FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2055325256> ?p ?o ?g. }

• W2055325256 endingPage "35663" @default.
• W2055325256 startingPage "35656" @default.
• W2055325256 abstract "Yeast Kex2 and human furin are subtilisin-related proprotein convertases that function in the late secretory pathway and exhibit similar though distinguishable patterns of substrate recognition. Although both enzymes prefer Arg at P1 and basic residues at P2, the two differ in recognition of P4 and P6 residues. To probe P4 and P6 recognition by Kex2p, furin-like substitutions were made in the putative S4 and S6 subsites of Kex2. T252D and Q283E mutations were introduced to increase the preference for Arg at P4 and P6, respectively. Glu255 was replaced with Ile to limit recognition of P4 Arg. The effects of putative S4 and S6 mutations were determined by examining the cleavage by purified mutant enzymes of a series of fluorogenic substrates with systematic changes in P4 and/or P6. Whereas wild Kex2 exhibited little preference type for Arg at P6, the T252D mutant and T252D/Q283E double mutant exhibited clear interactions with P6 Arg. Moreover, the T252D and T252D/Q283E substitutions altered the influence of the P6 residue on P4 recognition. We infer that cross-talk between S4 and S6, not seen in furin, allows wild type and mutant forms of Kex2 to adapt their subsites for altered modes of recognition. This apparent plasticity may allow the subsites to rearrange their local environment to interact with different substrates in a productive manner. E255I-Kex2 exhibited significantly decreased recognition of P4 Arg in a tetrapeptide substrate with Lys at P1, although the general pattern of selectivity for aliphatic residues at P4 remained unchanged. Yeast Kex2 and human furin are subtilisin-related proprotein convertases that function in the late secretory pathway and exhibit similar though distinguishable patterns of substrate recognition. Although both enzymes prefer Arg at P1 and basic residues at P2, the two differ in recognition of P4 and P6 residues. To probe P4 and P6 recognition by Kex2p, furin-like substitutions were made in the putative S4 and S6 subsites of Kex2. T252D and Q283E mutations were introduced to increase the preference for Arg at P4 and P6, respectively. Glu255 was replaced with Ile to limit recognition of P4 Arg. The effects of putative S4 and S6 mutations were determined by examining the cleavage by purified mutant enzymes of a series of fluorogenic substrates with systematic changes in P4 and/or P6. Whereas wild Kex2 exhibited little preference type for Arg at P6, the T252D mutant and T252D/Q283E double mutant exhibited clear interactions with P6 Arg. Moreover, the T252D and T252D/Q283E substitutions altered the influence of the P6 residue on P4 recognition. We infer that cross-talk between S4 and S6, not seen in furin, allows wild type and mutant forms of Kex2 to adapt their subsites for altered modes of recognition. This apparent plasticity may allow the subsites to rearrange their local environment to interact with different substrates in a productive manner. E255I-Kex2 exhibited significantly decreased recognition of P4 Arg in a tetrapeptide substrate with Lys at P1, although the general pattern of selectivity for aliphatic residues at P4 remained unchanged. The subtilisin superfamily includes a subfamily of related processing proteases, the proprotein convertases that function in the late secretory pathway of diverse eukaryotic organisms including Saccharomyces cerevisiae, Caenorhabditis elegans, Drosophila melanogaster, and mammals (1Julius D. Brake A. Blair L. Kunisawa R. Thorner J. Cell. 1984; 37: 1075-1089Abstract Full Text PDF PubMed Scopus (488) Google Scholar, 2Thacker C. Rose A.M. BioEssays. 2000; 22: 545-553Crossref PubMed Scopus (55) Google Scholar, 3Siekhaus D.E. Fuller R.S. J. Neurosci. 1999; 19: 6942-6954Crossref PubMed Google Scholar, 4Bergeron R. Leduc R. Day R. J. Mol. Endocrinol. 2000; 24: 1-22Crossref PubMed Scopus (165) Google Scholar). Unlike the degradative subtilisins, which display a broad substrate specificity for hydrophobic residues (5Gron H. Meldal M. Breddam K. Biochemistry. 