FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2054129096> ?p ?o ?g. }

• W2054129096 endingPage "34151" @default.
• W2054129096 startingPage "34143" @default.
• W2054129096 abstract "During origin-independent replisome assembly, the replication restart protein PriC prefers to load the replication fork helicase, DnaB, to stalled replication forks where there is a gap in the nascent leading strand. However, this activity can be obstructed if the 5′-end of the nascent lagging strand is near the template branch point. Here we provide biochemical evidence that the helicase activities of Rep and PriA function to unwind the nascent lagging strand DNA at such stalled replication forks. PriC then loads the replicative helicase, DnaB, onto the newly generated, single-stranded template for the purposes of replisome assembly and duplex unwinding ahead of the replication fork. Direct rescue of replication forks by the Rep-PriC and PriA-PriC pathways in this manner may contribute to genomic stability by avoiding the potential dangers of fork breakage inherent to recombination-dependent restart pathways. During origin-independent replisome assembly, the replication restart protein PriC prefers to load the replication fork helicase, DnaB, to stalled replication forks where there is a gap in the nascent leading strand. However, this activity can be obstructed if the 5′-end of the nascent lagging strand is near the template branch point. Here we provide biochemical evidence that the helicase activities of Rep and PriA function to unwind the nascent lagging strand DNA at such stalled replication forks. PriC then loads the replicative helicase, DnaB, onto the newly generated, single-stranded template for the purposes of replisome assembly and duplex unwinding ahead of the replication fork. Direct rescue of replication forks by the Rep-PriC and PriA-PriC pathways in this manner may contribute to genomic stability by avoiding the potential dangers of fork breakage inherent to recombination-dependent restart pathways. Although the two replisomes that proceed from oriC possess enough innate processivity to complete the replication of the entire Escherichiacoli chromosome, the replication forks that begin replication are often not the ones that finish the job at the terminus. Endogenous DNA damage, template nicks, and frozen protein-DNA complexes collapse the fork at a high frequency. Therefore, in addition to DNA repair processes, there must be an accurate system for replication restart in order for the cell to maintain genomic integrity and viability. Loading of DnaB, the replicative helicase, to the chromosome is the key step in replisome assembly. Thus, this process must be highly regulated. In solution, DnaB is maintained in a tight complex with DnaC (1Wickner S. Hurwitz J. Proc. Natl. Acad. Sci. U. S. A. 1975; 72: 921-925Crossref PubMed Scopus (113) Google Scholar), preventing DnaB from loading promiscuously onto single-stranded DNA-binding protein (SSB) 2The abbreviations used are: SSB, single-stranded DNA-binding protein; oligos, oligonucleotides; Pol III HE, DNA polymerase III holoenzyme; nt, nucleotides.-coated single-stranded DNA (2LeBowitz J.H. McMacken R. J. Biol. Chem. 1986; 261: 4738-4748Abstract Full Text PDF PubMed Google Scholar). A DnaB loading system is required to overcome the inhibition by SSB and deliver DnaB to the correct chromosomal position. For replication initiation at oriC, the recognition factor DnaA binds cooperatively to a series of 9-bp DnaA-boxes and assembles into a complex with the DNA wrapped around the periphery (3Fuller R.S. Funnell B.E. Kornberg A. Cell. 1984; 38: 889-900Abstract Full Text PDF PubMed Scopus (462) Google Scholar). AT-rich repeats are melted (4Bramhill D. Kornberg A. Cell. 1988; 52: 743-755Abstract Full Text PDF PubMed Scopus (514) Google Scholar) and DnaA promotes the transfer of DnaB from the DnaB-DnaC complex onto the melted DNA (5Baker T.A. Funnell B.E. Kornberg A. J. Biol. Chem. 1987; 262: 6877-6885Abstract Full Text PDF PubMed Google Scholar, 6Baker T.A. Sekimizu K. Funnell B.E. Kornberg A. Cell. 1986; 45: 53-64Abstract Full Text PDF PubMed Scopus (135) Google Scholar). Besides providing duplex unwinding activity at the replication fork, DnaB interacts transiently with the primase, DnaG (7Tougu K. Peng H. Marians K.J. J. Biol. Chem. 1994; 269: 4675-4682Abstract Full Text PDF PubMed Google