FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2055761503> ?p ?o ?g. }

• W2055761503 endingPage "28155" @default.
• W2055761503 startingPage "28141" @default.
• W2055761503 abstract "The lumican gene (lum), which encodes one of the major keratan sulfate proteoglycans (KSPGs) in the vertebrate cornea and sclera, has been linked to axial myopia in humans. In this study, we chose zebrafish (Danio rerio) as an animal model to elucidate the role of lumican in the development of axial myopia. The zebrafish lumican gene (zlum) spans ∼4.6 kb of the zebrafish genome. Like human (hLUM) and mouse (mlum), zlum consists of three exons, two introns, and a TATA box-less promoter at the 5′-flanking region of the transcription initiation site. Sequence analysis of the cDNA predicts that zLum encodes 344 amino acids. zLum shares 51% amino acid sequence identity with human lumican. Similar to hLUM and mlum, zlum mRNA is expressed in the eye and many other tissues, such as brain, muscle, and liver as well. Transgenic zebrafish harboring an enhanced GFP reporter gene construct downstream of a 1.7-kb zlum 5′-flanking region displayed enhanced GFP expression in the cornea and sclera, as well as throughout the body. Down-regulation of zlum expression by antisense zlum morpholinos manifested ocular enlargement resembling axial myopia due to disruption of the collagen fibril arrangement in the sclera and resulted in scleral thinning. Administration of muscarinic receptor antagonists, e.g. atropine and pirenzepine, effectively subdued the ocular enlargement caused by morpholinos in in vivo zebrafish larvae assays. The observation suggests that zebrafish can be used as an in vivo model for screening compounds in treating myopia. The lumican gene (lum), which encodes one of the major keratan sulfate proteoglycans (KSPGs) in the vertebrate cornea and sclera, has been linked to axial myopia in humans. In this study, we chose zebrafish (Danio rerio) as an animal model to elucidate the role of lumican in the development of axial myopia. The zebrafish lumican gene (zlum) spans ∼4.6 kb of the zebrafish genome. Like human (hLUM) and mouse (mlum), zlum consists of three exons, two introns, and a TATA box-less promoter at the 5′-flanking region of the transcription initiation site. Sequence analysis of the cDNA predicts that zLum encodes 344 amino acids. zLum shares 51% amino acid sequence identity with human lumican. Similar to hLUM and mlum, zlum mRNA is expressed in the eye and many other tissues, such as brain, muscle, and liver as well. Transgenic zebrafish harboring an enhanced GFP reporter gene construct downstream of a 1.7-kb zlum 5′-flanking region displayed enhanced GFP expression in the cornea and sclera, as well as throughout the body. Down-regulation of zlum expression by antisense zlum morpholinos manifested ocular enlargement resembling axial myopia due to disruption of the collagen fibril arrangement in the sclera and resulted in scleral thinning. Administration of muscarinic receptor antagonists, e.g. atropine and pirenzepine, effectively subdued the ocular enlargement caused by morpholinos in in vivo zebrafish larvae assays. The observation suggests that zebrafish can be used as an in vivo model for screening compounds in treating myopia. Myopia is a very common ocular disorder, which is characterized by excessive elongation of the eyeball. In Taiwan, the prevalence of myopia is about 84% of schoolchildren aged 16–18, and the prevalence of high myopia (less than −6.0 D) at 18 years of age is 24% in girls and 18% in boys (1Lin L.L. Shih Y.F. Hsiao C.K. Chen C.J. Lee L.A. Hung P.T. J. Formos. Med. Assoc. 2001; 100: 684-691PubMed Google Scholar). In contrast, the prevalence of high myopia is much lower in Western countries, about 1% of the general population (2Kempen J.H. Mitchell P. Lee K.E. Tielsch J.M. Broman A.T. Taylor H.R. Ikram M.K. Congdon N.G. O'Colmain B.J. Arch. Ophthalmol. 2004; 122: 495-505Crossref PubMed Scopus (491) Google Scholar). These studies imply that genetic susceptibility of ethnic differences may account for the high prevalence of myopia in Taiwanese. The sclera contains a collagen-rich extracellular matrix that undergoes significant biochemical and biomechanical remodeling during the development of myopia (3McBrien N.A. Metlapally R. Jobling A.I. Gentle A. Invest. Ophthalmol. Vis. Sci. 2006; 47: 4674-4682Crossref PubMed Scopus (50) Google Scholar). Linkage studies of high myopia have identified potential loci MYP1 (Xq28) and MYP3 (12q21-23); these loci are within and/or near the loci of the human genome containing several genes that encode small leucine-rich proteoglycans (SLRP), 3The abbreviations used are: SLRPsmall leucine-rich proteoglycanMOmorpholinoKSPGkeratan sulfate proteoglycanEGFPenhanced GFPRS-MOrandom sequence MOTEMtransmission electron microscopeRACErapid amplification of cDNA endzzebrafishmmousehhumanCScorneal stromaASanterior scleraPSposterior scleraRPEretinal pigment epitheliumhpfh post-fertilizationdpfdays post-fertilization. i.e. biglycan (Xq27ter), decorin (12q21-22), lumican (12q21.3-22), and DSPG3 (12q21) (4Deere M. Johnson J. Garza S. Harrison W.R. Yoon S.J. Elder F.F. Kucherlapati R. Hook M. Hecht J.T. Genomics. 1996; 38: 399-404Crossref PubMed Scopus (22) Google Scholar, 5Fisher L.W. Heegaard A.M. Vetter U. Vogel W. Just W. Termine J.D. Young M.F. J. Biol. Chem. 1991; 266: 14371-14377Abstract Full Text PDF PubMed Google Scholar, 6Pulkkinen L. Alitalo T. Krusius T. Peltonen L. Cytogenet. Cell Genet. 1992; 60: 107-111Crossref PubMed Scopus (35) Google Scholar, 7Young T.L. Ronan S.M. Alvear A.B. Wildenberg S.C. Oetting W.S. Atwood L.D. Wilkin D.J. King R.A. Am. J. Hum. Genet. 1998; 63: 1419-1424Abstract Full Text Full Text PDF PubMed Scopus (228) Google Scholar, 8Schwartz M. Haim M. Skarsholm D. Clin. Genet. 1990; 38: 281-286Crossref PubMed Scopus (137) Google Scholar, 9Grover J. Chen X.N. Korenberg J.R. Roughley P.J. J. Biol. Chem. 1995; 270: 21942-21949Abstract Full Text Full Text PDF PubMed Scopus (161) Google Scholar). Our previous study showed that certain variations (rs3759223 (C→T)) of single nucleotide polymorphism in the lumican regulatory region may influence the promoter activities of lumican and affect fibrillogenesis in myopic eyes (10Wang I.J. Chiang T.H. Shih Y.F. Hsiao C.K. Lu S.C. Hou Y.C. Lin L.L. Mol. Vis. 2006; 12: 852-857PubMed Google Scholar). Furthermore, Majava et al. (11Majava M. Bishop P.N. Hägg P. Scott P.G. Rice A. Inglehearn C. Hammond C.J. Spector T.D. Ala-Kokko L. Männikkö M. Hum. Mutat. 2007; 28: 336-344Crossref PubMed Scopus (58) Google Scholar) found that a novel single nucleotide polymorphism (c.893–105G→A) of the lumican gene was associated with high myopia. Recently, our prospective case control study also showed that genetic variation in the regulatory domains of the lumican gene (rs3759223 and rs3741834) were associated with high myopia susceptibility among the Han Chinese (12Chen Z.T. Wang I.J. Shih Y.F. Lin L.L. Ophthalmology. 2009; 116: 1920-1927Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). small leucine-rich proteoglycan morpholino keratan sulfate proteoglycan enhanced GFP random sequence MO transmission electron microscope rapid amplification of cDNA end zebrafish mouse human corneal stroma anterior sclera posterior sclera retinal pigment epithelium h post-fertilization days post-fertilization. Lumican, a member of the SLRP family, is one of the major extracellular components in interstitial collagenous matrices of corneal stroma, sclera, aorta, skin, skeletal muscle, lung, kidney, bone, cartilage, and intervertebral discs (13Funderburgh J.L. Funderburgh M.L. Mann M.M. Conrad G.W. J. Biol. Chem. 1991; 266: 24773-24777Abstract Full Text PDF PubMed Google Scholar, 14Funderburgh J.L. Caterson B. Conrad G.W. J. Biol. Chem. 1987; 262: 11634-11640Abstract Full Text PDF PubMed Google Scholar, 15Iozzo R.V. Murdoch A.D. FASEB J. 1996; 10: 598-614Crossref PubMed Scopus (544) Google Scholar, 16Knudson C.B. Knudson W. Semin. Cell Dev. Biol. 2001; 12: 69-78Crossref PubMed Scopus (449) Google Scholar, 17Ying S. Shiraishi A. Kao C.W. Converse R.L. Funderburgh J.L. Swiergiel J. Roth M.R. Conrad G.W. Kao W.W. J. Biol. Chem. 1997; 272: 30306-30313Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar, 18Raouf A. Ganss B. McMahon C. Vary C. Roughley P.J. Seth A. Matrix Biol. 2002; 21: 361-367Crossref PubMed Scopus (78) Google Scholar, 19Iozzo R.V. Danielson K.G. Prog. Nucleic Acid Res. Mol. Biol. 1999; 62: 19-53Crossref PubMed Scopus (26) Google Scholar, 20Chakravarti S. Magnuson T. Lass J.H. Jepsen K.J. LaMantia C. Carroll H. J. Cell. Biol. 1998; 141: 1277-1286Crossref PubMed