1992; 31: 6011-6018Crossref PubMed Scopus (153) Google Scholar), the proprotein convertases are post-translational modifying enzymes that process secretory proteins in a sequence-specific manner. In general, these proteases cleave C-terminal to clusters of basic residues, but their exact sequence specificity differs among the members of this family, even though they are ≥45% identical within their subtilisin-related domains. Similarities and differences in substrate recognition were illustrated by the enzymatic characterization of two members of this family, the S. cerevisiae protease, Kex2, and the human homologue, furin. A detailed understanding of substrate recognition by Kex2 and furin has emerged from extensive analysis of the purified secreted, soluble enzymes using model peptide substrates. Based on these studies, the consensus cleavage site for Kex2 was determined to be (Ali/Arg)-Xaa-(Lys/Arg)-Arg↓ (where Ali indicates an aliphatic amino acid), with the principal determinants being a basic residue at P2 and Arg at P1 (6Schecter I. Berger A. Biochem. Biophys. Res. Commun. 1967; 27: 157-162Crossref PubMed Scopus (4755) Google Scholar, 7Rockwell N.C. Wang G.T. Krafft G.A. Fuller R.S. Biochemistry. 1997; 36: 1912-1917Crossref PubMed Scopus (53) Google Scholar, 8Fuller R.S. Brake A. Thorner J. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 1434-1438Crossref PubMed Scopus (285) Google Scholar, 9Brenner C. Fuller R.S. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 922-926Crossref PubMed Scopus (160) Google Scholar). 1Substrate residues near the cleavage site, N- to C-terminal, are designated Pn... P3, P2, P1 ↓ P1 ′, P2 ′, P3 ′... Pn′, where the arrow represents the scissile bond. The complementary enzyme subsites are designated Sn... S3, S2, S1 ↓ S1′, S2′, S3′... Sn′ (6Schecter I. Berger A. Biochem. Biophys. Res. Commun. 1967; 27: 157-162Crossref PubMed Scopus (4755) Google Scholar).1Substrate residues near the cleavage site, N- to C-terminal, are designated Pn... P3, P2, P1 ↓ P1 ′, P2 ′, P3 ′... Pn′, where the arrow represents the scissile bond. The complementary enzyme subsites are designated Sn... S3, S2, S1 ↓ S1′, S2′, S3′... Sn′ (6Schecter I. Berger A. Biochem. Biophys. Res. Commun. 1967; 27: 157-162Crossref PubMed Scopus (4755) Google Scholar). A conservative substitution of Lys for Arg at P1 reduced kcat/Km of Kex2 1000-fold (10Rockwell N.C. Fuller R.S. Biochemistry. 1998; 37: 3386-3391Crossref PubMed Scopus (58) Google Scholar) and resulted in a change in the rate-limiting step from deacylation to acylation (10Rockwell N.C. Fuller R.S. Biochemistry. 1998; 37: 3386-3391Crossref PubMed Scopus (58) Google Scholar, 11Rockwell N.C. Fuller R.S. J. Biol. Chem. 2001; 276: 38394-38399Abstract Full Text Full Text PDF PubMed Scopus (12) Google Scholar, 12Rockwell N.C. Fuller R.S. Biochemistry. 2001; 40: 3657-3665Crossref PubMed Scopus (21) Google Scholar). Kex2 exhibits a less stringent preference at P4, with a dual specificity for either a basic or an aliphatic residue (10Rockwell N.C. Fuller R.S. Biochemistry. 1998; 37: 3386-3391Crossref PubMed Scopus (58) Google Scholar). Furin also exhibits a strict requirement for Arg at P1, but, unlike Kex2, it has reduced selectivity for P2 and increased dependence on P4 recognition (13Molloy S.S. Bresnahan P.A. Leppla S.H. Klimpel K.R. Thomas G. J. Biol. Chem. 1992; 267: 16396-16402Abstract Full Text PDF PubMed Google Scholar, 14Krysan D.J. Rockwell N.C. Fuller R.S. J. Biol. Chem. 1999; 274: 23229-23234Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar, 15Hatsuzawa K. Nagahama M. Takahashi S. Takada K. Murakami K. Nakayama K. J. Biol. Chem. 1992; 267: 16094-16099Abstract Full Text PDF PubMed Google Scholar). For example, substitution of Ala for Arg at P4 resulted in a 2500-fold decrease in kcat/Km (14Krysan D.J. Rockwell N.C. Fuller R.S. J. Biol. Chem. 1999; 274: 23229-23234Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). Kex2 and furin also differ in P6 recognition. Furin exhibited a 10-fold preference for Arg versus Ala at P6 (14Krysan D.J. Rockwell N.C. Fuller R.S. J. Biol. Chem. 1999; 274: 23229-23234Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). Furthermore, the presence of a basic residue at P6 can partially compensate for the lack of Arg at P4 (14Krysan D.J. Rockwell N.C. Fuller R.S. J. Biol. Chem. 1999; 274: 23229-23234Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar, 16Nakayama K. Biochem. J. 1997; 327: 625-635Crossref PubMed Scopus (702) Google Scholar, 17Lazure C. Gauthier D. Jean F. Boudreault A. Seidah N.G. Bennett H.P. Hendy G.N. J. Biol. Chem. 1998; 273: 8572-8580Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 18Anderson E.D. VanSlyke J.K. Thulin C.D. Jean F. Thomas G. EMBO J. 1997; 16: 1508-1518Crossref PubMed Scopus (199) Google Scholar). An examination of physiological Kex2 substrates does not indicate any obvious P6 selectivity, and in experiments with peptide substrates, Kex2 exhibits only a 2-fold preference for Arg at P6 (14Krysan D.J. Rockwell N.C. Fuller R.S. J. Biol. Chem. 1999; 274: 23229-23234Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). This difference in P6 recognition was also observed in interactions with derivatives of eglin-c that had been engineered to be potent inhibitors of Kex2 and furin (19Komiyama T. Fuller R.S. Biochemistry. 2000; 39: 15156-15165Crossref PubMed Scopus (51) Google Scholar). Kex2 exhibited only a slightly higher (∼3-fold) affinity for Arg (as opposed to Gly) at P6 in an eglin-c variant having Arg at P1 and P4 (19Komiyama T. Fuller R.S. Biochemistry. 2000; 39: 15156-15165Crossref PubMed Scopus (51) Google Scholar). However, this same substitution of Arg for Gly at P6 had a striking qualitative effect on the interaction of the inhibitor with furin, in that it caused the eglin-c variant to be cleaved. This result implies that the mode of P6 recognition also is fundamentally different between Kex2 and furin, suggesting that, unlike Kex2, furin has a well defined S6 subsite. Crystal structures of subtilisin-inhibitor complexes, such as that of subtilisin bound to Streptomyces subtilisin inhibitor, illustrate that the principal residues in subtilisin BPN′ that contact P4 are Tyr104 and Ile107 (20Takeuchi Y. Satow Y. Nakamura K.T. Mitsui Y. J. Mol. Biol. 1991; 221: 309-325PubMed Google Scholar). Based on these structural studies, several groups have mutated the S4 pocket in an attempt to alter the P4 substrate specificity of subtilisin (21Bech L.M. Sorensen S.B. Breddam K. Eur. J. Biochem. 1992; 209: 869-874Crossref PubMed Scopus (25) Google Scholar, 22Bech L.M. Sorensen S.B. Breddam K. Biochemistry. 1993; 32: 2845-2852Crossref PubMed Scopus (43) Google Scholar, 23Rheinnecker M. Backer G. Eder J. Fersht A.R. Biochemistry. 1993; 32: 1199-1203Crossref PubMed Scopus (52) Google Scholar, 24Rheinnecker M. Eder J. Pandey P.S. Fersht A.R. Biochemistry. 1994; 33: 221-225Crossref PubMed Scopus (42) Google Scholar, 25Legendre D. Laraki N. Graslund T. Bjørnvad M.E. Bouchet M. Nygren P. Borchet T.V. Fastrez J. J. Mol. Biol. 2000; 296: 87-102Crossref PubMed Scopus (33) Google Scholar, 26Sorenson S.B. Bech L.M. Meldal M. Breddam K. Biochemistry. 1993; 32: 8894-8899Google Scholar). Wells and co-workers (27Ballinger M.D. Tom J. Wells J.A. Biochemistry. 1995; 34: 13312-13319Crossref PubMed Scopus (73) Google Scholar, 28Ballinger M.D. Tom J. Wells J.A. Biochemistry. 1996; 35: 13579-13585Crossref PubMed Scopus (59) Google Scholar) found that substitutions of Asp for Tyr104 in subtilisin BPN′ increased cleavage of substrates containing a P4 Arg, but the resulting mutant protease did not discriminate between Arg and Phe at this position. In another study, acidic residues in furin predicted to interact with P4 were mutated, and the mutant furin enzymes were co-transfected with a furin substrate, pro-von Willebrand factor. Substitution of Val for Asp233 in furin, at a position equivalent to Tyr104 in subtilisin, resulted in an enzyme that cleaved pro-von Willebrand factor with Ala at P4 better than the wild type (WT) substrate (29Creemers J.W.M. Seizen R.J. Roebroek A.J.M. Ayoubi T.A. Huylebroeck D. Van de Ven W.J.M. J. Biol. Chem. 1993; 268: 21826-21834Abstract Full Text PDF PubMed Google Scholar). In this work, the differences in substrate recognition by the S4 and S6 subsites of Kex2 and furin were explored by mutagenesis. Residues predicted to contribute to the specificity of P4 and P6 binding and that were different in Kex2 and furin were mutated in the yeast enzyme, and the substrate specificity of the mutants was analyzed. Substitutions in Kex2 were chosen prior to the availability of crystallographic data for Kex2 or furin and thus were based on examination of three-dimensional structures of subtilisins and the amino acid sequences and structural models of Kex2 and furin (20Takeuchi Y. Satow Y. Nakamura K.T. Mitsui Y. J. Mol. Biol. 1991; 221: 309-325PubMed Google Scholar, 30McPhalen C.A. James M.N.G. Biochemistry. 1988; 27: 6582-6598Crossref PubMed Scopus (327) Google Scholar, 31McPhalen C.A. Svendsen I. Jonassen L. James M.N.G. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 7242-7246Crossref PubMed Google Scholar, 32Seizen R.J. Creemers J.W.M. Van de Ven J.M. Eur. J. Biochem. 1994; 222: 255-266Crossref PubMed Scopus (86) Google Scholar, 33Seizen R.J. Leunissen J.A.M. Protein Sci. 1997; 6: 501-523Crossref PubMed Scopus (778) Google Scholar). One group of mutations was generated with the goal of making Kex2 specificity more furin-like, by increasing selectivity for basic residues at P4 and for Arg at P6. In addition, the model for the dual specificity of the S4 subsite was tested by making a Kex2 mutant that was predicted to exhibit reduced recognition for basic residues at P4 while retaining selectivity for aliphatic P4 residues. Recently, the x-ray crystal structures were solved of the Kex2 catalytic domain complexed with tripeptidyl and tetrapeptidyl boronic acid inhibitors and of the furin catalytic domain complexed with a tetrapeptidyl chloromethylketone (34Henrich S. Cameron A. Bourenkov G.P. Kiefersauer R. Huber R. Lindberg I. Bode W. Than M.E. Nat. Struct. Biol. 2003; 10: 520-526Crossref PubMed Scopus (293) Google Scholar, 35Holyoak T.K.C. Kettner C.A. Petsko G.A. Fuller R.S. Ringe D. Biochemistry. 2004; 43: 2412-2421Crossref PubMed Scopus (47) Google Scholar, 36Holyoak T.W.M. Fenn T.D. Kettner C.A. Petsko G.A. Fuller R.S. Ringe D. Biochemistry. 2003; 42: 6709-6718Crossref PubMed Scopus (89) Google Scholar). Through the comparison of the P4-S4 interactions in Kex2 and furin, the structures have allowed us to interpret the results of these mutagenesis experiments with greater clarity. The biochemical data presented here will be discussed in light of the crystallographic structures. Expression Strain—The genotype of the S. cerevisiae strain CB017 was MATα kex2::TRP1 pep4::HIS3 prb1::hisG prc1::hisG can1 ade2 leu2 ura3. Materials—DNA restriction enzymes, T4 DNA ligase, and oligonucleotides were from Invitrogen, and Pfu turbo polymerase was from Stratagene. Peptide substrates Boc-LKR↓MCA and Pyr-RTKR↓MCA were from Bachem, and all other peptide substrates were synthesized as described previously (7Rockwell N.C. Wang G.T. Krafft G.A. Fuller R.S. Biochemistry. 1997; 36: 1912-1917Crossref PubMed Scopus (53) Google Scholar, 10Rockwell N.C. Fuller R.S. Biochemistry. 1998; 37: 3386-3391Crossref PubMed Scopus (58) Google Scholar, 14Krysan D.J. Rockwell N.C. Fuller R.S. J. Biol. Chem. 1999; 274: 23229-23234Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). General laboratory reagents were from Sigma and Fisher. Site-directed Mutagenesis—All of the mutations were made by overlap extension (37Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene (Amst.). 1989; 77: 51-59Crossref PubMed Scopus (6825) Google Scholar). The following primers were used to make point mutations: (i) T252D, GGTGATATTACTGACGAAGATGA (sense) and TCATCTTCGTCCGTAATATCACC (antisense); (ii) E255I, CGGAAGATRTRGCTGCTAGCTTGATTTA (sense) and TAAATCAAGCTAGCAGCYAYATCTTCCG (antisense); (iii) Q283E, GGAAGACATTTAGAAGGCCCTAG (sense) and CTAGGCCCTTCTAAATGTCTTCC (antisense); and (iv) V289A, GTGACCTGGCCAAAAAGGC (sense) and GCCTTTTTGGCCAGGTCAC (antisense). The template for all single mutations was pAL7, (38.Bevan, A. (1997) Structural Determinants of Protease Specificity. Ph.D. thesis, Stanford University School of Medicine, Palo Alto, CAGoogle Scholar) a pRS314-based vector encoding the full-length KEX2 gene with an additional XhoI site downstream of the P-domain (39Gluschankof P. Fuller R.S. EMBO J. 1994; 13: 2280-2288Crossref PubMed Scopus (86) Google Scholar), and its expression was regulated by its WT promoter. Q283E-Kex2 served as a PCR template for creation of the T252D/Q283E-Kex2 double mutant. PCR products were subcloned into pAL7as HindIII to BglII fragments, and the incorporation of each mutation was confirmed by DNA sequencing (University of Michigan DNA sequencing core). Expression and Purification of Mutants—The substituted Kex2 DNAs were recombined with a linearized expression vector for the production of secreted, soluble Kex2 mutants. The general method was described in Ref. 40Brenner C. Bevan A. Fuller R.S. Curr. Biol. 1993; 3: 498-506Abstract Full Text PDF PubMed Scopus (28) Google Scholar. Briefly, the expression vector pAL10 was a derivative of the secreted, soluble Kex2 expression plasmid, pG5KEX2Δ613 (9Brenner C. Fuller R.S. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 922-926Crossref PubMed Scopus (160) Google Scholar), in which a XhoI site was inserted in place of internal KEX2 sequences from a point 370 nucleotides downstream from the start codon to a point 1788 nucleotides downstream from the start codon, just 3′ to sequences encoding the P-domain. pAL7 vectors encoding the Kex2 mutants were linearized with BamHI and co-transformed into CBO17 with XhoI-digested pAL10. Transformants containing recombinant plasmids and thus encoding mutant-secreted, soluble Kex2 were selected on synthetic dextrose complete-Ura plates. Individual colonies were grown overnight in synthetic dextrose complete-Ura liquid medium and then inoculated into 1040 expression medium (41Brenner C. Bevan A. Fuller R.S. Methods Enzymol. 1994; 244: 152-167Crossref PubMed Scopus (35) Google Scholar). After growth at 30 °C for 24 h, the medium was checked for activity. Equal amounts of medium and substrate solution (140 μm BocQRR↓MCA, 400 mm BisTris, 2 mm CaCl2) were mixed in wells of a 96-well plate and release of the fluorogenic reporter was determined using a Molecular Devices fmax fluorescence plate reader. The cell cultures secreting active enzyme were reinoculated into fresh medium and incubated for 24 h at 30 °C. The enzymes were purified as described (9Brenner C. Fuller R.S. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 922-926Crossref PubMed Scopus (160) Google Scholar). The purified proteins were active site-titrated as described (7Rockwell N.C. Wang G.T. Krafft G.A. Fuller R.S. Biochemistry. 1997; 36: 1912-1917Crossref PubMed Scopus (53) Google Scholar, 9Brenner C. Fuller R.S. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 922-926Crossref PubMed Scopus (160) Google Scholar). Kinetic Characterization of Wild Type and Mutant Enzymes—Pseudo first order and saturation measurements were carried out at 37 °C in 0.2 m Bis Tris, 1 mm CaCl2, 0.1% Triton X-100 as described (7Rockwell N.C. Wang G.T. Krafft G.A. Fuller R.S. Biochemistry. 1997; 36: 1912-1917Crossref PubMed Scopus (53) Google Scholar, 10Rockwell N.C. Fuller R.S. Biochemistry. 1998; 37: 3386-3391Crossref PubMed Scopus (58) Google Scholar, 14Krysan D.J. Rockwell N.C. Fuller R.S. J. Biol. Chem. 1999; 274: 23229-23234Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). Error Analysis—The error for all experiments is listed as S.D. in the form of the percentage of deviation of the average value for each data point. These values were calculated using Microsoft Excel. Mutation of Kex2 to Alter Recognition of Basic Residues at P4 and P6—To increase recognition of basic side chains at P4 and P6, putative S4 and S6 residues were selected by comparison of Kex2 and furin sequence alignments and model structures as well as on results of previous mutagenesis experiments (24Rheinnecker M. Eder J. Pandey P.S. Fersht A.R. Biochemistry. 1994; 33: 221-225Crossref PubMed Scopus (42) Google Scholar, 28Ballinger M.D. Tom J. Wells J.A. Biochemistry. 1996; 35: 13579-13585Crossref PubMed Scopus (59) Google Scholar, 29Creemers J.W.M. Seizen R.J. Roebroek A.J.M. Ayoubi T.A. Huylebroeck D. Van de Ven W.J.M. J. Biol. Chem. 1993; 268: 21826-21834Abstract Full Text PDF PubMed Google Scholar). Again, these residues were chosen prior to the availability of any crystallographic data. Substitution of Asp for Thr252 in Kex2, a position equivalent to S4 residue Tyr104 in subtilisin BPN′ and Asp233 in furin, was originally introduced to increase recognition of basic versus aliphatic residues at P4 (Figs. 1 and 2). Because substitutions at this position in both subtilisin and furin exhibited significant alterations in their P4 specificities, this residue was also considered a good candidate for tuning the P4 specificity of Kex2 (24Rheinnecker M. Eder J. Pandey P.S. Fersht A.R. Biochemistry. 1994; 33: 221-225Crossref PubMed Scopus (42) Google Scholar, 28Ballinger M.D. Tom J. Wells J.A. Biochemistry. 