Scholar), which synthesizes a short primer. The DNA polymerase III holoenzyme (Pol III HE) gains access to the DNA by recognizing the primer-template, and the replisome becomes fully assembled with a protein-protein interaction between DnaB and the τ subunit of the holoenzyme (8Kim S. Dallmann H.G. McHenry C.S. Marians K.J. Cell. 1996; 84: 643-650Abstract Full Text Full Text PDF PubMed Scopus (304) Google Scholar, 9Yuzhakov A. Turner J. O'Donnell M. Cell. 1996; 86: 877-886Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar). In cases where the replication fork either encounters a nick in the DNA template or a stalled replication fork undergoes breakage, fork collapse will result in a broken chromosome that is repaired by homologous recombination with an intact sister duplex to generate a D-loop structure (10Cox M.M. Goodman M.F. Kreuzer K.N. Sherratt D.J. Sandler S.J. Marians K.J. Nature. 2000; 404: 37-41Crossref PubMed Scopus (871) Google Scholar). The restart proteins PriA, PriB, and DnaT fulfill the requirement for a loading system to reassemble the replisome and resume replication by delivering DnaB to the structure. PriA has been shown to bind D-loops with high affinity (11McGlynn P. Al-Deib A.A. Liu J. Marians K.J. Lloyd R.G. J. Mol. Biol. 1997; 270: 212-221Crossref PubMed Scopus (165) Google Scholar, 12Nurse P. Liu J. Marians K.J. J. Biol. Chem. 1999; 274: 25026-25032Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar) and form a complex with PriB and DnaT (13Liu J. Marians K.J. J. Biol. Chem. 1999; 274: 25033-25041Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). This complex is competent to load DnaB from the DnaB/DnaC complex onto the displaced strand of the D-loop. Although PriA possesses 3′ → 5′ DNA helicase activity (14Lee M.S. Marians K.J. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 8345-8349Crossref PubMed Scopus (85) Google Scholar, 15Lasken R.S. Kornberg A. J. Biol. Chem. 1988; 263: 5512-5518Abstract Full Text PDF PubMed Google Scholar), this activity is required neither for replication restart from a D-loop containing molecule in vitro (16Liu J. Xu L. Sandler S.J. Marians K.J. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3552-3555Crossref PubMed Scopus (116) Google Scholar, 17Xu L. Marians K.J. Mol. Cell. 2003; 11: 817-826Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar), nor to complement many of the phenotypes associated with the loss of PriA (18Zavitz K.H. Marians K.J. J. Biol. Chem. 1992; 267: 6933-6940Abstract Full Text PDF PubMed Google Scholar). Instead, the helicase activity may be important in a direct, non-recombinogenic form of replication restart. To load DnaB to the lagging strand template of a fork for restart, at least 20 nucleotides of single-stranded DNA is required at the branch point (19Jezewska M.J. Kim U.S. Bujalowski W. Biochemistry. 1996; 35: 2129-2145Crossref PubMed Scopus (83) Google Scholar). On model forks with insufficient single-stranded DNA, PriA was shown to unwind the nascent lagging strand, generating a structure conducive to restart (20Jones J.M. Nakai H. J. Mol. Biol. 1999; 289: 503-516Crossref PubMed Scopus (86) Google Scholar). This form of restart was proposed to act in concert with the branch migration protein RecG (21McGlynn P. Lloyd R.G. Cell. 2000; 101: 35-45Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar). If replication restart is absolutely essential for cell survival, then PriA-independent restart mechanisms must exist, because the elimination of PriA, although harmful to the cell, is not lethal (22Nurse P. Zavitz K.H. Marians K.J. J. Bacteriol. 1991; 173: 6686-6693Crossref PubMed Google Scholar, 23Lee E.H. Kornberg A. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 3029-3032Crossref PubMed Scopus (104) Google Scholar). Disruption of the genes encoding either PriC or Rep led to inviability in the absence of PriA (24Sandler S.J. Genetics. 