FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2055946483> ?p ?o ?g. }

• W2055946483 endingPage "38604" @default.
• W2055946483 startingPage "38597" @default.
• W2055946483 abstract "To study the essentiality of head domain movement of the Rieske iron-sulfur protein (ISP) duringbc1 catalysis, Rhodobacter sphaeroides mutants expressing His-tagged cytochromebc1 complexes with three pairs of cysteines engineered (one cysteine each) on the interface between cytochromeb and ISP, A185C(cytb)/K70C(ISP), I326C(cytb)/G165C(ISP), and T386C(cytb)/K164C(ISP), were generated and characterized. Formation of an intersubunit disulfide bond between cytochrome b and ISP is detected in membrane (intracytoplasmic membrane and air-aged chromatophore), and purified bc1 complex was prepared from the A185C(cytb)/K70C(ISP) mutant cells. Formation of the intersubunit disulfide bond in this cysteine pair mutant complex is concurrent with the loss of its bc1 activity. Reduction of this disulfide bond by β-mercaptoethanol restores activity, indicating that mobility of the head domain of ISP is functionally important in the cytochromebc1 complex. The rate of intramolecular electron transfer, between 2Fe2S and hemec1, in the A185C(cytb)/K70C(ISP) mutant complex is much lower than that in the wild type or in their respective single cysteine mutant complexes, indicating that formation of an intersubunit disulfide bond between cytochrome b and ISP arrests the head domain of ISP in the “fixed state” position, which is too far for electron transfer to heme c1. To study the essentiality of head domain movement of the Rieske iron-sulfur protein (ISP) duringbc1 catalysis, Rhodobacter sphaeroides mutants expressing His-tagged cytochromebc1 complexes with three pairs of cysteines engineered (one cysteine each) on the interface between cytochromeb and ISP, A185C(cytb)/K70C(ISP), I326C(cytb)/G165C(ISP), and T386C(cytb)/K164C(ISP), were generated and characterized. Formation of an intersubunit disulfide bond between cytochrome b and ISP is detected in membrane (intracytoplasmic membrane and air-aged chromatophore), and purified bc1 complex was prepared from the A185C(cytb)/K70C(ISP) mutant cells. Formation of the intersubunit disulfide bond in this cysteine pair mutant complex is concurrent with the loss of its bc1 activity. Reduction of this disulfide bond by β-mercaptoethanol restores activity, indicating that mobility of the head domain of ISP is functionally important in the cytochromebc1 complex. The rate of intramolecular electron transfer, between 2Fe2S and hemec1, in the A185C(cytb)/K70C(ISP) mutant complex is much lower than that in the wild type or in their respective single cysteine mutant complexes, indicating that formation of an intersubunit disulfide bond between cytochrome b and ISP arrests the head domain of ISP in the “fixed state” position, which is too far for electron transfer to heme c1. Rieske iron-sulfur protein β-mercaptoethanol intracytoplasmic membrane 2,3-dimethoxy-5-methyl-6-geranyl-1,4-benzoquinol polyacrylamide gel electrophoresis The cytochrome bc1 complex (also known as ubiquinol-cytochrome c reductase or complex III) is an essential segment of the energy-conserving electron transfer chains of mitochondria and many respiratory and photosynthetic bacteria (1Trumpower B.L. Gennis R.B. Annu. Rev. Biochem. 1994; 63: 675-716Crossref PubMed Scopus (471) Google Scholar). This complex catalyzes electron transfer from ubiquinol to cytochromec and concomitantly translocates protons across the membrane to generate a membrane potential and pH gradient for ATP synthesis. Recently the cytochrome bc1 complexes from bovine (2Xia D., Yu, C.A. Kim H. Xia J.Z. Kachurin A.M. Zhang L., Yu, L. Deisenhofer J. Science. 1997; 277: 60-66Crossref PubMed Scopus (873) Google Scholar, 3Iwata S. Lee J.W. Okada K. Lee J.K. Iwata M. Rasmussen B. Link T.A. Ramaswamy S. Jap B.K. Science. 1998; 281: 64-71Crossref PubMed Scopus (1069) Google Scholar) and chicken (4Zhang Z.L. Huang L-S. Shulmeister V.M. Chi Y-I. Kim K.K. Huang L-W. Crofts A.R. Berry E.A. Kim S-H Nature. 1998; 392: 677-684Crossref PubMed Scopus (939) Google Scholar) heart mitochondria, which contain 11 nonidentical protein subunits, were crystallized, and their structures were solved at 2.9 Å resolution. The structural information obtained not only answered a number of questions concerning the arrangement of the redox centers, transmembrane helices, and inhibitor binding sites but also suggested movement of the head domain of the iron-sulfur protein (ISP)1 duringbc1 catalysis. This suggestion arose from observation of a particularly low electron density area in the intermembrane space portion of the complex, where the extramembrane domains of ISP and cytochrome c1 reside (2Xia D., Yu, C.A. Kim H. Xia J.Z. Kachurin A.M. Zhang L., Yu, L. Deisenhofer J. Science. 1997; 277: 60-66Crossref PubMed Scopus (873) Google Scholar). This movement hypothesis was further supported by the observation of various positions for 2Fe2S in the different crystal forms (3Iwata S. Lee J.W. Okada K. Lee J.K. Iwata M. Rasmussen B. Link T.A. Ramaswamy S. Jap B.K. Science. 1998; 281: 64-71Crossref PubMed Scopus (1069) Google Scholar, 4Zhang Z.L. Huang L-S. Shulmeister V.M. Chi Y-I. Kim K.K. Huang L-W. Crofts A.R. Berry E.A. Kim S-H Nature. 1998; 392: 677-684Crossref PubMed Scopus (939) Google Scholar) and in complexes loaded with different inhibitors (4Zhang Z.L. Huang L-S. Shulmeister V.M. Chi Y-I. Kim K.K. Huang L-W. Crofts A.R. Berry E.A. Kim S-H Nature. 1998; 392: 677-684Crossref PubMed Scopus (939) Google Scholar, 5Kim H. Xia D., Yu, C.A. