FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2054631468> ?p ?o ?g. }

• W2054631468 endingPage "36340" @default.
• W2054631468 startingPage "36330" @default.
• W2054631468 abstract "Activation of the receptor for advanced glycation endproducts (RAGE) by its multiple ligands can trigger diverse signaling pathways with injurious or pro-survival consequences. In this study, we show that Rage mRNA and protein levels were stimulated in the mouse brain after experimental stroke and systemic hypoxia. In both cases, RAGE expression was primarily associated with neurons. Activation of RAGE-dependent pathway(s) post-ischemia appears to have a neuroprotective role because mice genetically deficient for RAGE exhibited increased infarct size 24 h after injury. Up-regulation of RAGE expression was also observed in primary neurons subjected to hypoxia or oxygen-glucose deprivation, an in vitro model of ischemia. Treatment of neurons with low concentrations of S100B decreased neuronal death after oxygen-glucose deprivation, and this effect was abolished by a neutralizing antibody against RAGE. Conversely, high concentrations of exogenous S100B had a cytotoxic effect that seems to be RAGE-independent. As an important novel finding, we demonstrate that hypoxic stimulation of RAGE expression is mediated by the transcription factor hypoxia-inducible factor-1. This conclusion is supported by the finding that HIF-1α down-regulation by Cre-mediated excision drastically decreased RAGE induction by hypoxia or desferrioxamine. In addition, we showed that the mouse RAGE promoter region contains at least one functional HIF-1 binding site, located upstream of the proposed transcription start site. A luciferase reporter construct containing this RAGE promoter fragment was activated by hypoxia, and mutation at the potential HIF-1 binding site decreased hypoxia-dependent promoter activation. Specific binding of HIF-1 to this putative HRE in hypoxic cells was detected by chromatin immunoprecipitation assay. Activation of the receptor for advanced glycation endproducts (RAGE) by its multiple ligands can trigger diverse signaling pathways with injurious or pro-survival consequences. In this study, we show that Rage mRNA and protein levels were stimulated in the mouse brain after experimental stroke and systemic hypoxia. In both cases, RAGE expression was primarily associated with neurons. Activation of RAGE-dependent pathway(s) post-ischemia appears to have a neuroprotective role because mice genetically deficient for RAGE exhibited increased infarct size 24 h after injury. Up-regulation of RAGE expression was also observed in primary neurons subjected to hypoxia or oxygen-glucose deprivation, an in vitro model of ischemia. Treatment of neurons with low concentrations of S100B decreased neuronal death after oxygen-glucose deprivation, and this effect was abolished by a neutralizing antibody against RAGE. Conversely, high concentrations of exogenous S100B had a cytotoxic effect that seems to be RAGE-independent. As an important novel finding, we demonstrate that hypoxic stimulation of RAGE expression is mediated by the transcription factor hypoxia-inducible factor-1. This conclusion is supported by the finding that HIF-1α down-regulation by Cre-mediated excision drastically decreased RAGE induction by hypoxia or desferrioxamine. In addition, we showed that the mouse RAGE promoter region contains at least one functional HIF-1 binding site, located upstream of the proposed transcription start site. A luciferase reporter construct containing this RAGE promoter fragment was activated by hypoxia, and mutation at the potential HIF-1 binding site decreased hypoxia-dependent promoter activation. Specific binding of HIF-1 to this putative HRE in hypoxic cells was detected by chromatin immunoprecipitation assay. The receptor for advanced glycation end products (RAGE) 4The abbreviations used are:RAGEreceptor for advanced glycation end productsHIF-1hypoxia-inducible factor-1HREhypoxia-response elementHIhypoxia-ischemiaOGDoxygen-glucose deprivationDFOdesferrioxamineDMOGdimethyloxalglycineAdGFPadenovirus encoding GFPPBSphosphate-buffered salineRTreverse transcriptaseVEGFvascular endothelial growth factorEMSAelectrophoretic mobility shift assay. 4The abbreviations used are:RAGEreceptor for advanced glycation end productsHIF-1hypoxia-inducible factor-1HREhypoxia-response elementHIhypoxia-ischemiaOGDoxygen-glucose deprivationDFOdesferrioxamineDMOGdimethyloxalglycineAdGFPadenovirus encoding GFPPBSphosphate-buffered salineRTreverse transcriptaseVEGFvascular endothelial growth factorEMSAelectrophoretic mobility shift assay. is a member of the immunoglobin superfamily of cell surface molecules. It was originally identified by its capacity to bind advanced glycation end products, adducts that accumulate during natural aging and are produced at an augmented rate during diabetes (1Neeper M. Schmidt A.M. Brett J. Yan S.D. Wang F. Pan Y.C. Elliston K. Stern D. Shaw A. J. Biol. Chem. 1992; 267: 14998-15004Abstract Full Text PDF PubMed Google Scholar). Subsequently, several other ligands for this receptor have been reported including amyloid-β peptide, high-mobility group box 1, some members of the S100/calgranulin family, and Mac-1 (2Chavakis T. Bierhaus A. Al Fakhri N. Schneider D. Witte S. Linn T. Nagashima M. Morser J. Arnold B. Preissner K.T. Nawroth P.P. J. Exp. Med. 2003; 198: 1507-1515Crossref PubMed Scopus (501) Google Scholar, 3Hofmann M.A. Drury S. Fu C. Qu W. Taguchi A. Lu Y. Avila C. Kambham N. Bierhaus A. Nawroth P. Neurath M.F. Slattery T. Beach D. McClary J. Nagashima M. Morser J. Stern D. Schmidt A.M. Cell. 1999; 97: 889-901Abstract Full Text Full Text PDF PubMed Scopus (1582) Google Scholar, 4Hori O. Brett J. Slattery T. Cao R. Zhang J. Chen J.X. Nagashima M. Lundh E.R. Vijay S. Nitecki D. J. Biol. Chem. 1995; 270: 25752-25761Abstract Full Text Full Text PDF PubMed Scopus (1011) Google Scholar, 5Yan S.D. Chen X. Fu J. Chen M. Zhu H. Roher A. Slattery T. Zhao L. Nagashima M. Morser J. Migheli A. Nawroth P. Stern D. Schmidt A.M. Nature. 1996; 382: 685-691Crossref PubMed Scopus (1797) Google Scholar). Multiple studies indicate that RAGE signaling has profound stimulatory effects on gene expression of inflammatory mediators, a mechanism that has been implicated in the pathogenesis of diabetic complications in the periphery (for review, see Ref. 6Yan S.F. Ramasamy R. Naka Y. Schmidt A.M. Circ. Res. 2003; 93: 1159-1169Crossref PubMed Scopus (458) Google Scholar). In the central nervous system, the expression of RAGE has been described in several cell types. During the embryonic and early postnatal period, RAGE is highly expressed by hippocampal, cortical, and cerebellar neurons (4Hori O. Brett J. Slattery T. Cao R. Zhang J. Chen J.X. Nagashima M. Lundh E.R. Vijay S. Nitecki D. J. Biol. Chem. 1995; 270: 25752-25761Abstract Full Text Full Text PDF PubMed Scopus (1011) Google Scholar). Expression of this receptor is limited in the normal adult brain, but enhanced in pathological conditions like Alzheimer disease (5Yan S.D. Chen X. Fu J. Chen M. Zhu H. Roher A. Slattery T. Zhao L. Nagashima M. Morser J. Migheli A. Nawroth P. Stern D. Schmidt A.M. Nature. 1996; 382: 685-691Crossref PubMed Scopus (1797) Google Scholar, 7Brett J. Schmidt A.M. Yan S.D. Zou Y.S. Weidman E. Pinsky D. Nowygrod R. Neeper M. Przysiecki C. Shaw A. Am. J. Pathol. 1993; 143: 1699-1712PubMed Google Scholar). In this pathology, RAGE expression was observed not only in neurons but also in endothelial cells, and microglia (5Yan S.D. Chen X. Fu J. Chen M. Zhu H. Roher A. Slattery T. Zhao L. Nagashima M. Morser J. Migheli A. Nawroth P. Stern D. Schmidt A.M. Nature. 1996; 382: 685-691Crossref PubMed Scopus (1797) Google Scholar, 8Lue L.F. Walker D.G. Brachova L. Beach T.G. Rogers J. Schmidt A.M. Stern D.M. Yan S.D. Exp. Neurol. 2001; 171: 29-45Crossref PubMed Scopus (372) Google Scholar). Several RAGE ligands are produced in the brain under normal and pathological conditions; interactions of these ligands with RAGE can lead to multiple molecular and cellular consequences, depending on the cell type involved and the nature and concentration of the ligand. S100B is one such ligand. In addition to its intracellular function, when secreted S100B can exert autocrine and paracrine effects that have trophic or toxic impact depending on its concentration. It has been proposed that activation of RAGE can mediate both sets of effects (9Huttunen H.J. Kuja-Panula J. Sorci G. Agneletti A.L. Donato R. Rauvala H. J. Biol. Chem. 2000; 275: 40096-40105Abstract Full Text Full Text PDF PubMed Scopus (502) Google Scholar). In vitro studies using primary neurons or neuroblastoma cells showed that stimulation of RAGE by low levels of S100B leads to neurite outgrowth, and activation of pro-survival pathways during stress conditions like trophic factor deprivation, glutamate, N-methyl-d-aspartate, or amyloid-β toxicity (9Huttunen H.J. Kuja-Panula J. Sorci G. Agneletti A.L. Donato R. Rauvala H. J. Biol. Chem. 2000; 275: 40096-40105Abstract Full Text Full Text PDF PubMed Scopus (502) Google Scholar, 10Ahlemeyer B. Beier H. Semkova I. Schaper C. Krieglstein J. Brain Res. 2000; 858: 121-128Crossref PubMed Scopus (165) Google Scholar, 11Businaro R. Leone S. Fabrizi C. Sorci G. Donato R. Lauro G.M. Fumagalli L. J. Neurosci. Res. 2006; 83: 897-906Crossref PubMed Scopus (80) Google Scholar, 12Kogel D. Peters M. Konig H.G. Hashemi S.M. Bui N.T. Arolt V. Rothermundt M. Prehn J.H. Neuroscience. 2004; 127: 913-920Crossref PubMed Scopus (78) Google Scholar). On the other hand, treatment of primary neurons, astrocytes, or microglia with relatively high doses of S100B leads to oxidative stress, NF-κB activation, expression of proinflammatory mediators, and cytotoxicity (9Huttunen H.J. Kuja-Panula J. Sorci G. Agneletti A.L. Donato R. Rauvala H. J. Biol. Chem. 2000; 275: 40096-40105Abstract Full Text Full Text PDF PubMed Scopus (502) Google Scholar, 11Businaro R. Leone S. Fabrizi C. Sorci G. Donato R. Lauro G.M. Fumagalli L. J. Neurosci. Res. 2006; 83: 897-906Crossref PubMed Scopus (80) Google Scholar, 13Ponath G. Schettler C. Kaestner F. Voigt B. Wentker D. Arolt V. Rothermundt M. J. Neuroimmunol. 2007; 184: 214-222Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar, 14Vincent A.M. Perrone L. Sullivan K.A. Backus C. Sastry A.M. Lastoskie C. Feldman E.L. Endocrinology. 2007; 148: 548-558Crossref PubMed Scopus (189) Google Scholar). Little is known about the in vivo synergistic or inhibitory effects of S100B and the other RAGE ligands, and for some of these proteins (i.e. high-mobility group box 1, S100B, and amyloid-β) other cell surface interaction sites besides RAGE have been postulated (15Park J.S. Svetkauskaite D. He Q. Kim J.Y. Strassheim D. Ishizaka A. Abraham E. J. Biol. Chem. 2004; 279: 7370-7377Abstract Full Text Full Text PDF PubMed Scopus (1309) Google Scholar, 16Sorci G. Riuzzi F. Agneletti A.L. Marchetti C. Donato R. Mol. Cell. Biol. 2003; 23: 4870-4881Crossref PubMed Scopus (72) Google Scholar).Recently, it was reported that expression of RAGE is enhanced by ischemia both in the brain and heart (17Bucciarelli L.G. Kaneko M. Ananthakrishnan R. Harja E. Lee L.K. Hwang Y.C. Lerner S. Bakr S. Li Q. Lu Y. Song F. Qu W. Gomez T. Zou Y.S. Yan S.F. Schmidt A.M. Ramasamy R. Circulation. 2006; 113: 1226-1234Crossref PubMed Scopus (188) Google Scholar, 18Ma L. Carter R.J. Morton A.J. Nicholson L.F. Brain Res. 2003; 966: 167-174Crossref PubMed Scopus (47) Google Scholar). In addition, it is well established that the production of the glial-derived protein S100B is substantially enhanced upon activation in response to cerebral ischemia (19Matsui T. Mori T. Tateishi N. Kagamiishi Y. Satoh S. Katsube N. Morikawa E. Morimoto T. Ikuta F. Asano T. J. Cereb. Blood Flow Metab. 2002; 22: 711-722Crossref PubMed Scopus (140) Google Scholar, 20Yasuda Y. Tateishi N. Shimoda T. Satoh S. Ogitani E. Fujita S. Brain Res. 2004; 1021: 20-31Crossref PubMed Scopus (73) Google Scholar). These reports support the possibility of an effective activation of RAGE-mediated signaling in the ischemic brain, the consequences of which have not been explored. Regulation of many cellular responses to ischemia requires the concerted activation of various transcription factors including hypoxia inducible factor 1 (HIF-1). HIF-1 is a heterodimer composed of HIF-1α and HIF-1β subunits; HIF-1α is the regulatory component of this complex and its expression is exquisitely regulated by an oxygen-dependent post-translational modification that targets HIF-1α for proteosomal degradation (for review, see Ref. 21Ratcliffe P.J. Clin. Med. 2006; 6: 573-578Crossref PubMed Scopus (27) Google Scholar). During hypoxia, HIF-1α is stabilized, translocates into the nucleus where it binds HIF-1β and forms the active HIF-1 complex. Interaction of HIF-1 with its consensus DNA binding site is required for the hypoxia-induced expression of a vast array of target genes, which are involved in various cellular and systemic adaptive responses to hypoxia, including erythropoiesis, angiogenesis, vasomotor regulation, cell proliferation and survival, cell death, and matrix metabolism, among others (22Semenza G.L. J. Appl. Physiol. 2000; 88: 1474-1480Crossref PubMed Scopus (1470) Google Scholar, 23Wenger R.H. Stiehl D.P. Camenisch G. Sci. STKE 2005. 2005; : re12Google Scholar). HIF-1α is up-regulated in the hypoxic-ischemic brain (24Baranova O. Miranda L.F. Pichiule P. Dragatsis I. Johnson R.S. Chavez J.C. J. Neurosci. 2007; 27: 6320-6332Crossref PubMed Scopus (295) Google Scholar, 25Bergeron M. Yu A.Y. Solway K.E. Semenza G.L. Sharp F.R. Eur. J. Neurosci. 1999; 11: 4159-4170Crossref PubMed Scopus (365) Google Scholar, 26Chavez J.C. LaManna J.C. J. Neurosci. 2002; 22: 8922-8931Crossref PubMed Google Scholar), however, potential interactions with S100B or RAGE have not been investigated. The purpose of this study was to investigate this potential signaling pathway in hypoxia-ischemia. We confirm earlier findings of neuronal RAGE up-regulation after cerebral hypoxia-ischemia (HI) in the mouse and further demonstrate that RAGE activation in the ischemic brain may have a neuroprotective role because RAGE-null mice displayed exacerbated brain damage when subjected to HI. In addition, by using a loss-of-function approach, we show that HIF-1 is required for RAGE expression during hypoxia. Chromatin immunoprecipitation experiments demonstrate that hypoxia induces the association of endogenous HIF-1α to the RAGE promoter. Finally, we show that activation of RAGE in primary neurons by low concentrations of S100B improves neuronal survival after oxygen-glucose deprivation. Conversely, high concentrations of S100B have a RAGE-independent cytotoxic effect. Together, our results indicate that HIF-1 mediates the transcriptional activation of RAGE expression in neurons, and activation of this receptor can be viewed as part of the glianeuron communication system that might be important for the neuronal response to ischemic insults, and explain the basis for the biphasic effects of S100B in the brain.EXPERIMENTAL PROCEDURESAnimals—The generation of RAGE-null mice has been described in detail elsewhere (27Constien R. Forde A. Liliensiek B. Grone H.J. Nawroth P. Hammerling G. Arnold B. Genesis. 2001; 30: 36-44Crossref PubMed Scopus (229) Google Scholar, 28Liliensiek B. Weigand M.A. Bierhaus A. Nicklas W. Kasper M. Hofer S. Plachky J. Grone H.J. Kurschus F.C. Schmidt A.M. Yan S.D. Martin E. Schleicher E. Stern D.M. Hammerling G.G. Nawroth P.P. Arnold B. J. Clin. Investig. 2004; 113: 1641-1650Crossref PubMed Scopus (454) Google Scholar). The RAGE-null animals used for the present study were provided by Dr. A. M. Schmidt, these animals have been backcrossed into the C57Bl/6J strain for >10 generations at the Columbia University animal facility. Age-matched wild-type C57Bl/6J mice were used as controls (The Jackson Laboratories, Bar Harbor, ME). RAGE-null mice are viable, and display normal development and reproductive capacity. We found no differences in pre-ischemic body weight and blood glucose levels among RAGE-null and control animals. Toth et al. (29Toth C. Schmidt A.M. Tuor U.I. Francis G. Foniok T. Brussee V. Kaur J. Yan S.F. Martinez J.A. Barber P.A. Buchan A. Zochodne D.W. Neurobiol. Dis. 2006; 23: 445-461Crossref PubMed Scopus (79) Google Scholar) recently described normal brain weight and no white matter abnormalities in RAGE-null mice. Mice carrying conditional Hif-1α floxed alleles (Hif-1αF/F) were generously provided by Dr. Randal Johnson (University of California, San Diego). These animals (C57Bl/6 genetic background) were generated by engineering loxP sites flanking exon 2 of the Hif-1α gene as described previously (30Ryan H.E. Poloni M. McNulty W. Elson D. Gassmann M. Arbeit J.M. Johnson R.S. Cancer Res. 2000; 60: 4010-4015PubMed Google Scholar).Induction of Unilateral Cerebral Hypoxia-ischemia Damage—Hypoxia-ischemia was induced in male RAGE-null or wild-type mice (12–15 weeks) as described previously (31Vannucci S.J. Willing L.B. Goto S. Alkayed N.J. Brucklacher R.M. Wood T.L. Towfighi J. Hurn P.D. Simpson I.A. J. Cereb. Blood Flow Metab. 2001; 21: 52-60Crossref PubMed Scopus (123) Google Scholar, 32Zhang L. Nair A. Krady K. Corpe C. Bonneau R.H. Simpson I.A. Vannucci S.J. J. Clin. Investig. 2004; 113: 85-95Crossref PubMed Scopus (70) Google Scholar). Animals were anesthetized with isoflurane (2.5% induction, 1.5% maintenance), and the right common carotid artery was isolated and double ligated with 4-0 surgical silk. The incision was sutured, and animals were allowed to recover with access to food and water for 2 h. Then, animals were exposed to hypoxia (30 min) in custom-designed plexiglass chambers individually equipped with oxygen and temperature sensors (OxyCycler A-series, BioSpherix, Redfield, NY). Oxygen levels during hypoxic exposure were monitored and controlled at a constant concentration of 8% O2 balanced with nitrogen. Chamber temperature was maintained at 35 °C; preliminary experiments showed that at this temperature, the animals rectal temperature was 37 °C. After hypoxia, animals were allowed to recover at normoxia for 30 min in the chambers, and then returned to their cages. Animals were euthanized at 6 h to 5 days of recovery. The duration of systemic hypoxia was chosen to assure consistent injury in 80% of the animals and low mortality rate by 48 h of recovery. Animals with right common carotid artery ligation without hypoxia were used as sham-operated controls.Systemic Hypoxia—C57Bl6J male mice (12 weeks old) were exposed to normobaric hypoxia (10% O2 balanced with nitrogen) for 24 and 48 h (BioSpherix) with access to food and water. Littermate controls were kept under normoxia in a similar chamber for the duration of the experiment. Animals were sacrificed immediately after hypoxia.Infarct Volume and Immunohistochemistry—Brains were quickly removed from the skull and frozen in dry ice-chilled isopentane (–30 °C). Coronal sections (25 μm) were cut serially in a Leica cryostat and mounted on superfrost slides (VWR). The extent of brain infarction was identified using cresyl violet staining; the infarcted area was determined indirectly by subtracting the area of healthy tissue in the ipsilateral hemisphere from the area of the contralateral hemisphere. Infarction volume was calculated by integration of infarct areas measured in 12 equidistant sections (at 250-μm intervals) encompassing the entire lesion. For immunohistochemistry, sections were fixed with ice-cold methanol (–80 °C), incubated with PBS containing 0.4% (v/v) Triton X-100 and 10% (w/v) normal serum for 2 h. Subsequently, sections were incubated overnight at 4 °C with rat polyclonal antibody against RAGE (1:100; R&D Systems). RAGE-positive cells were visualized with secondary biotinylated anti-rat antibody (1:200; Vector Laboratories, Burlingame, CA) and Cy3-conjugated streptavidin (1:500, Molecular Probes). Sections were subsequently double-stained for the neuronal specific nuclear protein NeuN (1:200, Chemicon) using the Vector M.O.M. Immunodetection kit. An additional group of sections were double stained with the astrocyte marker glial fibrillary acidic protein, using a polyclonal rabbit anti-glial fibrillary acidic protein antibody (1:400; Dako) and a secondary anti-rabbit antibody conjugated with fluorescein (1:100; Invitrogen). Staining was analyzed and documented using an Axiovert 200M microscope equipped with AxioVision software. The specificity of RAGE immunohistochemistry was confirmed by showing negligible staining in the ischemic RAGE-null mouse brain (not shown).Cell Culture and Treatments—Primary neuronal cultures were prepared from cerebral cortices of wild-type C57Bl/6J or homozygote conditional floxed HIF-1α (HIF-1αF/F) mouse embryos (E15), according to the protocol described by Chavez et al. (33Chavez J.C. Baranova O. Lin J. Pichiule P. J. Neurosci. 2006; 26: 9471-9481Crossref PubMed Scopus (192) Google Scholar). Briefly, dissected cortices were dissociated in Earl's balance salt solution containing papain (50 units/ml) and DNase I (100 units/ml). Cells were seeded in poly-d-lysine-coated plates under serum-free conditions using Neurobasal medium supplemented with B27, glutamine (2 mm), glutamate (25 μm), and β-mercapthoethanol (25 mm) (Invitrogen). On the fourth day of plating, one-half of the medium was replaced with glutamate-free B27/Neurobasal medium, and subsequently cultures were fed every 4 days with glutamate-free medium. These cultures contain >90% neurons as determined by microtubule-associated protein-2 cytochemistry. Experiments were performed in neurons at days 10–15 in vitro unless otherwise indicated. 3T3 NIH cells (ATCC) were grown in Dulbecco's modified Eagle's medium supplemented with 10% bovine fetal serum. Primary neurons were stimulated with bovine brain S100B protein (Calbiochem), desferrioxamine (Sigma), or dimethyloxalglycine (Sigma) freshly dissolved in PBS at the indicated concentrations. RAGE-blocking antibody (Ab-RAGE) was provided by Dr. A. M. Schmidt (Columbia University, New York).Hypoxia and Oxygen Glucose Deprivation—A custom-made temperature controlled hypoxic/anaerobic glove-box system was used (Coy Laboratories, MI). This system is equipped with an inverted microscope that allows visual inspection of cell viability before terminating each experiment. For hypoxia treatments, the system was set up at 37 °C with an atmosphere of 0.5% O2, 5%CO2, and 94% N2, and all solutions were pre-equilibrated for at least 12 h before each experiment. Cells were transferred into the chamber, washed with PBS, and incubated with fresh media for up to 24 h in a humidified internal incubator. At the end of hypoxia, cell harvesting and lysis were performed within the chamber. In agreement with a previous report (33Chavez J.C. Baranova O. Lin J. Pichiule P. J. Neurosci. 2006; 26: 9471-9481Crossref PubMed Scopus (192) Google Scholar), this degree of hypoxia did not produce cell death (data not shown). For oxygen-glucose deprivation, the glovebox system was set up at 37 °C with an atmosphere of 5% CO2, 5% H2, 90% N2 (anaerobic). Neurons were transferred into the chamber, washed with PBS, and incubated with a pre-equilibrated glucose-free balance salt solution for up to 60 min. At the end of the procedure, cells were removed from the chamber, fresh Neurobasal media was added (reperfusion), and cultures were returned to a regular incubator. At different periods of reperfusion, neurons were harvested for immunoblot analysis, and cell death was determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay following the manufacturer's protocol (CellTiter 96® Assay, Promega, Madison, WI). For experimental controls, cultures were subjected to the same procedures but maintained at normoxia with glucose-containing media in a standard cell culture incubator.Adenoviral Vector Construction and Transduction—A nonreplicative adenovirus in which the Cre recombinase gene is under the regulation of the cytomegalovirus promoter was obtained from Vector Biolabs. Reporter adenovirus encoding green fluorescence protein (AdGFP) was used as control. For adenoviral transduction, cortical neurons derived from homozygous Hif-1αF/F mice were prepared as described above. At day 6 in vitro, cells were infected with AdCre or AdGFP at a multiplicity of infection of 100. Significant deletion of floxed HIF-1α alleles by AdCre infection was accomplished at 7 days post-infection as determined by Western blot. Adenoviral infection with either AdCre or AdGFP did not affect neuronal viability (data not shown).Preparation of Tissue and Whole Cell Lysates—Right and left hemispheres were dissected from ischemic brains and frozen in liquid nitrogen. Samples were homogenized with a Polytron homogenizer using ice-cold lysis RIPA buffer (1× PBS, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with protease inhibitors (Complete, Roche). Homogenates were centrifuged at 10,000 × g for 10 min (4 °C), and supernatants were collected for immunoblots. For the preparation of whole cell lysates, cells were harvested, washed with PBS, and centrifuged (2000 × g for 10 min). The resulting cell pellet was subsequently processed as described above. In all cases, protein concentrations were determined by Bradford protein assay with bovine serum albumin as standard (Bio-Rad).Western Blot Analysis—Samples were electrophoresed on SDS-PAGE under reducing conditions and transferred to nitrocellulose membranes (Bio-Rad) by standard procedures. Membranes were blocked with 10% nonfat dry milk and incubated with the following primary antibodies: rabbit anti-RAGE (Santa Cruz), anti-β-actin (Santa Cruz), anti-HIF-1α (R&D), and anti-HIF-1β (Novus Biologicals Littleton, CO). After washing, membranes were incubated with the appropriate horseradish peroxidase-conjugated secondary antibodies. Antigen-antibody complexes were visualized by enhanced chemiluminescence detection (ECL, Amersham Biosciences). Results were visualized and quantified with Kodak Image Station 4000. Membranes