Scopus (570) Google Scholar). In corneal stroma, lumican is a KSPG, whereas lumican presents as an under- or unglycanated glycoprotein in other tissues (9Grover J. Chen X.N. Korenberg J.R. Roughley P.J. J. Biol. Chem. 1995; 270: 21942-21949Abstract Full Text Full Text PDF PubMed Scopus (161) Google Scholar, 13Funderburgh J.L. Funderburgh M.L. Mann M.M. Conrad G.W. J. Biol. Chem. 1991; 266: 24773-24777Abstract Full Text PDF PubMed Google Scholar, 14Funderburgh J.L. Caterson B. Conrad G.W. J. Biol. Chem. 1987; 262: 11634-11640Abstract Full Text PDF PubMed Google Scholar, 21Funderburgh J.L. Funderburgh M.L. Mann M.M. Conrad G.W. Biochem. Soc. Trans. 1991; 19: 871-876Crossref PubMed Scopus (47) Google Scholar). It has been proposed that the horseshoe-shaped lumican core protein binds collagen molecules to modulate collagen fibril diameter, whereas the N-linked glycosaminoglycan chains regulate fibril spacing and stromal hydration for the formation and maintenance of transparent corneas (22Iozzo R.V. J. Biol. Chem. 1999; 274: 18843-18846Abstract Full Text Full Text PDF PubMed Scopus (567) Google Scholar, 23Conrad G.W. Ernst B. Hart G.W. Sinaý P. Carbohydrates in Chemistry and Biology. Wiley Interscience, New York2000: 717-727Crossref Scopus (2) Google Scholar, 24Kao W.W. Funderburgh J.L. Xia Y. Liu C.Y. Conrad G.W. Exp. Eye Res. 2006; 82: 3-4Crossref PubMed Scopus (69) Google Scholar). The wide distribution of lumican implies that lumican may have multiple functions in tissue morphogenesis and maintenance of tissue homeostasis, besides serving as a regulatory molecule of collagen fibrillogenesis (24Kao W.W. Funderburgh J.L. Xia Y. Liu C.Y. Conrad G.W. Exp. Eye Res. 2006; 82: 3-4Crossref PubMed Scopus (69) Google Scholar). Indeed, lumican plays essential roles in wound healing by modulating epithelial cell migration (25Saika S. Shiraishi A. Liu C.Y. Funderburgh J.L. Kao C.W. Converse R.L. Kao W.W. J. Biol. Chem. 2000; 275: 2607-2612Abstract Full Text Full Text PDF PubMed Scopus (206) Google Scholar) and in epithelium-mesenchyme transition of the injured lens (26Saika S. Miyamoto T. Tanaka S. Tanaka T. Ishida I. Ohnishi Y. Ooshima A. Ishiwata T. Asano G. Chikama T. Shiraishi A. Liu C.Y. Kao C.W. Kao W.W. Invest. Ophthalmol. Vis. Sci. 2003; 44: 2094-2102Crossref PubMed Scopus (120) Google Scholar), in addition to regulating collagen fibrillogenesis (20Chakravarti S. Magnuson T. Lass J.H. Jepsen K.J. LaMantia C. Carroll H. J. Cell. Biol. 1998; 141: 1277-1286Crossref PubMed Scopus (570) Google Scholar, 25Saika S. Shiraishi A. Liu C.Y. Funderburgh J.L. Kao C.W. Converse R.L. Kao W.W. J. Biol. Chem. 2000; 275: 2607-2612Abstract Full Text Full Text PDF PubMed Scopus (206) Google Scholar). Lumican-null (Lum−/−) mice and lumican- and fibromodullin-null (Lum−/−Fmod−/−) mice showed alterations of collagen fibril arrangement in interstitial connective tissues. Lum−/− Fmod−/− mice exhibited elongated axial lengths and thin sclera, which are characteristics of high myopia, and lumican-null mice (Lum−/−) also had a slight elongation of the eyeball (27Austin B.A. Coulon C. Liu C.Y. Kao W.W. Rada J.A. Invest. Ophthalmol. Vis. Sci. 2002; 43: 1695-1701PubMed Google Scholar, 28Chakravarti S. Paul J. Roberts L. Chervoneva I. Oldberg A. Birk D.E. Invest. Ophthalmol. Vis. Sci. 2003; 44: 2422-2432Crossref PubMed Scopus (97) Google Scholar). These findings indicated that these proteoglycans may be directly or indirectly involved in scleral development, resulting in the pathoetiology of high myopia. The zebrafish is an excellent model to study vertebrate genetics and development (29Udvadia A.J. Linney E. Dev. Biol. 2003; 256: 1-17Crossref PubMed Scopus (157) Google Scholar, 30Xu Y.S. Kantorow M. Davis J. Piatigorsky J. J. Biol. Chem. 2000; 275: 24645-24652Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar, 31Soules K.A. Link B.A. BMC Dev. Biol. 2005; 5: 12Crossref PubMed Scopus (114) Google Scholar). As a disease model, transgenic zebrafish provide several advantages, such as shorter duration of embryonic development and optically transparent embryos; its development also provides easy access for observation and treatment schemes during embryogenesis in comparison with transgenic mouse models. In this study, we examined the structure, expression pattern, promoter activity, and function of zlum. Our