2000; 155: 487-497PubMed Google Scholar), implicating at least these two proteins in the PriA-independent pathway. In support of the model for multiple restart pathways, strains lacking both PriA and PriB, or PriC and Rep remain viable because the other pathway can compensate in each case. The mechanism for PriA- and PriB-dependent restart has been well characterized, but the restart pathway involving Rep and PriC is less understood. Furthermore, genetic evidence indicates the presence of a third restart pathway, about which little is known, that involves both PriA and PriC. We have recently reported evidence that PriC has the capability to load DnaB and restart replication on specific fork structures in reactions that are distinct from the PriA- and PriB-dependent system (25Heller R.C. Marians K.J. Mol. Cell. 2005; 17: 733-743Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). However, in those studies, because Rep was not required in the reactions, its contribution toward replication restart could not be elucidated. Like PriA, Rep exhibits 3′ → 5′ DNA helicase activity (26Yarranton G.T. Gefter M.L. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 1658-1662Crossref PubMed Scopus (149) Google Scholar) and also plays a role in the replication of the φX174 chromosome (27Scott J.F. Eisenberg S. Bertsch L.L. Kornberg A. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 193-197Crossref PubMed Scopus (135) Google Scholar). Although the processivity of Rep helicase activity is rather low on its own, it has the ability to displace bound proteins from the DNA template (28Yancey-Wrona J.E. Matson S.W. Nucleic Acids Res. 1992; 20: 6713-6721Crossref PubMed Scopus (76) Google Scholar). The rep mutant was reported to have a slower rate of replication fork movement, about 50-60% that of wild-type cells (29Lane H.E. Denhardt D.T. J. Mol. Biol. 1975; 97: 99-112Crossref PubMed Scopus (136) Google Scholar). Consequently, cells are larger, contain more DNA, and have more replication forks per cell (30Lane H.E. Denhardt D.T. J. Bacteriol. 1974; 120: 805-814Crossref PubMed Google Scholar). In combination with recB or recC disruptions, the rep mutant is inviable (31Uzest M. Ehrlich S.D. Michel B. Mol. Microbiol. 1995; 17: 1177-1188Crossref PubMed Scopus (68) Google Scholar), suggesting an increased frequency of double-strand breaks. Indeed, the rep mutant does accumulate linear DNA when temperature-sensitive RecB and RecC are inactivated by high temperature (32Michel B. Ehrlich S.D. Uzest M. EMBO J. 1997; 16: 430-438Crossref PubMed Scopus (382) Google Scholar). One explanation is that frequent replication pauses occur in the absence of Rep, perhaps because of an inability to remove blocking proteins, which leads to chromosome breakage. In this report, we describe how Rep participates in the direct, PriA-independent rescue of stalled replication forks and the role of the helicase activities of Rep and PriA in the restart process. In the Rep-PriC pathway, the latter protein plays a crucial, multifunctional role by loading both Rep and DnaB to branched structures. Both Rep and PriA have the ability to unwind nascent lagging strand DNA at the fork branch point, activities that are focused to the proper template strand by the presence of SSB. The newly single-stranded template is then utilized by PriC to load DnaB, which nucleates replisome reassembly and provides the replicative helicase activity. Thus the Rep-PriC and PriA-PriC pathways of replication restart exhibit similar properties and are likely to act at stalled forks where a blockage of leading strand synthesis has allowed the 5′-end of the nascent lagging strand to progress further along the template than the 3′-end of the nascent leading strand. DNA and Protein—The restart primosomal proteins PriA, PriC, DnaB, DnaC, and DnaG were all expressed in E. coli and purified as described previously (33Marians K.J. Methods Enzymol. 1995; 262: 507-521Crossref PubMed Scopus (54) Google Scholar). Oligonucleotides (oligos) were obtained from GeneLink. The forked, linear DNA template was prepared as described previously (25Heller R.C. Marians K.J. Mol. Cell. 2005; 17: 733-743Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). The Rep open reading frame was amplified by PCR from E. coli W3110 genomic DNA using a forward primer with the sequence 5′-CGGCGGCGCATATGCGTCTAAACCCCGGCCAAC-3′, and a reverse primer with the sequence 5′-GCCGCCGGATCCTTATTTCCCTCGTTTTGCCGCC-3′, and ligated into NdeI- and BamHI-digested pET-21a (Novagen) to create pRH72. Rep was purified from soluble extracts of BL21(DE3)(pLysS)(pRH72) by sequential chromatography on Q-Sepharose, Bio-Rex 70, single-stranded DNA cellulose, and hydroxylapatite, a combination and modification of previously published procedures (34Scott J.F. Kornberg A. J. Biol. Chem. 1978; 253: 3292-3297Abstract Full Text PDF PubMed Google Scholar, 35Lohman