FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2054757478> ?p ?o ?g. }

• W2054757478 endingPage "7118" @default.
• W2054757478 startingPage "7108" @default.
• W2054757478 abstract "RNA interference can be considered as an antisense mechanism of action that utilizes a double-stranded RNase to promote hydrolysis of the target RNA. We have performed a comparative study of optimized antisense oligonucleotides designed to work by an RNA interference mechanism to oligonucleotides designed to work by an RNase H-dependent mechanism in human cells. The potency, maximal effectiveness, duration of action, and sequence specificity of optimized RNase H-dependent oligonucleotides and small interfering RNA (siRNA) oligonucleotide duplexes were evaluated and found to be comparable. Effects of base mismatches on activity were determined to be position-dependent for both siRNA oligonucleotides and RNase H-dependent oligonucleotides. In addition, we determined that the activity of both siRNA oligonucleotides and RNase H-dependent oligonucleotides is affected by the secondary structure of the target mRNA. To determine whether positions on target RNA identified as being susceptible for RNase H-mediated degradation would be coincident with siRNA target sites, we evaluated the effectiveness of siRNAs designed to bind the same position on the target mRNA as RNase H-dependent oligonucleotides. Examination of 80 siRNA oligonucleotide duplexes designed to bind to RNA from four distinct human genes revealed that, in general, activity correlated with the activity to RNase H-dependent oligonucleotides designed to the same site, although some exceptions were noted. The one major difference between the two strategies is that RNase H-dependent oligonucleotides were determined to be active when directed against targets in the pre-mRNA, whereas siRNAs were not. These results demonstrate that siRNA oligonucleotide- and RNase H-dependent antisense strategies are both valid strategies for evaluating function of genes in cell-based assays. RNA interference can be considered as an antisense mechanism of action that utilizes a double-stranded RNase to promote hydrolysis of the target RNA. We have performed a comparative study of optimized antisense oligonucleotides designed to work by an RNA interference mechanism to oligonucleotides designed to work by an RNase H-dependent mechanism in human cells. The potency, maximal effectiveness, duration of action, and sequence specificity of optimized RNase H-dependent oligonucleotides and small interfering RNA (siRNA) oligonucleotide duplexes were evaluated and found to be comparable. Effects of base mismatches on activity were determined to be position-dependent for both siRNA oligonucleotides and RNase H-dependent oligonucleotides. In addition, we determined that the activity of both siRNA oligonucleotides and RNase H-dependent oligonucleotides is affected by the secondary structure of the target mRNA. To determine whether positions on target RNA identified as being susceptible for RNase H-mediated degradation would be coincident with siRNA target sites, we evaluated the effectiveness of siRNAs designed to bind the same position on the target mRNA as RNase H-dependent oligonucleotides. Examination of 80 siRNA oligonucleotide duplexes designed to bind to RNA from four distinct human genes revealed that, in general, activity correlated with the activity to RNase H-dependent oligonucleotides designed to the same site, although some exceptions were noted. The one major difference between the two strategies is that RNase H-dependent oligonucleotides were determined to be active when directed against targets in the pre-mRNA, whereas siRNAs were not. These results demonstrate that siRNA oligonucleotide- and RNase H-dependent antisense strategies are both valid strategies for evaluating function of genes in cell-based assays. small interfering RNA reverse transcriptase glyceraldehyde-3-phosphate dehydrogenase receiver operating characteristic true positive rate false positive rate nucleotide 2′-O-methoxyethyl intercellular adhesion molecule tumor necrosis factor RNA interference has become a powerful and widely used tool for the analysis of gene function in invertebrates and plants (1Fraser A.G. Kamath R.S. Zipperlen P. Martinez-Campos M. Sohrmann M. Ahringer J. Nature. 2000; 408: 325-330Crossref PubMed Scopus (1356) Google Scholar, 2Gönczy P. Echeverri G. Oegema K. Coulson A. Jones S.J. Copley R.R. Duperon J. Oegema J. Brehm M. Cassin E. Hannak E. Kirkham M. Pichler S. Flohrs K. Goessen A. Leidel S. Alleaume A.M. Martin C. Ozlu N. Bork P. Hyman A.A. Nature. 2000; 408: 331-336Crossref PubMed Scopus (730) Google Scholar). Introduction of long double-stranded RNA into the cells of these organisms leads to the sequence-specific degradation of homologous gene transcripts. The long double-stranded RNA molecules are metabolized to small 21–23-nucleotide interfering RNAs (siRNAs)1 by the action of an endogenous ribonuclease, Dicer (3Grishok A. Tabara H. Mello C.C. Science. 2000; 287: 2494-2497Crossref PubMed Scopus (355) Google Scholar, 4Zamore P.D. Tuschl T. Sharp P.A. Bartel D.P. Cell. 2000; 101: 25-33Abstract Full Text Full Text PDF PubMed Google Scholar). The siRNA molecules bind to a protein complex, termed RNA-induced silencing complex, which contains a helicase activity that unwinds the two strands of RNA molecules, allowing the antisense strand to bind to the targeted RNA molecule (4Zamore P.D. Tuschl T. Sharp P.A. Bartel D.P. Cell. 2000; 101: 25-33Abstract Full Text Full Text PDF PubMed Google Scholar,5Zamore P.D. Science. 2002; 296: 1265-1269Crossref PubMed Scopus (310) Google Scholar) and an endonuclease activity that hydrolyzes the target RNA at the site where the antisense strand is bound. It is unknown whether the antisense RNA molecule is also hydrolyzed or recycles and binds to another RNA molecule. Therefore, RNA interference is an antisense mechanism of action, since ultimately a single-stranded RNA molecule binds to the target RNA molecule by Watson-Crick base pairing rules and recruits a ribonuclease that degrades the target RNA. In mammalian cells, long double-stranded RNA molecules were found to promote a global change in gene expression, obscuring any gene-specific silencing (6Tuschl T. Zamore P.D. Lehmann R. Barkel D.P. Sharp P.A. Genes Dev. 1999; 13: 3191-3197Crossref PubMed Scopus (679) Google Scholar, 7Caplen N.J. Fleenor J. Morgan A.F.A. Gene (Amst.). 2000; 252: 95-105Crossref PubMed Scopus (197) Google Scholar). This reduction in global gene expression is thought to be mediated in part through activation of double-stranded RNA-activated protein kinase which phosphorylates and inactivates the translation factor eukaryotic initiation factor 2α (8Der S.D. Yang Y.L. Weissmann C. Williams B.R.G. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3279-3283Crossref PubMed Scopus (360) Google Scholar). Recently, it has been shown that transfection of synthetic 21-nucleotide siRNA duplexes into mammalian cells does not elicit the RNA-activated protein kinase response, allowing effective inhibition of endogenous genes in a sequence-specific manner (9Elbashir S.M. Harborth J. Lendeckel W. Yalcin A. Weber K. Tuschl T. Nature. 2001; 411: 494-498Crossref PubMed Scopus (8018) Google Scholar, 10Caplen N.J. Parrish S. Imani F. Fire A. Morgan R.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 9742-9747Crossref PubMed Scopus (914) Google Scholar). These siRNAs are too short to trigger the nonspecific double-stranded RNA responses, but they still promote degradation of complementary RNA sequences (9Elbashir S.M. Harborth J. Lendeckel W. Yalcin A. Weber K. Tuschl T. Nature. 2001; 411: 494-498Crossref PubMed Scopus (8018) Google Scholar, 11Novina C.D. Murray M.F. Dykxhoorn D.M. Beresford P.J. Riess J. Lee S.-K. Collman R.G. Lieberman J. Shankar P. Sharp P.A. Nat. Med. 2002; 8: 681-686Crossref PubMed Scopus (731) Google Scholar). Multiple mechanisms exist by which short synthetic oligonucleotides can be used to modulate gene expression in mammalian cells (12Crooke S.T. Biochim. Biophys. Acta. 1999; 1489: 30-42Google Scholar). A commonly exploited antisense mechanism is RNase H-dependent degradation of the targeted RNA. RNase H is a ubiquitously expressed endonuclease that recognizes a DNA-RNA heteroduplex, hydrolyzing the RNA strand (13Crouch R.J. Dirksen M.L. Cold Spring Harbor Monogr. Ser. 1982; 14: 211-254Google Scholar, 14Lima W.F. Wu H. Crooke S.T. Methods Enzymol. 