data indicated that lumican is highly conserved between zebrafish and mammals (e.g. human and mouse) in respect to gene structure, expression patterns, and protein function. In particular, ocular enlargement and scleral thinning with changes in the ultrastructure of the sclera were noted when zLum expression was down-regulated by antisense zlum morpholinos (MO). Furthermore, in vivo zebrafish larvae assays were performed to elucidate the potential application of several muscarinic receptor antagonists to attenuate increased scleral coats caused by zlum knockdown with MO. Our results suggest that zebrafish can be used as an in vivo model for screening compounds of treating myopia. Zebrafish were raised and maintained according to protocols established previously (32Westerfield M. The Zebrafish Book. University of Oregon Press, Eugene, OR1995Google Scholar). Briefly, adult zebrafish and embryos were maintained at 28.5 °C on a 14-h light and 10-h dark cycle. Embryos were sorted at the different stages required for each experiment and staged according to Kimmel et al. (33Kimmel C.B. Ballard W.W. Kimmel S.R. Ullmann B. Schilling T.F. Dev Dyn. 1995; 203: 253-310Crossref PubMed Scopus (8418) Google Scholar). Chorions were removed manually with Dumont Watchmaker's Forceps No. 5. All procedures were approved by the Institutional Animal Care and Use Committee of National Taiwan University and performed in compliance with the Association for Research in Vision and Ophthalmology Statement for Use of Animals in Ophthalmic and Vision Research. To identify the zebrafish expressed sequence tag clone encoding a putative protein sharing high sequence similarity with the human and mouse SLRP family proteins, we applied the Basic Local Alignment Search Tool (BLAST) analysis of the GenBankTM database using the full-length human lumican cDNA sequence. An ∼4.6-kb NotI/MluI zebrafish genomic DNA fragment containing the 5′ portion of the zebrafish lumican gene was amplified by PCR and subcloned into the pBluescript SK vector (Stratagene, La Jolla, CA). The insert was sequenced, using T3, T7, and walk-in primers, by the DNA core of the Department of Molecular Genetics, National Taiwan University. The 5′- and 3′-ends of the zlum mRNA were amplified using the 5′-rapid amplification of cDNA end (5′-RACE) and 3′-RACE systems, respectively (Invitrogen). For the 5′-RACE experiment, 1 μg of total RNA from zebrafish eyes was reverse-transcribed with a lumican-specific primer (5′-AAGTAGAGGTATTTGATTCCGGTC-3′) corresponding to a sequence in exon 2 of the zlum gene. The RNA templates were degraded by treatment with an RNase mix. A poly(dCTP) tail was added to the 3′-end of the cDNAs with terminal deoxynucleotidyltransferase. The cDNA was amplified with a second gene-specific primer (5′-GCACAAGAAGGTGATGAAACG-3′) corresponding to a sequence from the junction between exon 1 and 2 in conjunction with the abridged anchor primer (5′-GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG-3′). The resulting PCR products were diluted 100-fold and used as templates to be reamplified with a third gene-specific primer (5′-CAGACTTAGAAGTCCAGCCAAC-3′) in conjunction with the universal amplification primer (5′-CUACUACUACUAGGCCACGCGTCGACTAGTAC-3′). For 3′-RACE, PCRs were performed using a gene-specific primer (5′-GCCTCAGAGATCATCTTTGAATAG-3′) corresponding to a sequence in exon 3 of the zlum gene. The cycling conditions were as follows: 34 cycles of 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 3 min followed by a 10-min extension at 72 °C at the end of the cycles. Finally, the 5′-RACE and 3′-RACE PCR products were gel-purified, and the sequences were determined with a dideoxy sequencing protocol. The transcription initiation and termination sites of the zlum gene were determined by a sequence comparison between genomic DNA, the 5′-RACE product, and the 3′-RACE product, respectively. The amino acid sequences of the open reading frames (ORFs) were initially aligned using the ClustalW program, as described previously (34Yeh L.K. Liu C.Y. Chien C.L. Converse R.L. Kao W.W. Chen M.S. Hu F.R. Hsieh F.J. Wang I.J. J. Biol. Chem. 2008; 283: 506-517Abstract Full Text Full Text PDF PubMed Scopus (19) Google Scholar). The aligned amino acid sequences used were subsequently analyzed with the Neighbor-Joining distance analysis method