1996; 35: 13579-13585Crossref PubMed Scopus (59) Google Scholar, 29Creemers J.W.M. Seizen R.J. Roebroek A.J.M. Ayoubi T.A. Huylebroeck D. Van de Ven W.J.M. J. Biol. Chem. 1993; 268: 21826-21834Abstract Full Text PDF PubMed Google Scholar). The S6 subsite was more difficult to model because the degradative subtilisins described to date do not have a distinct binding pocket for P6, but Seizen et al. (32Seizen R.J. Creemers J.W.M. Van de Ven J.M. Eur. J. Biochem. 1994; 222: 255-266Crossref PubMed Scopus (86) Google Scholar) tentatively assigned an insertion loop, with respect to subtilisin, in furin to form the S6 subsite. Only very recently, the crystallographic data for Kex2 clarified the structure of this insertion (see “Discussion”). Within this region, furin has Asp at amino acid 264, equivalent to Gln283 in Kex2 (Figs. 1 and 2). Gln283 was mutated to a Glu to mimic the charge at that position in furin while minimizing the change in geometry in the binding site. Glu at this position was expected to be well tolerated as it is also found in PC1/3 (33Seizen R.J. Leunissen J.A.M. Protein Sci. 1997; 6: 501-523Crossref PubMed Scopus (778) Google Scholar). The T252D/Q283E double mutant was constructed to determine whether this would result in a Kex2 mutant with furin-like specificity at P4 and P6. Finally, to decrease recognition of basic residues at P4 while maintaining interactions with aliphatic side chains, Ile was substituted for Glu255, a potential site of interaction with basic residues equivalent to Ile107 in subtilisin and Glu236 in furin.Fig. 2Crystal structure of Kex2 depicting the location of the substituted residues. The mutated residues in this work, Thr252, Glu255, and Gln283, are highlighted in this depiction of Kex2 crystallized with the Ac-Ala-Lys-Arg-boronic acid inhibitor (Protein Data Bank identification code PDB1OT5) (36Holyoak T.W.M. Fenn T.D. Kettner C.A. Petsko G.A. Fuller R.S. Ringe D. Biochemistry. 2003; 42: 6709-6718Crossref PubMed Scopus (89) Google Scholar). This figure was made using MOL-MOL (48Koradi R.B.M. Wuthrich K. J. Mol. Graph. 1996; 14: 51-55Crossref PubMed Scopus (6487) Google Scholar).View Large Image Figure ViewerDownload (PPT) Effects of the T252D and Q283E Substitutions on Specificity for Basic and Aliphatic Amino Acids at P4 in the Context of Tetrapeptide Substrates—Although the majority of known physiological Kex2 substrates have an aliphatic residue at P4, purified Kex2 can also cleave substrates with Arg at P4. In fact, using the model substrates Ac-βYKR↓MCA 2The abbreviations used are: WT, wild type; Nle or β, norleucine; π, norvaline; χ, cyclohexylalanine; MCA, 7-amino-4-methylcoumarin. and Ac-RYKR↓MCA, Kex2 exhibited a 3-fold preference for the P4 Arg substrate (see Table I) (10Rockwell N.C. Fuller R.S. Biochemistry. 1998; 37: 3386-3391Crossref PubMed Scopus (58) Google Scholar). Further investigation indicated that the positive charge of the guanidinium group of Arg, and not the aliphatic portion, was the critical determinant for the S4 recognition of Arg at P4, suggesting that Kex2 binds aliphatic and basic residues using different binding modes (10Rockwell N.C. Fuller R.S. Biochemistry. 1998; 37: 3386-3391Crossref PubMed Scopus (58) Google Scholar). Such dual specificity at P4 is not observed with furin, which has a clear preference for Arg at this position (14Krysan D.J. Rockwell N.C. Fuller R.S. J. Biol. Chem. 1999; 274: 23229-23234Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). Thus, increasing the net negative charge in the S4 subsite of Kex2 would be expected to disfavor the binding of aliphatic residues and enhance binding of basic ones. Indeed, T252D-Kex2 exhibited kcat/Km values with the model substrates Ac-βYKR↓MCA and Ac-RYKR↓MCA that indicated a 5-fold preference for Arg over Nle at P4 (see Table I). Unexpectedly, the Kex2 mutant with a putative S6 mutation, Q283E-Kex2, also exhibited an increased, 4-fold, preference for Arg over Nle, whereas the double mutant T252D/Q283E-Kex2 displayed similar specificity constants to wild type with these substrates. Thus, the very slightly enhanced recognition of Arg over Nle at P4 in tetrapeptides with Arg P1 was observed with both of the putative S4 and S6 mutant enzymes but not the double mutant.Table Ikcat/Km values for substrate cleavage by wild type and mutant Kex2Substratekcat/Km values for indicated enzymesWild typeT252DQ283ET252D/Q283Em-1 s-1m-1 