2001; 341: 430-440Crossref PubMed Scopus (39) Google Scholar). Antisense oligonucleotides that contain at least five consecutive deoxynucleotides are substrates for human RNase H (15Monia B.P. Lesnik E.A. Gonzalez C. Lima W.F. McGee D. Guinosso C.J. Kawasaki A.M. Cook P.D. Freier S.M. J. Biol. Chem. 1993; 268: 14514-14522Abstract Full Text PDF PubMed Google Scholar,16Wu H. Lima W.F. Crooke S.T. J. Biol. Chem. 1999; 274: 28270-28278Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar). Thus, the RNase H-dependent antisense mechanism differs from the siRNA mechanism by utilizing RNase H, instead of a double-stranded RNase, as the terminating mechanism. Initial reports in which siRNA was compared with single-stranded antisense approaches to gene knockdown have indicated that the siRNA is more potent and effective than a traditional antisense approach (4Zamore P.D. Tuschl T. Sharp P.A. Bartel D.P. Cell. 2000; 101: 25-33Abstract Full Text Full Text PDF PubMed Google Scholar,10Caplen N.J. Parrish S. Imani F. Fire A. Morgan R.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 9742-9747Crossref PubMed Scopus (914) Google Scholar). However, the antisense molecules used in these experiments were single-stranded unmodified RNA, which is rapidly degraded and does not recruit RNase H to cleave the target. Phosphorothioate oligodeoxynucleotides are first generation antisense agents that have been widely used to modulate gene expression in cell-based assays, in animal models, and in the clinic (18Henry S.P. Monteith D. Levin A.A. Anti-cancer Drug Des. 1997; 12: 395-408PubMed Google Scholar). The phosphorothioate modification dramatically increases the nuclease resistance of the oligonucleotide and still supports RNase H activity (19Eckstein F. Antisense Nucleic Acid Drug Dev. 2000; 10: 117-121Crossref PubMed Scopus (312) Google Scholar). Further improvements to phosphorothioate oligodeoxynucleotides have been made, resulting in second generation oligonucleotides such as 2′-O-methyl or 2′-O-methoxyethyl modifications (15Monia B.P. Lesnik E.A. Gonzalez C. Lima W.F. McGee D. Guinosso C.J. Kawasaki A.M. Cook P.D. Freier S.M. J. Biol. Chem. 1993; 268: 14514-14522Abstract Full Text PDF PubMed Google Scholar, 20Agrawal S. Jiang Z. Zhao Q. Shaw D. Cai Q. Roskey A. Channavajjala L. Saxinger C. Zhang R. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 2620-2625Crossref PubMed Scopus (235) Google Scholar). The 2′-O-methoxyethyl modification is particularly attractive, since it increases the potency of the oligonucleotide, further increases nuclease resistance, decreases toxicity, and increases oral bioavailability (21Henry S. Stecker K. Brooks D. Monteith D. Conklin B. Bennett C.F. J. Pharmacol. Exp. Ther. 2000; 292: 468-479PubMed Google Scholar, 22McKay R.A. Miraglia L.J. Cummins L.L. Owens S.R. Sasmor H. Dean N.M. J. Biol. Chem. 1999; 274: 1715-1722Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar, 23Geary R.S. Khatsenko O. Bunker K. Crooke R. Moore M. Burchkin T. Truong L. Sasmor H. Levin A.A. J. Pharmacol. Exp. Ther. 2001; 296: 898-904PubMed Google Scholar, 24Geary R.S. Watanabe T.A. Truong L. Freier S. Lesnik E.A. Sioufi N.B. Sasmor H. Manoharaon M. Levin A.A. J. Pharmacol. Exp. Ther. 2001; 296: 890-897PubMed Google Scholar). In this report, we compare oligonucleotides that were designed to work by a siRNA mechanism (siRNA oligonucleotides) to optimized first and second generation antisense oligonucleotides that were designed to work by an RNase H-dependent mechanism (RNase H oligonucleotides). Active siRNA oligonucleotides and homologous RNase H-dependent oligonucleotides were evaluated for relative potency, efficacy, duration of action, sequence specificity, and site of action within the cell to determine whether significant advantages could be found for the different antisense strategies in cell-based assays. Our results suggest that in human cell culture assays, double-stranded oligoribonucleotides that work by siRNA mechanism exhibit similar potency, efficacy, specificity, and duration of action as RNase H oligonucleotides. Furthermore, as we have previously found for RNase H oligonucleotides, not all sites on the target RNA are good target sites for siRNA molecules. Like RNase H-dependent oligonucleotides, activity of siRNAs is affected by the secondary structure of the target RNA. Finally, siRNAs and RNase H oligonucleotides appear to work upon the target mRNA at different stages of its