to construct a phylogenetic tree by using Geneious Pro software (version 4.7). Bootstrap values were calculated from 100 replicates, and values >50% are indicated at each divergence point. Unless otherwise specified, RT-PCR reagents used in this procedure were purchased from Promega (Madison, WI). RevertAidTM H Minus First Strand cDNA synthesis kit was purchased from Fermentas (St-Leon-Rot, Germany). Zebrafish cDNA was synthesized using 40 μl of 5× reverse transcription buffer, 20 μl of 0.1 m dithiothreitol, 8 μl of 25 mm dNTPs, 10 μl of RNasin (40 units/ml), 10 μl of 50 mm random hexamers (GE Healthcare), 10 μl of avian myeloblastosis virus reverse transcriptase (9.5 units/μl), and 1 μg of heat-denatured corneal poly(A)+ RNAs. Diethylpyrocarbonate-treated water was added to bring the final reaction volume to 200 μl, and the reaction was incubated at room temperature for 10 min, 42 °C for 90 min, 100 °C for 2 min, and 0 °C for 5 min. Twenty microliters of each of the above RT reactions was added to 80 μl of a PCR mixture containing the following: 8 μl of 10× PCR buffer without MgCl2, 8 μl of 25 mm MgCl2, 10 μl of 20 ng/μl primers, 0.5 μl of Taq polymerase (5 units/μl), and 45.5 μl of H2O. The cycling conditions were as follows: 35 cycles of 94 °C for 1 min, 57 °C for 1 min, and 72 °C for 1 min followed by a 15-min extension at 72 °C at the end of these cycles. Primers used were as follows: CCGCTCGAGCGGATGTTTGCTCTGGGATCCATTC (forward 5′-XhoI cut site) and TCCCCGCGGGGACTATTCAAAGATGATCTCTGAGG (reverse 3′-SacII cut site). The PCR product was confirmed by an appropriate restriction enzyme digestion and analyzed by electrophoresis on a 1.5% agarose gel. To develop an anti-zLum antibody, an oligopeptide deduced from zLum cDNA was synthesized (N-terminal peptide, CNERNLKFIPIVPTGIKY). The peptides were conjugated to keyhole limpet hemocyanin for antibody production in rabbits. The antibodies were purified through an immune absorbent column of the above zebrafish lumican oligopeptide conjugated to SulfoLink gel (Pierce) according to the manufacturer's instructions. Fractions containing purified anti-zebrafish lumican antibody were pooled and concentrated, and the protein concentration was measured by spectrophotometry at 280 nm. Embryos were fixed in 4% paraformaldehyde in 1× PBS overnight at 4 °C, rinsed with PBS three times, transferred into 100% methanol, and stored at −20 °C until use. To prevent melanization, embryos raised to time points beyond the 24-h post-fertilization (hpf) stage were treated with 0.003% phenylthiourea. Whole mount RNA in situ hybridization was carried out as described previously (34Yeh L.K. Liu C.Y. Chien C.L. Converse R.L. Kao W.W. Chen M.S. Hu F.R. Hsieh F.J. Wang I.J. J. Biol. Chem. 2008; 283: 506-517Abstract Full Text Full Text PDF PubMed Scopus (19) Google Scholar). Sense and antisense digoxigenin-labeled oligonucleotide probes were obtained from Bio Basic Inc. (Ontario, Canada). The oligonucleotide sequence (5′-3′) was GTTTCCATCCAAGCGCAGGGTCCTCAGTCTAGAGTAGTTGACCGGTGAGCTAAATCTGCA. The hybridization signals were visualized with anti-digoxigenin antibody-alkaline phosphatase conjugates using procedures recommended by Roche Applied Science. The sections were counterstained with 0.5% neutral red and mounted. Images were obtained using an AxioCam digital camera on a dissection microscope (Zeiss, Germany). Adult zebrafish corneal tissues were fixed with 4% paraformaldehyde in PBS and then embedded in paraffin. Paraffinized sections (5 μm) of adult zebrafish corneal tissue were placed on slides and processed for deparaffinization and immunohistochemistry. Before immunostaining, tissue sections were incubated with 0.5 unit/ml keratanase at 37 °C overnight. After blocking with 3% hydrogen peroxide for 30 min, the samples were incubated with either the primary affinity-purified anti-zebrafish lumican antibody (0.1 μg/ml) or monoclonal anti-keratan sulfate antibody, washed in PBS, and then incubated with a biotinylated secondary antibody (goat anti-rabbit IgG). After washing in PBS, sections were incubated with streptavidin-HRP (DAKO, Carpinteria, CA), then washed in PBS, and incubated with the 3′,3-diaminobenzidine chromogen for 5–10 min. Negative control samples were obtained using preimmune rabbit IgG. Total proteins were extracted from adult fish eyes using