were stripped and reprobed as needed.Real Time PCR Analysis—Total RNA from cell cultures or brain samples was extracted using RNgents® Total RNA Isolation System (Promega). Complementary DNA was synthesized from 2.5 μg of total RNA using the SuperScript III system with oligo(dT) (18Ma L. Carter R.J. Morton A.J. Nicholson L.F. Brain Res. 2003; 966: 167-174Crossref PubMed Scopus (47) Google Scholar) primer (Invitrogen, CA). Real time PCR analysis was performed using 0.5 μl of the final cDNA synthesis mixture and mouse specific TaqMan-based gene expression assays (Applied Biosystems). The following assays were employed: Advanced glycation end products (Ager) (Mm00545815_m1), vascular endothelial growth factor (Vegf) (Mm00437304_m1), erythropoietin (Epo) (Mm00433126_ m1), and β-actin (Mn00607939_s1). The PCR was carried out in an ABI 7500 real time PCR thermocycler (Applied Biosystems, CA). All reactions were performed in duplicate and independently repeated at least three times. Results were normalized to β-actin, and expressed as -fold increase relative to control.DNA Electrophoretic Mobility Shift Assay (EMSA)—Crude nuclear extracts were prepared as described previously (33Chavez J.C. Baranova O. Lin J. Pichiule P. J. Neurosci. 2006; 26: 9471-9481Crossref PubMed Scopus (192) Google Scholar) and used for EMSA to detect HIF-1 binding activity. All probes were commercially generated (Invitrogen), annealed, and radiolabeled with [γ-32P]ATP using T4 polynucleotide kinase. After incubation of probes with nuclear extracts (5 μg of proteins), DNA-protein complexes were resolved in 5% polyacrylamide gels, and the signal was visualized using a phosphorimager (FujiFilm). Supershift experiments were performed by preincubating nuclear extract with 1 μg of monoclonal HIF-1α antibody on ice for 30 min prior to the addition of labeled probe. The sequences of the sense strands of the oligonucleotides were as follows: 5′-gcctggacacgtgggtttcttagcct-3′ (RAGE-Wt, –1071/–1052, contains a putative HIF-1 binding site), 5′-gcctggacaaaagggtttcttagcct-3′ (RAGE-Mut), 5′-gccctacgtgctgtctca-3′ (Epo-Wt), and 5′-gccctaaaagctgtctca-3′ (Epo-Mut).Generation of Promoter Constructs, Transient Transfection, and Reporter Gene Assays—A fragment containing the 5′-flanking region (∼2000 bp) of the mouse Rage gene was generated from mouse genomic DNA by PCR using the following primers: forward, 5′-attgctagcgggaggtcagatatacagtc-3′ and reverse, 5′-attaagcttccatctcccatctcgttc-3′. This product was cloned into the NheI and HindIII sites of the pGL3-basic vector (Promega), and the generated plasmid was designated pRAGE-luc1. Three additional RAGE promoter constructs (pRAGE-luc2, pRAGE-luc3, and pRAGE-luc4) were generated using the same downstream primer as for pRAGE-luc1 and the following NheI site-containing upstream primers: F2 (attgctagcccagagatgccaaaaatgg), F3 (attgctagcttgagaagtaagagccaaa), and F4 (attgctagctgaactcagtgattttgaa). In the pRAGE-mutHRE construct, the putative HRE of pRAGE-luc1 was replaced from 5′-ACGTG-3′ to 5′-AAAAG-3′ using the QuikChange site-directed mutagenesis kit (Stratagene). All constructs were verified by DNA sequencing. 3T3 NIH cells at about 90% confluence in 24-well plates were transiently transfected with reporter plasmid (0.5 μg) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's directions. To correct for variable transfection efficiency, cells were cotransfected with the pRL-SV40 vector (0.05 μg) encoding the Renilla luciferase gene. Transfected cells were allowed to recover for 24 h in fresh medium, and then treated with desferrioxamine (DFO) (100 μm), dimethyloxalglycine (DMOG) (300 μm), or subjected to 0.5% O2. Cells were lysed and luciferase activity was determined with a multiwell luminescence reader (Molecular Devices), by using the Dual-Luciferase Reporter Assay System (Promega).Chromatin Immunoprecipitation—Chromatin" @default.
• W2054631468 created "2016-06-24" @default.
• W2054631468 creator A5007603996 @default.
• W2054631468 creator A5033111532 @default.
• W2054631468 creator A5050316069 @default.
• W2054631468 creator A5086590995 @default.
• W2054631468 date "2007-12-01" @default.
• W2054631468 modified "2023-10-17" @default.
• W2054631468 title "Hypoxia-inducible Factor-1 Mediates Neuronal Expression of the Receptor for Advanced Glycation End Products following Hypoxia/Ischemia" @default.