T.M. Chao K. Green J.M. Sage S. Runyon G.T. J. Biol. Chem. 1989; 264: 10139-10147Abstract Full Text PDF PubMed Google Scholar). SSB and the DNA Pol III HE (reconstituted from Pol III* and β) was prepared as described previously (36Hiasa H. Marians K.J. J. Biol. Chem. 1996; 271: 21529-21535Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). The fork substrates used in unwinding assays were prepared with the following oligos: (i) 1b-98, 5′-GCAAGCCTTCTACAGGTCGACCGTCCATGGCGACTCGAGACCGCAATACGGATAAGGGCTGAGCACGCCGACGAACATTCACCACGCCAGACCACGTA-3′; (ii) 3L-98, 5′-GACTATCTACGTCCGAGGCTCGCGCCGCAGACTCATTTAGCCCTTATCCGTATTGCGGTCTCGAGTCGCCATGGACGGTCGACCTGTAGAAGGCTTGC-3′; (iii) 11b-38, 5′-TACGTGGTCTGGCGTGGTGAATGTTCGTCGGCGTGCTC-3′; (iv) B-33, 5′-AGTCTGCGGCGCGAGCCTCGGACGTAGATAGTC-3′. The basic fork is composed of oligos 1b-98 and 3L-98; to this, the leading strand oligo 11b-38 or the lagging strand oligo B-33 was annealed to the fork or omitted, as noted. All fork substrates were 5′-end-labeled on 3L-98 using [γ-32P]ATP and T4 polynucleotide kinase. An excess (1.5-fold) of unlabeled oligos were mixed with the labeled oligo, annealed and then the completed fork structure was purified by electrophoresis through polyacrylamide gels as described previously (12Nurse P. Liu J. Marians K.J. J. Biol. Chem. 1999; 274: 25026-25032Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). Fork Unwinding Assays—Reaction mixtures (15 μl) containing 50 mm HEPES-KOH (pH 8.0), 40 μg/ml bovine serum albumin, 2 mm dithiothreitol, 2 mm ATP, 4 mm MgOAc2, 1 nm DNA substrate, and 125 nm SSB where indicated, were preincubated at 25 °C for 3 min. Reactions were started by addition of the indicated concentrations of Rep, PriC, PriA, DnaB, and DnaC, and incubated at 37 °C for 10 min, unless otherwise noted. Unwinding was terminated by addition of EDTA, SDS, and proteinase K to 20 mm, 0.5%, and 0.2 mg/ml, respectively, followed by incubation at 37 °C for 30 min. The samples were analyzed by electrophoresis at 17 V/cm for 1 h through a 10% polyacrylamide gel (30:1, acrylamide to bisacrylamide) using 100 mm Tris borate (pH 8.3), 2 mm EDTA as the electrophoresis buffer. The gel was fixed by soaking in 10% methanol, 7% HOAc, 5% glycerol, dried, exposed to a phosphorimager screen, and then autoradiographed. The fraction of intact substrate and unwound product bands were quantitated using a phosphorimager. Replication Restart Reactions—Replication restart reaction mixtures (15 μl) containing 50 mm HEPES-KOH (pH 8.0), MgOAc2 (5.5 mm for Rep-PriC reactions and 8 mm for PriA-PriC reactions), 10 mm dithiothreitol, 100 μg/ml bovine serum albumin, ATP (0.5 mm for Rep-PriC reactions and 1 mm for PriA-PriC reactions), 200 μm NTPs, 40 μm [α-32P]dATP (4000-5000 cpm/pmol), 40 μm dCTP, dTTP, and dGTP, 1nm linear, forked template DNA, 20 nm Pol III*, 30 nm β subunit of the HE, 250 nm SSB, Rep, and the primosomal proteins as indicated were incubated at 37 °C for 30 min. When present, PriA was at 32 nm (except when varied as indicated), Rep was at 200 nm (except when varied as indicated), PriC was at 320 nm, DnaB was at 60 nm, DnaC was at 400 nm, and DnaG was at 300 nm. DNA synthesis was terminated by the addition of EDTA to 33 mm. Total DNA synthesis was determined by assaying an aliquot of the reaction mixture for acid-insoluble radioactivity. Samples were prepared for electrophoresis by adding one-fifth volume of a loading dye mixture containing 150 mm NaOH, 10 mm EDTA, 6% sucrose, and 0.1% bromphenol blue. DNA products were analyzed by alkaline gel electrophoresis through a 0.8% agarose gel at 2 V/cm for 15.5 h using 30 mm NaOH and 2 mm EDTA as the electrophoresis buffer. For DNA size reference, a 5′-[32P]-1 kb ladder (NEB) was analyzed alongside the samples. Gels were neutralized with 5% trichloroacetic acid, dried, exposed to a phosphorimager screen, and then autoradiographed. PriC Stimulates Rep, but Not PriA, Helicase Activity—In considering the relationship between Rep and PriC, we asked whether PriC affected Rep helicase activity. When these analyses were conducted using partial duplex DNA substrates, no effect of PriC was detected (data not shown), however, when forked duplex substrates were used, PriC had a significant stimulatory effect (Fig. 1). The framework of the forked helicase substrates used in these experiments has been described previously (25Heller R.C. Marians K.J. Mol. Cell. 2005; 