processing/metabolism. Synthesis and purification of phosphorothioate-modified oligodeoxynucleotides or chimeric 2′-O-methoxyethyl/deoxyphosphorothioate modified oligonucleotides was performed using an Applied Biosystems 380B automated DNA synthesizer as described previously (22McKay R.A. Miraglia L.J. Cummins L.L. Owens S.R. Sasmor H. Dean N.M. J. Biol. Chem. 1999; 274: 1715-1722Abstract Full Text Full Text PDF PubMed Scopus (210) Google Scholar). Sequences of oligonucleotides and placement of 2′-O-methoxyethyl modifications are detailed in Tables I and II. RNA oligonucleotides were synthesized at Dharmacon Research, Inc. (Boulder, CO). siRNA duplexes were formed by combining 30 μl of each 50 μmRNA oligonucleotide solution and 15 μl of 5× annealing buffer (100 mm potassium acetate, 30 mm HEPES-KOH, pH 7.4, 2 mm magnesium acetate) followed by heating for 1 min at 90 °C and then 1 h at 37 °C. Successful annealing was confirmed by nondenaturing polyacrylamide gel electrophoresis. The melting temperatures (T m) were experimentally determined for a subset of siRNA tested as described previously (15Monia B.P. Lesnik E.A. Gonzalez C. Lima W.F. McGee D. Guinosso C.J. Kawasaki A.M. Cook P.D. Freier S.M. J. Biol. Chem. 1993; 268: 14514-14522Abstract Full Text PDF PubMed Google Scholar). In each case, the measured T m values were greater than 55 °C. The predicted T m values for all siRNA duplexes used in this paper were >50 °C (100 mm salt, 0.1 μm oligonucleotide).Table ISequence of CD54 RNase H-dependent oligonucleotides and siRNAsISIS no.Start positionSequenceRegion1217258AGAGGAGCTCAGCGTCGACT5′-UTR12172633GGCTGAGGTTGCAACTCTGA5′-UTR121727256CCAGGCAGGAGCAACTCCTTCoding121728321TTGAATAGCACATTGGTTGGCoding121729422GCCCACTGGCTGCCAAGAGGCoding121730571TCTCTCCTCACCAGCACCGTCoding121731674AAAGGTCTGGAGCTGGTAGGCoding121732732GCGTGTCCACCTCTAGGACCCoding121733801CCAGTGCCAGGTGGACCTGGCoding121734921CCAGTATTACTGCACACGTCCoding1217351002CCTCTGGCTTCGTCAGAATCCoding1217361121GGTGGCCTTCAGCAGGAGCTCoding1217371221CATACAGGACACGAAGCTCCCoding1217381341CATCCTTTAGACACTTGAGCCoding1217391421GCTCCTGGCCCGACAGAGGTCoding1217401501GCTACCACAGTGATGATGACCoding1217411622TTGTGTGTTCGGTTTCATGGCoding1217421633GGAGGCGTGGCTTGTGTGTTCoding1217431654CCTGTCCCGGGATAGGTTCACoding1217441666CGAGGAAGAGGCCCTGTCCC3′-UTR1217451711TCCACTCTGTTCAGTGTGGC3′-UTR1217461781TCTGACTGAGGACAATGCCC3′-UTR1217471818TAGGTGTGCAGGTACCATGG3′-UTR1217481924CCTCTCATCAGGCTAGACTT3′-UTR1217491971CCAGTTGTATGTCCTCATGG3′-UTR1217502012GGGCCTCAGCATACCCAATA3′-UTR1217512056ATGCTACACATGTCTATGGA3′-UTR1217522100GCCCAAGCTGGCATCCGTCA3′-UTR1217532103AGTGCCCAAGCTGGCATCCG3′-UTR1217542221GCTCCGTGAGGCCAGAGACC3′-UTR1217552291CAGGCACTCTCCTGCAGTGT3′-UTR1217562341GAAAGGCAGGTTGGCCAATG3′-UTR1217572417GGTAATCTCTGAACCTGTGA3′-UTR1217582531GTCCAGACATGACCGCTGAG3′-UTR1217592619CTGGAGCTGCAATAGTGCAA3′-UTR1217602731TACACATACACACACACACA3′-UTR1217612831GCTGAGGTGGGAGGATCACT3′-UTR1217622871GGTGTGGTGTTGTGAGCCTA3′-UTR1217632944CTAACACAAAGGAAGTCTGG3′-UTR1217643104CAGTGCCCAAGCTGGCATCC3′-UTRAll oligonucleotides are full phosphorothioate with 2′-O-methoxyethyl substitutions at positions 1–5 and 16–20 (boldface type). Residues 6–15 are unmodified oligodeoxynucleotides, so they can serve as substrates for RNase H. The corresponding siRNAs use the same start position but are 19 rather than 20 nucleotides in length and have dTdT additions at the 3′-end of each strand. The GenBank™ accession number for CD54 is J03132. Open table in a new tab Table IISequence of human PTEN RNase H-dependent oligonucleotides and siRNAsISIS no.Start positionSequenceRegion2957419CGAGAGGCGGACGGGACC5′-UTR2957557CGGGCGCCTCGGAAGACC5′-UTR29576197TGGCTGCAGCTTCCGAGA5′-UTR29577314CCCGCGGCTGCTCACAGG5′-UTR29578421CAGGAGAAGCCGAGGAAG5′-UTR29579494GGGAGGTGCCGCCGCCGC5′-UTR29581671CCGGGTCCCTGGATGTGC5′-UTR29582757CCTCCGAACGGCTGCCTC5′-UTR29583817TCTCCTCAGCAGCCAGAG5′-UTR29584891CGCTTGGCTCTGGACCGC5′-UTR29585952TCTTCTGCAGGATGGAAA5′-UTR295871106GGATAAATATAGGTCAAGCoding295881169TCAATATTGTTCCTGTATCoding295891262TTAAATTTGGCGGTGTCACoding295901342CAAGATCTTCACAAAAGGCoding295911418ATTACACCAGTTCGTCCCCoding295921504TGTCTCTGGTCCTTACTTCoding295931541ACATAGCGCCTCTGACTGCoding295951694GAATATATCTTCACCTTTCoding295961792GGAAGAACTCTACTTTGACoding295971855TGAAGAATGTATTTACCCCoding295992020GGTTGGCTTTGTCTTTATCoding296002098TGCTAGCCTCTGGATTTGCoding296012180TCTGGATCAGAGTCAGTGCoding296022268TATTTTCATGGTGTTTTA3′-UTR296032347TGTTCCTATAACTGGTAA3′-UTR296042403GTGTCAAAACCCTGTGGA3′-UTR296052523ACTGGAATAAAACGGGAA3′-UTR296062598ACTTCAGTTGGTGACAGA3′-UTR296072703TAGCAAAACCTTTCGGAA3′-UTR296082765AATTATTTCCTTTCTGAG3′-UTR296092806TAAATAGCTGGAGATGGT3′-UTR296102844CAGATTAATAACTGTAGC3′-UTR296112950CCCCAATACAGATTCACT3′-UTR296123037ATTGTTGCTGTGTTTCTT3′-UTR296133088TGTTTCAAGCCCATTCTT3′-UTRAll