• W2054631468 cites W1503258737 @default.
• W2054631468 cites W1830795510 @default.
• W2054631468 cites W1968200687 @default.
• W2054631468 cites W1972816014 @default.
• W2054631468 cites W1979668935 @default.
• W2054631468 cites W1984830754 @default.
• W2054631468 cites W1993942559 @default.
• W2054631468 cites W1994406619 @default.
• W2054631468 cites W2003739799 @default.
• W2054631468 cites W2003813921 @default.
• W2054631468 cites W2004437604 @default.
• W2054631468 cites W2005640704 @default.
• W2054631468 cites W2008125614 @default.
• W2054631468 cites W2008721781 @default.
• W2054631468 cites W2009917224 @default.
• W2054631468 cites W2011076742 @default.
• W2054631468 cites W2011810742 @default.
• W2054631468 cites W2011988431 @default.
• W2054631468 cites W2017217969 @default.
• W2054631468 cites W2019538649 @default.
• W2054631468 cites W2026885016 @default.
• W2054631468 cites W2027052432 @default.
• W2054631468 cites W2031060205 @default.
• W2054631468 cites W2039861539 @default.
• W2054631468 cites W2049167261 @default.
• W2054631468 cites W2059693555 @default.
• W2054631468 cites W2061163173 @default.
• W2054631468 cites W2071675524 @default.
• W2054631468 cites W2077708785 @default.
• W2054631468 cites W2079407096 @default.
• W2054631468 cites W2092272732 @default.
• W2054631468 cites W2096678432 @default.
• W2054631468 cites W2112384663 @default.
• W2054631468 cites W2112841292 @default.
• W2054631468 cites W2114032717 @default.
• W2054631468 cites W2115293825 @default.
• W2054631468 cites W2117783767 @default.
• W2054631468 cites W2129868478 @default.
• W2054631468 cites W2143343444 @default.
• W2054631468 cites W2148088341 @default.
• W2054631468 cites W2148329662 @default.
• W2054631468 cites W2148750797 @default.
• W2054631468 cites W2157441872 @default.
• W2054631468 cites W2157935084 @default.
• W2054631468 cites W2162666481 @default.
• W2054631468 cites W2165021695 @default.
• W2054631468 cites W2169533924 @default.
• W2054631468 cites W2179556324 @default.
• W2054631468 cites W4235155311 @default.
• W2054631468 cites W4245060634 @default.
• W2054631468 doi "https://doi.org/10.1074/jbc.m706407200" @default.
• W2054631468 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17942394" @default.
• W2054631468 hasPublicationYear "2007" @default.
• W2054631468 type Work @default.
• W2054631468 sameAs 2054631468 @default.
• W2054631468 citedByCount "91" @default.
• W2054631468 countsByYear W20546314682012 @default.
• W2054631468 countsByYear W20546314682013 @default.
• W2054631468 countsByYear W20546314682014 @default.
• W2054631468 countsByYear W20546314682015 @default.
• W2054631468 countsByYear W20546314682016 @default.
• W2054631468 countsByYear W20546314682017 @default.
• W2054631468 countsByYear W20546314682018 @default.
• W2054631468 countsByYear W20546314682019 @default.
• W2054631468 countsByYear W20546314682020 @default.
• W2054631468 countsByYear W20546314682021 @default.
• W2054631468 countsByYear W20546314682022 @default.
• W2054631468 countsByYear W20546314682023 @default.
• W2054631468 crossrefType "journal-article" @default.
• W2054631468 hasAuthorship W2054631468A5007603996 @default.
• W2054631468 hasAuthorship W2054631468A5033111532 @default.
• W2054631468 hasAuthorship W2054631468A5050316069 @default.
• W2054631468 hasAuthorship W2054631468A5086590995 @default.
• W2054631468 hasBestOaLocation W20546314681 @default.
• W2054631468 hasConcept C126322002 @default.
• W2054631468 hasConcept C134018914 @default.
• W2054631468 hasConcept C147990577 @default.
• W2054631468 hasConcept C170493617 @default.
• W2054631468 hasConcept C178790620 @default.
• W2054631468 hasConcept C185592680 @default.
• W2054631468 hasConcept C540031477 @default.
• W2054631468 hasConcept C541997718 @default.
• W2054631468 hasConcept C55493867 @default.
• W2054631468 hasConcept C71924100 @default.
• W2054631468 hasConcept C7836513 @default.
• W2054631468 hasConcept C86803240 @default.
• W2054631468 hasConcept C95444343 @default.
• W2054631468 hasConceptScore W2054631468C126322002 @default.
• W2054631468 hasConceptScore W2054631468C134018914 @default.

• next