FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2054133060> ?p ?o ?g. }

• W2054133060 endingPage "15" @default.
• W2054133060 startingPage "7" @default.
• W2054133060 abstract "Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples." @default.
• W2054133060 created "2016-06-24" @default.
• W2054133060 creator A5002958861 @default.
• W2054133060 creator A5006674069 @default.
• W2054133060 creator A5019487491 @default.
• W2054133060 creator A5055873959 @default.
• W2054133060 creator A5059755311 @default.
• W2054133060 creator A5090883898 @default.
• W2054133060 date "2015-10-01" @default.
• W2054133060 modified "2023-10-13" @default.
• W2054133060 title "DNA Functionalized Direct Electro-deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi" @default.
• W2054133060 cites W1853499144 @default.
• W2054133060 cites W1965332246 @default.
• W2054133060 cites W1973673495 @default.
• W2054133060 cites W1974622938 @default.
• W2054133060 cites W1975052466 @default.
• W2054133060 cites W1980477536 @default.
• W2054133060 cites W1993297297 @default.
• W2054133060 cites W1994138077 @default.
• W2054133060 cites W2015655898 @default.
• W2054133060 cites W2022423885 @default.
• W2054133060 cites W2024172998 @default.
• W2054133060 cites W2026694409 @default.
• W2054133060 cites W2027614166 @default.
• W2054133060 cites W2031664809 @default.
• W2054133060 cites W2032994792 @default.
• W2054133060 cites W2036103981 @default.
• W2054133060 cites W2048262811 @default.
• W2054133060 cites W2060181267 @default.
• W2054133060 cites W2078723411 @default.
• W2054133060 cites W2080870150 @default.
• W2054133060 cites W2089700871 @default.
• W2054133060 cites W2102627886 @default.
• W2054133060 cites W2108089273 @default.
• W2054133060 cites W2109730437 @default.
• W2054133060 cites W2109791101 @default.
• W2054133060 cites W2118822531 @default.
• W2054133060 cites W2122800331 @default.
• W2054133060 cites W2129678715 @default.
• W2054133060 cites W2148218785 @default.
• W2054133060 cites W2159664632 @default.
• W2054133060 cites W2301210057 @default.
• W2054133060 cites W2319910320 @default.
• W2054133060 doi "https://doi.org/10.1016/j.bioelechem.2015.03.005" @default.
• W2054133060 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/25917793" @default.
• W2054133060 hasPublicationYear "2015" @default.
• W2054133060 type Work @default.
• W2054133060 sameAs 2054133060 @default.
• W2054133060 citedByCount "27" @default.
• W2054133060 countsByYear W20541330602016 @default.
• W2054133060 countsByYear W20541330602017 @default.
• W2054133060 countsByYear W20541330602018 @default.
• W2054133060 countsByYear W20541330602019 @default.
• W2054133060 countsByYear W20541330602020 @default.
• W2054133060 countsByYear W20541330602021 @default.
• W2054133060 countsByYear W20541330602022 @default.
• W2054133060 crossrefType "journal-article" @default.
• W2054133060 hasAuthorship W2054133060A5002958861 @default.
• W2054133060 hasAuthorship W2054133060A5006674069 @default.
• W2054133060 hasAuthorship W2054133060A5019487491 @default.
• W2054133060 hasAuthorship W2054133060A5055873959 @default.
• W2054133060 hasAuthorship W2054133060A5059755311 @default.
• W2054133060 hasAuthorship W2054133060A5090883898 @default.
• W2054133060 hasConcept C104317684 @default.
• W2054133060 hasConcept C147789679 @default.
• W2054133060 hasConcept C160756335 @default.
• W2054133060 hasConcept C171250308 @default.
• W2054133060 hasConcept C17525397 @default.
• W2054133060 hasConcept C185592680 @default.
• W2054133060 hasConcept C192562407 @default.
• W2054133060 hasConcept C2777869211 @default.
• W2054133060 hasConcept C2779525745 @default.
• W2054133060 hasConcept C52859227 @default.
• W2054133060 hasConcept C55493867 @default.
• W2054133060 hasConcept C7040849 @default.
• W2054133060 hasConcept C74231797 @default.
• W2054133060 hasConceptScore W2054133060C104317684 @default.
• W2054133060 hasConceptScore W2054133060C147789679 @default.
• W2054133060 hasConceptScore W2054133060C160756335 @default.
• W2054133060 hasConceptScore W2054133060C171250308 @default.
• W2054133060 hasConceptScore W2054133060C17525397 @default.
• W2054133060 hasConceptScore W2054133060C185592680 @default.
• W2054133060 hasConceptScore W2054133060C192562407 @default.
• W2054133060 hasConceptScore W2054133060C2777869211 @default.
• W2054133060 hasConceptScore W2054133060C2779525745 @default.
• W2054133060 hasConceptScore W2054133060C52859227 @default.
• W2054133060 hasConceptScore W2054133060C55493867 @default.
• W2054133060 hasConceptScore W2054133060C7040849 @default.
• W2054133060 hasConceptScore W2054133060C74231797 @default.
• W2054133060 hasLocation W20541330601 @default.
• W2054133060 hasLocation W20541330602 @default.
• W2054133060 hasOpenAccess W2054133060 @default.
• W2054133060 hasPrimaryLocation W20541330601 @default.
• W2054133060 hasRelatedWork W1976861527 @default.
• W2054133060 hasRelatedWork W1996763009 @default.
• W2054133060 hasRelatedWork W2008912847 @default.
• W2054133060 hasRelatedWork W2092816171 @default.
• W2054133060 hasRelatedWork W2193008910 @default.

• next