oligonucleotides are full phosphorothioate with 2′-O-methoxyethyl substitutions at positions 1–4 and 15–18 (boldface type). Residues 5–14 are unmodified 2′-oligodeoxynucleotides, so they can serve as substrates for RNase H. The corresponding siRNAs use the same start position but are 19 rather than 18 nucleotides in length and have dTdT additions at the 3′-end of each strand. The GenBank™ accession number for PTEN is U92436 Open table in a new tab All oligonucleotides are full phosphorothioate with 2′-O-methoxyethyl substitutions at positions 1–5 and 16–20 (boldface type). Residues 6–15 are unmodified oligodeoxynucleotides, so they can serve as substrates for RNase H. The corresponding siRNAs use the same start position but are 19 rather than 20 nucleotides in length and have dTdT additions at the 3′-end of each strand. The GenBank™ accession number for CD54 is J03132. All oligonucleotides are full phosphorothioate with 2′-O-methoxyethyl substitutions at positions 1–4 and 15–18 (boldface type). Residues 5–14 are unmodified 2′-oligodeoxynucleotides, so they can serve as substrates for RNase H. The corresponding siRNAs use the same start position but are 19 rather than 18 nucleotides in length and have dTdT additions at the 3′-end of each strand. The GenBank™ accession number for PTEN is U92436 T24 cells, (American Type Tissue Culture Collection, Manassas, VA) were cultivated in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum in six-well culture dishes at a density of 250,00 cells/well. Oligonucleotides were administered to cells using Lipofectin reagent (Invitrogen) as described previously (25Chiang M.-Y. Chan H. Zounes M.A. Freier S.M. Lima W.F. Bennett C.F. J. Biol. Chem. 1991; 266: 18162-18171Abstract Full Text PDF PubMed Google Scholar, 26Vickers T.A. Wyatt J.R. Freier S.M. Nucleic Acids Res. 2000; 28: 1340-1347Crossref PubMed Scopus (123) Google Scholar). Other transfection reagents were evaluated (e.g. Transit TKO, LipofectAMINE 2000, and Oligofectamine) and found to provide similar levels of siRNA-mediated target reduction in T24 cells (data not shown); however, Lipofectin was determined to be superior to the other transfection reagents for RNase H-dependent oligonucleotide administration. In addition, LipofectAMINE was found to be more toxic to the cells than Lipofectin, and Transit TKO failed to provide consistent results for delivery of siRNA molecules. Optimal Lipofectin/oligonucleotide ratios were empirically determined for both siRNAs and RNase H-dependent oligonucleotides. For RNase H antisense oligonucleotides, cells were incubated with a mixture of 3 μg/ml Lipofectin per 100 nm oligonucleotide in OptiMEM medium (Invitrogen), whereas siRNA duplexes were incubated with a mixture of 6 μg/ml Lipofectin per 100 nm siRNA duplex. Since concentrations reported in the paper represent concentration of the siRNA duplex, the same weight/Lipofectin ratio was maintained for siRNA duplexes and antisense oligonucleotides. After 4 h, the transfection mixture was aspirated from the cells and replaced with fresh Dulbecco's modified Eagle's medium plus 10% fetal calf serum and incubated at 37 °C, 5% CO2 until harvest. To induce CD54 mRNA expression, oligonucleotide-treated cells were incubated overnight and then treated with 5 ng/ml TNF-α (R&D Systems, Minneapolis, MN) for 2–3 h prior to harvest of cells for RNA expression analysis. For analysis of cell surface expression of CD54 protein, cells were induced with 5 ng/ml TNF-α immediately following the transfection and incubated overnight. Total RNA was harvested at the indicated times following the beginning of transfection using an RNeasy Mini preparation kit (Qiagen, Valencia, CA) according to the manufacturer's protocol. Gene expression was analyzed using quantitative RT-PCR essentially as described elsewhere (27Winer J. Kwang C. Jung S. Shackel I. Williams P.M. Anal. Biochem. 