17: 733-743Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). The substrates are composed of two 98 nucleotide (nt)-long oligos. Annealing the two oligos generates a 60 bp duplex DNA with one blunt end and the other end consisting of two non-complementary, 38-nt long single-stranded tails. Various complementary oligos can be annealed to the single-stranded tails to represent the nascent leading and lagging strands at stalled replication forks. Alone, Rep exhibited weak activity on a forked substrate that had no oligos representing nascent DNA annealed to it; however, in the presence of PriC, unwinding activity was stimulated ∼6-fold (Fig. 1A). The DNA substrate is relatively small, so the stimulation of activity most likely represents an increase in Rep loading efficiency, although whether PriC also increases the processivity of Rep cannot be determined by this assay. During rolling circle DNA synthesis of the bacteriophage φX174, an interaction between Rep and the phage-encoded gene A protein at the replication fork enables Rep to accomplish processive unwinding of the duplex DNA of the phage chromosome (27Scott J.F. Eisenberg S. Bertsch L.L. Kornberg A. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 193-197Crossref PubMed Scopus (135) Google Scholar, 37Arai N. Kornberg A. J. Biol. Chem. 1981; 256: 5294-5298Abstract Full Text PDF PubMed Google Scholar). Based on our finding that PriC facilitates duplex unwinding by Rep, it is possible that PriC represents a cellular analog of the gene A protein. At a fixed concentration of Rep, introducing increased concentrations of PriC caused unwinding to increase, but stimulation exhibited a threshold effect (Fig. 1B). At low concentrations of PriC, activity was barely increased, but at higher PriC concentrations, activity increased rapidly, resulting in a sigmoidal titration curve. Whether this indicates cooperativity in binding between multiple PriC monomers and DNA or Rep is unclear at this time. In a previous report, a Rep helicase stimulatory protein was purified from E. coli cell extract (38Smith K.R. Yancey J.E. Matson S.W. J. Biol. Chem. 1989; 264: 6119-6126Abstract Full Text PDF PubMed Google Scholar). Like PriC, this protein was small and basic, stimulated unwinding activity with a pronounced sigmoidicity, and maximal stimulation was observed at a protein: DNA ratio of over 350. Because this stimulatory factor shares so many characteristics in common with PriC, they are likely to be the same protein. This stimulatory activity of PriC was specific for Rep. No stimulation of PriA helicase activity could be observed (Fig. 1C). The Presence of a Nascent Leading Strand and of SSB Modulates Rep and PriA Helicase Activities at Forked DNA Structures—Whereas the functional biochemical interaction between Rep and PriC indicated by the experiments described in Fig. 1 was consistent with the genetic observations, the helicase activity manifest was inconsistent with replication fork restart. It seemed unlikely that the unwinding of the template strands described would be productive. Rep cannot couple with the Pol III HE in the absence of the φX174 gene A protein and, unlike DnaB, exhibits no interaction with the primase. Such promiscuous unwinding of the template strands in the absence of replisome formation is sure to be deleterious. Under normal circumstances, DnaB is prevented from loading onto single-stranded DNA that is coated with SSB (2LeBowitz J.H. McMacken R. J. Biol. Chem. 1986; 261: 4738-4748Abstract Full Text PDF PubMed Google Scholar). Based on our previous observations that PriC was involved in a DnaB loading system that could overcome the SSB inhibition at stalled replication forks containing gaps in the leading strand (25Heller R.C. Marians K.J. Mol. Cell. 2005; 17: 733-743Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar), and that Rep helicase activity appeared to be important for restart, we hypothesized that a more productive role at a stalled replication fork for a non-replicative helicase such as Rep would be to modulate the structure of the fork by unwinding an obstructing DNA strand on the lagging strand template. Such an activity had already been ascribed to PriA (39Jones J.M. Nakai H. J. Mol. Biol. 2001; 312: 935-947Crossref PubMed Scopus (46) Google Scholar). When incubated with a forked substrate carrying a lagging strand oligo that was shortened from the 