lysis solution (10 ml containing 1 ml of 200 mm HEPES/KOH buffer (pH 7.5), 200 mm sucrose (0.86 g), 50 mm KCl (0.04 g), 2.5 mm MgCl2 (0.005 g), and 100 μl of 100 mm DTT). To remove keratan sulfate chains, protein aliquots were incubated with 0.1 unit/ml endo-β-galactosidase (Sigma) and 1 unit/ml keratanase (Sigma) at 37 °C overnight. The zebrafish corneal extracts were subjected to 10% SDS-PAGE and then probed with the anti-zebrafish lumican N-terminal peptide antibody (0.1 μg/ml) as described above. The immunocomplex was visualized by incubation with goat anti-rabbit IgG alkaline phosphatase conjugate (1:2500 (Novagen, Madison, WI)) and Western Blue®-stabilized substrate (Promega). Genomic DNA, both 1.7 and 0.48 kb from the 5′-untranslated region of the zlum gene, were amplified with specific PCR primers and inserted into the multiple cloning sites of pBluescript II SK vectors (Stratagene, La Jolla, CA) containing an EGFP sequence. PCR primers are as follows: 5′-ATAAGAATGCGGCCGCTCCATTAATTCGACAGACCAG-3′ and 5′-ATAAGAATGCGGCCGCAGGTAGACAACACGGTTATGT-3′ (forward primer) and 5′-CGACGCGTGGCTGCACAACTTAAATTAAACCT-3′ (reverse primer). The recombinant plasmids were propagated in Escherichia coli DH5α and purified with a Qiagen plasmid purification maxi kit. Purified plasmid DNA was adjusted to 50 ng/μl in distilled water and microinjected into one-cell stage zebrafish embryos under a dissecting microscope. Embryos with GFP expression were observed and imaged under a fluorescence microscope. A morpholino-antisense oligonucleotide (Gene Tools, Philomath, OR) was designed to target the 5′-untranslated and/or -flanking regions, including the translation start codon of the respective genes. The MO sequence was designed as follows: zlum-MO, 5′-GATCCCAGAGCAAACATGGCTGCAC-3′. This oligonucleotide complemented the sequence from −8 through +17 with respect to the translation initiation codon. A search of the database did not identify any sequence similarity of known zebrafish genes to zlum-MO. A random sequence MO (RS-MO) serves as a control for zlum-MO, 5′-CCTCTTACCTCAGTTACAATTTATA-3′. This RS-MO was obtained from Gene Tools as a standard control oligonucleotide with no target specificity. Solutions were prepared and injected at the 1–4-cell stage as described by Nasevicius and Ekker (35Nasevicius A. Ekker S.C. Nat. Genet. 2000; 26: 216-220Crossref PubMed Scopus (2091) Google Scholar). Corneas of zlum-MO-injected, RS-MO-injected, and wild type zebrafish at 7 and 12 days post-fertilization (dpf) stage were fixed in 50 mm phosphate buffer (pH 7.2) containing 2.5% glutaraldehyde and 2% paraformaldehyde for 24 h at room temperature. After re-fixation in 1% osmium tetraoxide for 4 h at room temperature, the samples were washed in phosphate buffer, dehydrated, and embedded in Epon 812 epoxy resin. Semi-thick sections (100 nm) were stained with toluidine blue. Ultrathin 50-nm sections were collected on 75 mesh copper grids and stained with uranyl acetate and lead citrate, and images were photographed with a Hitachi 7100 transmission electron microscope (TEM) (Hitachi, Tokyo, Japan) equipped with an AMT digital camera. Collagen fibril diameters and scleral thickness were measured with Image-Pro Plus version 4.5. Corneal stroma, anterior sclera, and posterior sclera from six zlum-MO and six wild type zebrafish at each 7- and 12-dpf stage were analyzed. Six to 12 areas of collagen fibrils were analyzed for each region in each group, generating 772–1678 measurements for each condition, and 27–84 measurements were generated by analysis of scleral thickness for anterior and posterior sclera in each group at the 12-dpf stage. Collagen fibers and scleral thickness (in micrometers) are represented as the mean ± S.D., and all measurements were analyzed using Student's t tests assuming unequal variances. To apply our zebrafish model for myopia drug screening, different muscarinic receptor antagonists, atropine, pirenzepine (M1), and methoctramine (M2) purchased from Sigma were used according to protocols previously described with some modifications (36Luft W.A. Ming Y. Stell W.K. Invest. Ophthalmol. Vis. Sci. 2003; 44: 1330-1338Crossref PubMed Scopus (78) Google Scholar, 37Williams F.E. Messer W.S. Comp. Biochem. Physiol. C. Toxicol. Pharmacol. 