1999; 270: 41-49Crossref PubMed Scopus (1206) Google Scholar). Briefly, 200 ng of total RNA was analyzed in a final volume of 50 μl containing 200 nm gene-specific PCR primers, 0.2 mm each dNTP, 75 nm fluorescently labeled oligonucleotide probe, 1× RT-PCR buffer, 5 mmMgCl2, 2 units of Platinum Taq DNA polymerase (Invitrogen), and 8 units of ribonuclease inhibitor. Reverse transcription was performed for 30 min at 48 °C followed by PCR: 40 thermal cycles of 30 s at 94 °C and 1 min at 60 °C using an ABI Prism 7700 Sequence Detector (Applied Biosystems; Foster City, CA). All mRNA expression was normalized to levels of GAPDH mRNA, also determined by quantitative RT-PCR, from the same total RNA samples. The following primer/probe sets were used: c-raf kinase (accession number X03484), forward primer (AGCTTGGAAGACGATCAGCAA), reverse primer (AAACTGCTGAACTATTGTAGGAGAGATG), and probe (AGATGCCGTGTTTGATGGCTCCAGCX); CD54 (accession numberJ03132), forward primer (CATAGAGACCCCGTTGCCTAAA), reverse primer (TGGCTATCTTCTTGCACATTGC), and probe (CTCCTGCCTGGGAACAACCGGAAX); PTEN (accession number U92436), forward primer (AATGGCTAAGTGAAGATGACAATCAT), reverse primer (TGCACATATCATTACACCAGTTCGT), and probe (TTGCAGCAATTCACTGTAAAGCTGGAAAGGX); Bcl-x (accession number Z23115), forward primer (TGCAGGTATTGGTGAGTCGG), reverse primer (TCCAAGGCTCTAGGTGGTCATT), and probe (TCGCAGCTTGGATGGCCACTTACCTX); GAPDH (accession numberX01677), forward primer (GAAGGTGAAGGTCGGAGTC), reverse primer (GAAGATGGTGATGGGATTTC), and probe (CAAGCTTCCCGTTCTCAGCCX); COREST (accession number NM_015156), forward primer (ACAATCCCATTGACATTGAGGTT), reverse primer (TTTGCTCTATTTTTAGCTTGTGTGCT), and probe (AAGGAGGTTCCCCCTACTGAGACAGTTCCTX); Notch homolog 2 (accession number NM_024408), forward primer (TGGCAACTAACGTAGAAACTCAACA), reverse primer (TGCCAAGAGCATGAATACAGAGA), and probe (ACAACTATAGACTTGCTCATTGTTCAGACTGATTGCCX); PAK1 (accession number U51120), forward primer (TGTGATTGAACCACTTCCTGTCA), reverse primer (GGAGTGGTGTTATTTTCAGTAGGTGAA), and probe (TCCAACTCGGGACGTGGCTACAX); CARD-4 (accession number NM_006092), forward primer (GCAGGCGGGACTATCAGGA), reverse primer (AGTTTGCCGACCAGACCTTCT), and probe (TCCACTGCCTCCAT- GATGCAAGCCX). Following oligonucleotide treatment, cells were detached from the plates with Dulbecco's phosphate-buffered saline (without calcium and magnesium) supplemented with 4 mm EDTA. Cells were transferred to microcentrifuge tubes, pelleted at 5000 rpm for 1 min, and washed in 2% bovine serum albumin, 0.2% sodium azide in Dulbecco's phosphate-buffered saline at 4 °C. PE anti-human CD54 antibody (catalog no. 555511; Pharmingen, San Diego, CA) was then added at 1:20 in 0.1 ml of the above buffer. The antibody was incubated with the cells for 30 min at 4 °C in the dark. Cells were washed again as above and resuspended in 0.3 ml of PBS buffer with 0.5% paraformaldehyde. Cells were analyzed on a Becton Dickinson FACScan. Results are expressed as percentage of control expression based upon the mean fluorescence intensity. For luciferase-based reporter gene assays, 10 μg of plasmid pGL3-5132-S0 or pGL3-5132-S20 (26Vickers T.A. Wyatt J.R. Freier S.M. Nucleic Acids Res. 2000; 28: 1340-1347Crossref PubMed Scopus (123) Google Scholar) was introduced into COS-7 cells at 70% confluence in 10-cm dishes using SuperFect Reagent (Qiagen). Following a 2-h treatment, cells were trypsinized and split into 24-well plates. Cells were allowed to adhere for 1 h, and then RNase H or siRNA oligonucleotides were added in the presence of Lipofectin reagent as detailed above. All oligonucleotide treatments were performed in duplicate or triplicate. Following the 4-h oligonucleotide treatment, cells were washed, and fresh Dulbecco's modified Eagle's medium containing 10% fetal calf serum was added. The cells were incubated overnight at 37 °C. The following morning, cells were harvested in 150 μl of passive lysis buffer (Promega, Madison, WI), and 60 μl of lysate was added to each well of a black 96-well plate followed by 50 μl of luciferase assay reagent (Promega). Luminescence was measured using a Packard TopCount microplate scintillation counter. Simple statistical analyses were conducted to examine the association between siRNA and RNase H oligonucleotide screens. Similarity between the two screens for a given gene was measured by using correlation