s-1m-1 s-1m-1 s-1AcAAAYKR ↓ MCA1.6 × 1078.3 × 1061.6 × 1073.7 × 106AcAARYKR ↓ MCA5.4 × 107aThese data were previously published (14).5.3 × 1072.1 × 1081.2 × 108AcRAAYKR ↓ MCA7.0 × 1071.2 × 1083.9 × 1075.5 × 107AcRAKYKR ↓ MCA1.4 × 1081.2 × 1088.0 × 1072.0 × 108AcRARYKR ↓ MCA9.6 × 107aThese data were previously published (14).1.4 × 1083.9 × 1081.9 × 108AcRAπYKR ↓ MCA1.5 × 1075.6 × 1062.5 × 1073.2 × 107AcAYKR ↓ MCA4.3 × 106bThese data were previously published (10).8.0 × 1061.0 × 1073.6 × 106AcRYKR ↓ MCA1.2 × 108aThese data were previously published (14).6.5 × 1071.5 × 1081.1 × 108AcβYKR ↓ MCA4.3 × 107bThese data were previously published (10).1.3 × 1073.8 × 1074.3 × 107AcAYKK ↓ MCA1.2 × 103bThese data were previously published (10).1.2 × 104≤5.0 × 1031.1 × 103AcRYKK ↓ MCA1.2 × 105bThese data were previously published (10).8.3 × 1051.5 × 1052.9 × 105AcβYKK ↓ MCA9.2 × 104bThese data were previously published (10).2.8 × 1053.8 × 1044.8 × 104a These data were previously published (14Krysan D.J. Rockwell N.C. Fuller R.S. J. Biol. Chem. 1999; 274: 23229-23234Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar).b These data were previously published (10Rockwell N.C. Fuller R.S. Biochemistry. 1998; 37: 3386-3391Crossref PubMed Scopus (58) Google Scholar). Open table in a new tab Previously, it was demonstrated that P4 recognition becomes more important when Lys is substituted for Arg at P1 (10Rockwell N.C. Fuller R.S. Biochemistry. 1998; 37: 3386-3391Crossref PubMed Scopus (58) Google Scholar). Substitution of Lys for Arg at this position resulted in a change of the rate-limiting step from hydrolysis of the acyl enzyme intermediate (deacylation) to its formation (acylation) (10Rockwell N.C. Fuller R.S. Biochemistry. 1998; 37: 3386-3391Crossref PubMed Scopus (58) Google Scholar, 12Rockwell N.C. Fuller R.S. Biochemistry. 2001; 40: 3657-3665Crossref PubMed Scopus (21) Google Scholar). Comparison of kcat/Km values for AcβYKK↓MCA and AcRYKK↓MCA showed an increasing preference for P4 Arg versus Nle in the order WT < T252D-Kex2 < Q283E-Kex2 < T252D/Q283E-Kex2 (see Table I). T252D/Q283E-Kex2 exhibited a 6-fold preference for Arg over Nle at P4 in the context of Lys at P1. Although the effects of the T252D and Q283E substitutions were not additive, each mutation contributed toward the increased specificity of the double mutant for P4 Arg versus Nle. Relative to WT-Kex2, T252D-Kex2 exhibited a 7-fold higher kcat/Km for AcRYKK↓MCA and a 3-fold higher kcat/Km for AcβYKK↓MCA (see Table I). Q283E-Kex2 exhibited a 2.5-fold reduction kcat/Km for AcβYKK↓MCA relative to WT-Kex2 (see Table I). These results suggested that both an increased acylation rate with the P4 Arg substrate and a decreased acylation rate with the P4 Nle substrate contribute to the enhanced discrimination of Arg versus Nle by T252D/Q283E-Kex2. Backbone Contacts at P5 and P6 Affect P4 Recognition by WT but Not Mutant Forms of Kex2—Most kinetic analyses of Kex2 specificity have been performed with substrates lacking a P6 residue. To evaluate the contribution of the S6-P6 interaction toward the processing of hexapeptide substrates, the proteolysis of a series of hexapeptide substrates was analyzed using pseudo first order kinetics (Fig. 3). However, in addition to specific interactions, P5 and P6 residues in hexapeptide substrates could conceivably provide nonspecific backbone contacts that could reduce the relative importance of P4 binding. This possibility was tested for WT and mutant enzymes by comparing the kcat/Km ratio for a pair of hexapeptide substrates with Ala at P5 and P6 (AcAARYKR-MCA and AcAAAYKR↓MCA) to the kcat/Km ratio for the analogous tetrapeptide substrates (AcRYKR↓MCA and AcAYKR↓MCA; Fig. 4, Table I). In the case of WT Kex2, the specificity for Arg versus Ala at P4 decreased from 28-fold in the tetrapeptide context to 3.4-fold in the hexapeptide context. Moreover, the" @default.
• W2055325256 created "2016-06-24" @default.
• W2055325256 creator A5046764076 @default.
• W2055325256 creator A5067347941 @default.
• W2055325256 creator A5076058258 @default.
• W2055325256 creator A5087101413 @default.
• W2055325256 date "2004-08-01" @default.
• W2055325256 modified "2023-09-26" @default.
• W2055325256 title "Plasticity of Extended Subsites Facilitates Divergent Substrate Recognition by Kex2 and Furin" @default.