2004; 137: 349-353Crossref PubMed Scopus (22) Google Scholar, 38Berghmans S. Butler P. Goldsmith P. Waldron G. Gardner I. Golder Z. Richards F.M. Kimber G. Roach A. Alderton W. Fleming A. J. Pharmacol. Toxicol. Methods. 2008; 58: 59-68Crossref PubMed Scopus (149) Google Scholar). Briefly, before drug screening test, the maximal sublethal concentration of each drug was determined, and the drug concentration was selected by the survival rate of embryos greater than 60% at 6 dpf stage. Zebrafish larvae were placed in a 96-well plate at 1 fish per well. In this assay, the zlum-MO-injected larvae were exposed to 0.5% atropine, 0.25% pirenzepine, and 0.01% methoctramine starting at 3 dpf for 48 h, respectively, after which the larvae were anesthetized with Tricaine, immobilized in 3% methylcellulose, and observed under dissecting microscopy. The axial length of eyeball, diameter of scleral coat, and the ratio of RPE diameter/scleral coat diameter were measured. Student's t test was used to compare these parameters between control group and treated groups, respectively. The difference of significance was defined as p < 0.05. We identified zlum by performing a BLAST search of the publicly available zebrafish databases with human LUM. The zlum gene is 11 kb upstream of zkera (keratocan) (Fig. 1). We have isolated clones representing the full open reading frames (ORF) of zebrafish lumican. A cDNA clone encoding the lumican ORF was subcloned into the pBluescript SK vector (Stratagene, La Jolla, CA). The ORF of the zlum gene was 1032 bp long and encoded 344 amino acid residues. The proved nucleotide sequence of the zebrafish lumican gene (zlum) gene was submitted to the GenBankTM database under GenBankTM accession number GQ376197. This sequence has been scanned against the database and is significantly related to the sequence NM_001002059.1, which is derived from BC071347.1 and has not yet been subject to final NCBI review (39Strausberg R.L. Feingold E.A. Grouse L.H. Derge J.G. Klausner R.D. Collins F.S. Wagner L. Shenmen C.M. Schuler G.D. Altschul S.F. Zeeberg B. Buetow K.H. Schaefer C.F. Bhat N.K. Hopkins R.F. Jordan H. Moore T. Max S.I. Wang J. Hsieh F. Diatchenko L. Marusina K. Farmer A.A. Rubin G.M. Hong L. Stapleton M. Soares M.B. Bonaldo M.F. Casavant T.L. Scheetz T.E. Brownstein M.J. Usdin T.B. Toshiyuki S. Carninci P. Prange C. Raha S.S. Loquellano N.A. Peters G.J. Abramson R.D. Mullahy S.J. Bosak S.A. McEwan P.J. McKernan K.J. Malek J.A. Gunaratne P.H. Richards S. Worley K.C. Hale S. Garcia A.M. Gay L.J. Hulyk S.W. Villalon D.K. Muzny D.M. Sodergren E.J. Lu X. Gibbs R.A. Fahey J. Helton E. Ketteman M. Madan A. Rodrigues S. Sanchez A. Whiting M. Madan A. Young A.C. Shevchenko Y. Bouffard G.G. Blakesley R.W. Touchman J.W. Green E.D. Dickson M.C. Rodriguez A.C. Grimwood J. Schmutz J. Myers R.M. Butterfield Y.S. Krzywinski M.I. Skalska U. Smailus D.E. Schnerch A. Schein J.E. Jones S.J. Marra M.A. Proc. Natl. Acad. Sci. U.S.A. 2002; 99: 16899-16903Crossref PubMed Scopus (1543) Google Scholar). The entire genomic DNA sequence of zlum is shown in supplemental Fig. 1. The zlum gene spans ∼4.6 kb (4610 bp) and contains three exons and two introns (Fig. 1). Sequence analysis revealed that exon 1 contains 26 untranslated nucleotides, exon 2 contains 24 noncoding and 880 coding nucleotides, and exon 3 contains 152 bases of coding sequence and 1106 bases of 3′-untranslated sequence. The transcription initiation site marked +1 was determined by 5′-RACE, as described under “Experimental Procedures.” The first translation initiation ATG codon is located at the 844th base downstream of the beginning of exon 1. There was no TATA consensus sequence found in the ∼2.58 kb of proximal 5′-flanking region. The full-length zlum cDNA clone (∼1.9 kb) contains a 1032-bp ORF of 344 amino acids of zLum core protein. Like other SLRP core proteins such as bovine lumican (40Funderburgh J.L. Funderburgh M.L. Brown S.J. Vergnes J.P. Hassell J.R. Mann M.M. Conrad G.W. J. Biol. Chem. 1993; 268: 11874-11880Abstract Full Text PDF PubMed Google Scholar), bovine mimeca" @default.
• W2055761503 created "2016-06-24" @default.
• W2055761503 creator A5010579083 @default.
• W2055761503 creator A5016366854 @default.
• W2055761503 creator A5019281695 @default.
• W2055761503 creator A5046520432 @default.
• W2055761503 creator A5053657893 @default.
• W2055761503 creator A5079154462 @default.