5′-end, leaving a 5-nt gap between it and the template branch point (this gap was used in order to be able to compare Rep and PriA action, it is required for PriA unwinding of the nascent lagging strand (data not shown and Ref. 39Jones J.M. Nakai H. J. Mol. Biol. 2001; 312: 935-947Crossref PubMed Scopus (46) Google Scholar)), Rep could unwind both the template strands (fork unwinding) and the duplex formed by the lagging strand template and the nascent lagging strand (Fig. 2A). The former activity is similar to that described in Fig. 1; however, note that in the absence of PriC a 5-fold higher concentration of Rep was required to sustain the same extent of unwinding (compare the Rep titration in the presence of PriC shown in Fig. 1A to the Rep titration in the absence of PriC shown in Fig. 2A). However, the persistence of the fork unwinding activity was still troubling. We therefore searched for elements that would act to modulate this unwinding activity by examining the influence of both the presence of a nascent leading strand and of SSB, elements likely to be present at a significant fraction of stalled fork structures. The presence of either a nascent leading strand or SSB suppressed the fork unwinding activity of Rep (Fig. 2, B-D). Both elements presumably act by the same mechanism, i.e. preventing access of Rep to the leading strand template. The ability of Rep to bind the forked substrates in the presence of SSB suggests that this protein, like PriA, possesses structure-specific DNA recognition. This is consistent with our observation that Rep can bind D-loop DNA specifically, even in the presence of SSB. 3K. J. Marians, unpublished data. These data indicate that the Rep helicase activity will be directed to unwind the nascent lagging strand at stalled replication forks, irrespective of the disposition of the nascent leading strand. Given the similarities between the Rep and PriA helicase activities, we asked whether the same was true for PriA. Unlike Rep, PriA did not exhibit any fork unwinding activity (Fig. 3). However, also unlike Rep, when a nascent leading strand was present at the fork, unwinding of the nascent lagging strand was suppressed (Fig. 3, A-C). This suppression was reversed by the presence of SSB (Fig. 3, D-F). In this case, we surmise that SSB acts to partially denature the branch point region, allowing PriA to gain access to the lagging strand template after recognition of the branched structure. Thus, SSB plays a critical role in ensuring that at stalled replication forks the helicase activities of Rep and PriA are applied in a fashion that will assist restart: to obviate a potentially inhibitory situation where access of DnaB to the lagging strand template is prevented. As described in the following sections, we proceeded to examine the complete mechanism of replication restart under such conditions. The observed PriA-catalyzed unwinding of the nascent lagging strand is consistent with a previous demonstration using similar structures formed during bacteriophage Mu DNA replication (39Jones J.M. Nakai H. J. Mol. Biol. 2001; 312: 935-947Crossref PubMed Scopus (46) Google Scholar). However, unlike Jones and Nakai (39Jones J.M. Nakai H. J. Mol. Biol. 2001; 312: 935-947Crossref PubMed Scopus (46) Google Scholar), we find that in the presence of SSB unwinding of the lagging strand by PriA occurs equally well whether or not the fork contains a leading strand (Fig. 3, D-F). We investigated this apparent discrepancy (supplemental Fig. S1). Under our conditions in the presence of SSB, the presence of a leading strand does not inhibit PriA unwinding of the lagging strand. In order to observe the inhibition observed by Jones and Nakai (39Jones J.M. Nakai H. J. Mol. Biol. 2001; 312: 935-947Crossref PubMed Scopus (46) Google Scholar), we had to use their experimental conditions, which included the opposite order of addition that we use. Jones and Nakai were adding PriA first and then SSB. When we do so we can observe the inhibition, although only if there is a 5-nt gap in the leading strand. This gap was used in the experiments of Jones and Nakai because it is present at the bacteriophage Mu fork. We consider our conditions to be more representative of those extant in the cell then those of Jones and Nakai, because SSB will always be present at stalled forks before they are recognized by any restart system. Rep and PriA Unwind