coefficients and average difference. Two different correlation measures were employed: Pearson's product-moment correlation coefficient, which measures a linear relationship between siRNA and RNase H oligonucleotide screens, and Spearman's rank-order correlation coefficient, which measures a linear relationship between the potency of siRNA and RNase H oligonucleotide screens. One-sample one-tailed t tests were conducted for observed correlation coefficients to assess whether they are significantly greater than the null hypothesis of no correlation. Statistical inference on observed average difference was conducted by randomizing sample pairs of siRNA and RNase H oligonucleotide screen. Again, one-tailed tests were used to determine whether the observed distances are significantly smaller than those expected from random chance. The association between siRNA and RNase H oligonucleotide screen was further examined by the receiver operating characteristic (ROC) analysis. First, siRNAs were classified as potent when the percentage inhibition rate was smaller than the median value of 67.4% for the CD54 siRNA screen and 57.1% for the PTEN screen. An arbitrary cut-off was then set for RNase H oligonucleotide screens. RNase H oligonucleotides with percentage inhibition rates smaller than this cut-off value were classified as potent. From the classification of siRNAs and RNase H oligonucleotides, a 2 × 2 contingency table was constructed. Finally, true positive rate (TPR) and false positive rate (FPR) were determined based on this table. For example, TPR is the number of cases where potent RNase H oligonucleotides correspond to potent siRNAs divided by the number of potent siRNAs. Similarly, FPR is the number of cases where potent RNase H oligonucleotides corresponds to nonpotent siRNAs divided by the number of nonpotent siRNAs. For CD54, a cut-off value of 70% gives TPR = 75% and FPR = 45%. For the PTEN gene, a cut-off of 40% gives TPR = 72% and FPR = 44%. By varying these cut-off values, a ROC curve can be drawn on a plane spanned by FPR and TPR. The area under the ROC curve provides a measure of overall accuracy. Since both siRNAs and RNase H-dependent oligonucleotides must hybridize to target RNA and subsequently direct specific RNases to bind and cleave the bound RNA (15Monia B.P. Lesnik E.A. Gonzalez C. Lima W.F. McGee D. Guinosso C.J. Kawasaki A.M. Cook P.D. Freier S.M. J. Biol. Chem. 1993; 268: 14514-14522Abstract Full Text PDF PubMed Google Scholar, 28Elbashir S.M. Martinez J. Patkaniowska A. Lendeckel W. Tuschl T. EMBO J. 2001; 20: 6877-6888Crossref PubMed Scopus (1187) Google Scholar), we examined whether an active RNase H oligonucleotide site would also be an active siRNA site. Initially, siRNAs were designed and synthesized based upon the target sequences of active RNase H oligonucleotides previously identified. ISIS 5132 is a 20-base phosphorothioate oligodeoxynucleotide that targets the 3′-untranslated region of human c-raf kinase mRNA and specifically reduces expression of both mRNA and protein (29Monia B.P. Sasmor H. Johnston J.F. Freier S.M. Lesnik E.A. Muller M. Geiger T. Altmann K.-H. Moser H. Fabbro D. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 15481-15484Crossref PubMed Scopus (125) Google Scholar). An siRNA duplex (si5132) composed of 21-nt sense and 21-nt antisense strands was designed using the first 19 nucleotides of the target site for ISIS 5132 in the paired region and unpaired 2-nt 3′-dTdT overhangs. T24 cells were treated with oligonucleotides at doses ranging from 3 to 300 nm as detailed under “Experimental Procedures.” Total RNA was analyzed for expression of c-raf mRNA by quantitative RT-PCR. The results, shown in Fig.1 A, are normalized to GAPDH mRNA expression. Both ISIS 5132 (solid bars) and the corresponding siRNA to the same target site (open bars) were found to inhibit the expression of the c-raf kinase mRNA, each with an IC50 of ∼50 nm. siRNAs targeted to human CD54 and Bcl-X had no effect on the expression of c-raf (data not shown). Chimeric oligonu" @default.
• W2054757478 created "2016-06-24" @default.
• W2054757478 creator A5009075790 @default.
• W2054757478 creator A5027827928 @default.
• W2054757478 creator A5039227038 @default.
• W2054757478 creator A5046729344 @default.
• W2054757478 creator A5077755519 @default.