• W2055325256 cites W1182370503 @default.
• W2055325256 cites W1480056716 @default.
• W2055325256 cites W1481687671 @default.
• W2055325256 cites W1513543887 @default.
• W2055325256 cites W1549532730 @default.
• W2055325256 cites W1749453950 @default.
• W2055325256 cites W1885047062 @default.
• W2055325256 cites W1949779925 @default.
• W2055325256 cites W1964461863 @default.
• W2055325256 cites W1967414045 @default.
• W2055325256 cites W1967948218 @default.
• W2055325256 cites W1968592972 @default.
• W2055325256 cites W1970367568 @default.
• W2055325256 cites W1973020628 @default.
• W2055325256 cites W1985469117 @default.
• W2055325256 cites W1987057684 @default.
• W2055325256 cites W1990623885 @default.
• W2055325256 cites W2002195659 @default.
• W2055325256 cites W2003039115 @default.
• W2055325256 cites W2006159331 @default.
• W2055325256 cites W2016648335 @default.
• W2055325256 cites W2016913070 @default.
• W2055325256 cites W2019104515 @default.
• W2055325256 cites W2020508498 @default.
• W2055325256 cites W2034795380 @default.
• W2055325256 cites W2048846412 @default.
• W2055325256 cites W2054015058 @default.
• W2055325256 cites W2060913542 @default.
• W2055325256 cites W2064424457 @default.
• W2055325256 cites W2070606233 @default.
• W2055325256 cites W2084030033 @default.
• W2055325256 cites W2084295365 @default.
• W2055325256 cites W2088395142 @default.
• W2055325256 cites W2092750380 @default.
• W2055325256 cites W2093102332 @default.
• W2055325256 cites W2093508320 @default.
• W2055325256 cites W2099023864 @default.
• W2055325256 cites W2107026123 @default.
• W2055325256 cites W2120195060 @default.
• W2055325256 cites W2121093397 @default.
• W2055325256 cites W2128548712 @default.
• W2055325256 cites W2133498598 @default.
• W2055325256 cites W2138006485 @default.
• W2055325256 cites W2138376561 @default.
• W2055325256 cites W2145368473 @default.
• W2055325256 doi "https://doi.org/10.1074/jbc.m405362200" @default.
• W2055325256 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15159396" @default.
• W2055325256 hasPublicationYear "2004" @default.
• W2055325256 type Work @default.
• W2055325256 sameAs 2055325256 @default.
• W2055325256 citedByCount "18" @default.
• W2055325256 countsByYear W20553252562012 @default.
• W2055325256 countsByYear W20553252562013 @default.
• W2055325256 countsByYear W20553252562017 @default.
• W2055325256 countsByYear W20553252562018 @default.
• W2055325256 countsByYear W20553252562020 @default.
• W2055325256 crossrefType "journal-article" @default.
• W2055325256 hasAuthorship W2055325256A5046764076 @default.
• W2055325256 hasAuthorship W2055325256A5067347941 @default.
• W2055325256 hasAuthorship W2055325256A5076058258 @default.
• W2055325256 hasAuthorship W2055325256A5087101413 @default.
• W2055325256 hasBestOaLocation W20553252561 @default.
• W2055325256 hasConcept C181199279 @default.
• W2055325256 hasConcept C185592680 @default.
• W2055325256 hasConcept C18903297 @default.
• W2055325256 hasConcept C2777265534 @default.
• W2055325256 hasConcept C2777289219 @default.
• W2055325256 hasConcept C2994592520 @default.
• W2055325256 hasConcept C55493867 @default.
• W2055325256 hasConcept C86803240 @default.
• W2055325256 hasConcept C95444343 @default.
• W2055325256 hasConceptScore W2055325256C181199279 @default.
• W2055325256 hasConceptScore W2055325256C185592680 @default.
• W2055325256 hasConceptScore W2055325256C18903297 @default.
• W2055325256 hasConceptScore W2055325256C2777265534 @default.
• W2055325256 hasConceptScore W2055325256C2777289219 @default.
• W2055325256 hasConceptScore W2055325256C2994592520 @default.
• W2055325256 hasConceptScore W2055325256C55493867 @default.
• W2055325256 hasConceptScore W2055325256C86803240 @default.
• W2055325256 hasConceptScore W2055325256C95444343 @default.
• W2055325256 hasIssue "34" @default.
• W2055325256 hasLocation W20553252561 @default.
• W2055325256 hasOpenAccess W2055325256 @default.
• W2055325256 hasPrimaryLocation W20553252561 @default.
• W2055325256 hasRelatedWork W1897681821 @default.
• W2055325256 hasRelatedWork W1967581940 @default.
• W2055325256 hasRelatedWork W2046390241 @default.
• W2055325256 hasRelatedWork W2070232478 @default.
• W2055325256 hasRelatedWork W2073407391 @default.

• next