the Nascent Lagging Strand at Stalled Replication Forks—Helicase assays were performed in the presence of SSB to determine how the presence of a nascent lagging strand affects the PriC system for DnaB loading. For these reactions, using synthetic oligos we modeled a stalled fork in which lagging strand DNA synthesis had progressed past leading strand synthesis. The leading strand oligo was omitted from the fork in order to model a large gap, and a lagging strand oligo was annealed near to the branch point to represent the continued nascent lagging strand DNA synthesis. (This is the same substrate used in Figs. 2, A and B and 3, A and D and is used here to maximize PriC-directed DnaB-loading activity, which is inhibited by the presence of a nascent leading strand that does not contain a sizable gap between its 3′-end and the fork branch point, as with the substrates used in Figs. 2, C and D and 3, B and E (25Heller R.C. Marians K.J. Mol. Cell. 2005; 17: 733-743Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar).) As expected, incubation with PriC or DnaB/C alone did not produce any unwinding products because the requirements for the PriC-dependent loading system were not met (Fig. 4, lanes 4 and 5). However, even incubation with PriC, DnaB, and DnaC together did not produce any unwinding product (lane 8). Because of the presence of the nascent lagging strand DNA, DnaB loading to this fork required an additional factor, either Rep or PriA, although targeting of these latter two proteins to the forked structures occurred by different mechanisms: PriA could recognize the branched structure independently, whereas Rep loading was mediated by PriC. Incubation of the fork with Rep alone produced a limited amount of product, and PriC was found to stimulate the observed unwinding (lanes 3 and 6), consistent with the results reported above (Fig. 1). Interestingly, only one unwinding product was observed from this SSB-coated model fork containing a lagging strand oligo. The nascent lagging strand was unwound exclusively, whereas the parental duplex was left intact. On the other hand, PriA bound the substrate and unwound the lagging strand equally well in either the presence or absence of PriC (lanes 10 and 11). Unwinding of the nascent lagging strand oligo provided a single stranded template for the loading of DnaB to the fork by PriC when all components were present: PriC, DnaB, and DnaC, in the presence of either PriA or Rep. Only under these conditions was DnaB loaded to the lagging strand template and able to use its 5′→3′ helicase activity to unwind the parental duplex (Fig. 4, lane 9 for Rep and lane 13 for PriA). The loading of DnaB to such a stalled replication fork should be sufficient to reassemble the replisome and allow replication to proceed. To test this supposition, we reconstituted the Rep-PriC and PriA-PriC replication restart reactions. Reconstitution of Replication Restart Mediated by the Rep-PriC and PriA-PriC Pathways—We have described previously a long linear forked template that we used to model replication restart at a stalled replication fork (25Heller R.C. Marians K.J. Mol. Cell. 2005; 17: 733-743Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar). The template is blunt-ended on one side, contains 6.9 kb of duplex DNA, and has two 38-nucleotide noncomplementary arms on the other end. The advantage of this template is that oligos of different lengths can be annealed to its arms, thereby modeling the structures of different types of stalled replication forks. The restart reactions are perfor" @default.
• W2054129096 created "2016-06-24" @default.
• W2054129096 creator A5068066930 @default.
• W2054129096 creator A5072077767 @default.
• W2054129096 date "2005-10-01" @default.
• W2054129096 modified "2023-10-05" @default.
• W2054129096 title "Unwinding of the Nascent Lagging Strand by Rep and PriA Enables the Direct Restart of Stalled Replication Forks" @default.
• W2054129096 cites W1484429384 @default.
• W2054129096 cites W1485021232 @default.
• W2054129096 cites W1493097357 @default.
• W2054129096 cites W1494323283 @default.
• W2054129096 cites W1510329672 @default.
• W2054129096 cites W1512516275 @default.
• W2054129096 cites W1516002069 @default.
• W2054129096 cites W1548796103 @default.
• W2054129096 cites W1558934363 @default.
• W2054129096 cites W1564119816 @default.
• W2054129096 cites W1570361288 @default.