• W2054757478 creator A5083296071 @default.
• W2054757478 date "2003-02-01" @default.
• W2054757478 modified "2023-10-14" @default.
• W2054757478 title "Efficient Reduction of Target RNAs by Small Interfering RNA and RNase H-dependent Antisense Agents" @default.
• W2054757478 cites W146486495 @default.
• W2054757478 cites W1564730852 @default.
• W2054757478 cites W1611419331 @default.
• W2054757478 cites W1752221293 @default.
• W2054757478 cites W1824700770 @default.
• W2054757478 cites W1977840396 @default.
• W2054757478 cites W1982944995 @default.
• W2054757478 cites W1983241347 @default.
• W2054757478 cites W1988582067 @default.
• W2054757478 cites W1992024544 @default.
• W2054757478 cites W1995484947 @default.
• W2054757478 cites W1995599027 @default.
• W2054757478 cites W2009866838 @default.
• W2054757478 cites W2012188597 @default.
• W2054757478 cites W2012547585 @default.
• W2054757478 cites W2016372500 @default.
• W2054757478 cites W2019387053 @default.
• W2054757478 cites W2026050954 @default.
• W2054757478 cites W2026762551 @default.
• W2054757478 cites W2028767896 @default.
• W2054757478 cites W2030889696 @default.
• W2054757478 cites W2033481004 @default.
• W2054757478 cites W2036242475 @default.
• W2054757478 cites W2063215375 @default.
• W2054757478 cites W2064808830 @default.
• W2054757478 cites W2067401769 @default.
• W2054757478 cites W2069070280 @default.
• W2054757478 cites W2084851425 @default.
• W2054757478 cites W2095461860 @default.
• W2054757478 cites W2095949497 @default.
• W2054757478 cites W2096018896 @default.
• W2054757478 cites W2097699954 @default.
• W2054757478 cites W2101276385 @default.
• W2054757478 cites W2115678473 @default.
• W2054757478 cites W2116009187 @default.
• W2054757478 cites W2118270653 @default.
• W2054757478 cites W2128212057 @default.
• W2054757478 cites W2128491398 @default.
• W2054757478 cites W2132343975 @default.
• W2054757478 cites W2135368384 @default.
• W2054757478 cites W2136447541 @default.
• W2054757478 cites W2145638174 @default.
• W2054757478 cites W2146576174 @default.
• W2054757478 cites W2148310540 @default.
• W2054757478 cites W2166497605 @default.
• W2054757478 cites W2166903671 @default.
• W2054757478 cites W2332631121 @default.
• W2054757478 doi "https://doi.org/10.1074/jbc.m210326200" @default.
• W2054757478 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12500975" @default.
• W2054757478 hasPublicationYear "2003" @default.
• W2054757478 type Work @default.
• W2054757478 sameAs 2054757478 @default.
• W2054757478 citedByCount "421" @default.
• W2054757478 countsByYear W20547574782012 @default.
• W2054757478 countsByYear W20547574782013 @default.
• W2054757478 countsByYear W20547574782014 @default.
• W2054757478 countsByYear W20547574782015 @default.
• W2054757478 countsByYear W20547574782016 @default.
• W2054757478 countsByYear W20547574782017 @default.
• W2054757478 countsByYear W20547574782018 @default.
• W2054757478 countsByYear W20547574782019 @default.
• W2054757478 countsByYear W20547574782020 @default.
• W2054757478 countsByYear W20547574782021 @default.
• W2054757478 countsByYear W20547574782022 @default.
• W2054757478 countsByYear W20547574782023 @default.
• W2054757478 crossrefType "journal-article" @default.
• W2054757478 hasAuthorship W2054757478A5009075790 @default.
• W2054757478 hasAuthorship W2054757478A5027827928 @default.
• W2054757478 hasAuthorship W2054757478A5039227038 @default.
• W2054757478 hasAuthorship W2054757478A5046729344 @default.
• W2054757478 hasAuthorship W2054757478A5077755519 @default.
• W2054757478 hasAuthorship W2054757478A5083296071 @default.
• W2054757478 hasBestOaLocation W20547574781 @default.
• W2054757478 hasConcept C104317684 @default.
• W2054757478 hasConcept C10879258 @default.
• W2054757478 hasConcept C111335779 @default.
• W2054757478 hasConcept C153911025 @default.
• W2054757478 hasConcept C166703698 @default.
• W2054757478 hasConcept C185592680 @default.
• W2054757478 hasConcept C202416437 @default.
• W2054757478 hasConcept C2191507 @default.
• W2054757478 hasConcept C22615655 @default.
• W2054757478 hasConcept C2524010 @default.
• W2054757478 hasConcept C33923547 @default.
• W2054757478 hasConcept C55493867 @default.
• W2054757478 hasConcept C60723119 @default.
• W2054757478 hasConcept C62203573 @default.

• next