default.
• W2053443669 cites W4233455462 @default.
• W2053443669 cites W4233879183 @default.
• W2053443669 doi "https://doi.org/10.1074/jbc.m706636200" @default.
• W2053443669 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18029360" @default.
• W2053443669 hasPublicationYear "2008" @default.
• W2053443669 type Work @default.
• W2053443669 sameAs 2053443669 @default.
• W2053443669 citedByCount "30" @default.
• W2053443669 countsByYear W20534436692012 @default.
• W2053443669 countsByYear W20534436692013 @default.
• W2053443669 countsByYear W20534436692014 @default.
• W2053443669 countsByYear W20534436692015 @default.
• W2053443669 countsByYear W20534436692017 @default.
• W2053443669 countsByYear W20534436692018 @default.
• W2053443669 countsByYear W20534436692019 @default.
• W2053443669 countsByYear W20534436692020 @default.
• W2053443669 countsByYear W20534436692021 @default.
• W2053443669 countsByYear W20534436692023 @default.
• W2053443669 crossrefType "journal-article" @default.
• W2053443669 hasAuthorship W2053443669A5007205089 @default.
• W2053443669 hasAuthorship W2053443669A5028507446 @default.
• W2053443669 hasAuthorship W2053443669A5029645367 @default.
• W2053443669 hasAuthorship W2053443669A5068202304 @default.
• W2053443669 hasAuthorship W2053443669A5072816186 @default.
• W2053443669 hasAuthorship W2053443669A5089053594 @default.
• W2053443669 hasBestOaLocation W20534436691 @default.
• W2053443669 hasConcept C104317684 @default.
• W2053443669 hasConcept C149011108 @default.
• W2053443669 hasConcept C170493617 @default.
• W2053443669 hasConcept C185592680 @default.
• W2053443669 hasConcept C202751555 @default.
• W2053443669 hasConcept C2777704780 @default.
• W2053443669 hasConcept C2778163477 @default.
• W2053443669 hasConcept C2778718757 @default.
• W2053443669 hasConcept C2779244956 @default.
• W2053443669 hasConcept C2780072125 @default.
• W2053443669 hasConcept C2780948078 @default.
• W2053443669 hasConcept C43554185 @default.

• next