• W2055761503 creator A5083539700 @default.
• W2055761503 date "2010-09-01" @default.
• W2055761503 modified "2023-10-11" @default.
• W2055761503 title "Knockdown of Zebrafish Lumican Gene (zlum) Causes Scleral Thinning and Increased Size of Scleral Coats" @default.
• W2055761503 cites W1533083198 @default.
• W2055761503 cites W1543315777 @default.
• W2055761503 cites W1553509509 @default.
• W2055761503 cites W1558524165 @default.
• W2055761503 cites W1564759593 @default.
• W2055761503 cites W1574083809 @default.
• W2055761503 cites W1585661831 @default.
• W2055761503 cites W1967014829 @default.
• W2055761503 cites W1968509293 @default.
• W2055761503 cites W1971855649 @default.
• W2055761503 cites W1977709406 @default.
• W2055761503 cites W1982617925 @default.
• W2055761503 cites W1983470507 @default.
• W2055761503 cites W1984452766 @default.
• W2055761503 cites W1997366771 @default.
• W2055761503 cites W1998756807 @default.
• W2055761503 cites W2002509647 @default.
• W2055761503 cites W2009212790 @default.
• W2055761503 cites W2024083782 @default.
• W2055761503 cites W2031344273 @default.
• W2055761503 cites W2036341761 @default.
• W2055761503 cites W2041175220 @default.
• W2055761503 cites W2042037755 @default.
• W2055761503 cites W2044698901 @default.
• W2055761503 cites W2054490643 @default.
• W2055761503 cites W2054730944 @default.
• W2055761503 cites W2058200475 @default.
• W2055761503 cites W2062186255 @default.
• W2055761503 cites W2062265758 @default.
• W2055761503 cites W2072631700 @default.
• W2055761503 cites W2087439286 @default.
• W2055761503 cites W2087533466 @default.
• W2055761503 cites W2090046481 @default.
• W2055761503 cites W2093498304 @default.
• W2055761503 cites W2104390119 @default.
• W2055761503 cites W2108222684 @default.
• W2055761503 cites W2119973952 @default.
• W2055761503 cites W2120347833 @default.
• W2055761503 cites W2121937598 @default.
• W2055761503 cites W2125349610 @default.
• W2055761503 cites W2131687641 @default.
• W2055761503 cites W2141265124 @default.
• W2055761503 cites W2146933109 @default.
• W2055761503 cites W2151846229 @default.
• W2055761503 cites W2159058635 @default.
• W2055761503 cites W2317332613 @default.
• W2055761503 cites W2405445698 @default.
• W2055761503 cites W3022355476 @default.
• W2055761503 cites W4313369701 @default.
• W2055761503 doi "https://doi.org/10.1074/jbc.m109.043679" @default.
• W2055761503 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2934679" @default.
• W2055761503 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/20551313" @default.
• W2055761503 hasPublicationYear "2010" @default.
• W2055761503 type Work @default.
• W2055761503 sameAs 2055761503 @default.
• W2055761503 citedByCount "40" @default.
• W2055761503 countsByYear W20557615032012 @default.
• W2055761503 countsByYear W20557615032013 @default.
• W2055761503 countsByYear W20557615032014 @default.
• W2055761503 countsByYear W20557615032015 @default.
• W2055761503 countsByYear W20557615032016 @default.
• W2055761503 countsByYear W20557615032017 @default.
• W2055761503 countsByYear W20557615032018 @default.
• W2055761503 countsByYear W20557615032019 @default.
• W2055761503 countsByYear W20557615032020 @default.
• W2055761503 countsByYear W20557615032021 @default.
• W2055761503 countsByYear W20557615032022 @default.
• W2055761503 countsByYear W20557615032023 @default.
• W2055761503 crossrefType "journal-article" @default.
• W2055761503 hasAuthorship W2055761503A5010579083 @default.
• W2055761503 hasAuthorship W2055761503A5016366854 @default.
• W2055761503 hasAuthorship W2055761503A5019281695 @default.
• W2055761503 hasAuthorship W2055761503A5046520432 @default.
• W2055761503 hasAuthorship W2055761503A5053657893 @default.
• W2055761503 hasAuthorship W2055761503A5079154462 @default.
• W2055761503 hasAuthorship W2055761503A5083539700 @default.
• W2055761503 hasBestOaLocation W20557615031 @default.
• W2055761503 hasConcept C104317684 @default.
• W2055761503 hasConcept C105702510 @default.
• W2055761503 hasConcept C118487528 @default.
• W2055761503 hasConcept C173396325 @default.
• W2055761503 hasConcept C18903297 @default.
• W2055761503 hasConcept C189165786 @default.
• W2055761503 hasConcept C2776878037 @default.
• W2055761503 hasConcept C2779335624 @default.
• W2055761503 hasConcept C2779457992 @default.

• next