• W2054129096 cites W1583270177 @default.
• W2054129096 cites W1583600685 @default.
• W2054129096 cites W1603916894 @default.
• W2054129096 cites W1605117055 @default.
• W2054129096 cites W1883762470 @default.
• W2054129096 cites W1985662030 @default.
• W2054129096 cites W1987914894 @default.
• W2054129096 cites W1997503948 @default.
• W2054129096 cites W1999925341 @default.
• W2054129096 cites W2001764918 @default.
• W2054129096 cites W2001823184 @default.
• W2054129096 cites W2005699935 @default.
• W2054129096 cites W2005954755 @default.
• W2054129096 cites W2007146285 @default.
• W2054129096 cites W2008250450 @default.
• W2054129096 cites W2011435761 @default.
• W2054129096 cites W2015598559 @default.
• W2054129096 cites W2015840719 @default.
• W2054129096 cites W2019081472 @default.
• W2054129096 cites W2025475717 @default.
• W2054129096 cites W2039764581 @default.
• W2054129096 cites W2043274368 @default.
• W2054129096 cites W2048680704 @default.
• W2054129096 cites W2065976083 @default.
• W2054129096 cites W2070059581 @default.
• W2054129096 cites W2070872901 @default.
• W2054129096 cites W2083123225 @default.
• W2054129096 cites W2084874442 @default.
• W2054129096 cites W2089013942 @default.
• W2054129096 cites W2093398311 @default.
• W2054129096 cites W2094625390 @default.
• W2054129096 cites W2097766238 @default.
• W2054129096 cites W2113506888 @default.
• W2054129096 cites W2118429793 @default.
• W2054129096 cites W2124145206 @default.
• W2054129096 cites W2148007373 @default.
• W2054129096 cites W2154208108 @default.
• W2054129096 cites W2155885923 @default.
• W2054129096 cites W2158524133 @default.
• W2054129096 cites W2160452155 @default.
• W2054129096 cites W2163827697 @default.
• W2054129096 doi "https://doi.org/10.1074/jbc.m507224200" @default.
• W2054129096 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16079128" @default.
• W2054129096 hasPublicationYear "2005" @default.
• W2054129096 type Work @default.
• W2054129096 sameAs 2054129096 @default.
• W2054129096 citedByCount "84" @default.
• W2054129096 countsByYear W20541290962012 @default.
• W2054129096 countsByYear W20541290962013 @default.
• W2054129096 countsByYear W20541290962014 @default.
• W2054129096 countsByYear W20541290962015 @default.
• W2054129096 countsByYear W20541290962016 @default.
• W2054129096 countsByYear W20541290962017 @default.
• W2054129096 countsByYear W20541290962018 @default.
• W2054129096 countsByYear W20541290962019 @default.
• W2054129096 countsByYear W20541290962020 @default.
• W2054129096 countsByYear W20541290962021 @default.
• W2054129096 countsByYear W20541290962022 @default.
• W2054129096 countsByYear W20541290962023 @default.
• W2054129096 crossrefType "journal-article" @default.
• W2054129096 hasAuthorship W2054129096A5068066930 @default.
• W2054129096 hasAuthorship W2054129096A5072077767 @default.
• W2054129096 hasBestOaLocation W20541290961 @default.
• W2054129096 hasConcept C12590798 @default.
• W2054129096 hasConcept C142724271 @default.
• W2054129096 hasConcept C159047783 @default.
• W2054129096 hasConcept C2776962539 @default.
• W2054129096 hasConcept C71924100 @default.
• W2054129096 hasConcept C86803240 @default.
• W2054129096 hasConcept C95444343 @default.
• W2054129096 hasConceptScore W2054129096C12590798 @default.
• W2054129096 hasConceptScore W2054129096C142724271 @default.
• W2054129096 hasConceptScore W2054129096C159047783 @default.
• W2054129096 hasConceptScore W2054129096C2776962539 @default.
• W2054129096 hasConceptScore W2054129096C71924100 @default.
• W2054129096 hasConceptScore W2054129096C86803240 @default.
• W2054129096 hasConceptScore W2054129096C95444343 @default.
• W2054129096 hasIssue "40" @default.
• W2054129096 hasLocation W20541290961 @default.
• W2054129096 hasOpenAccess W2054129096 @default.

• next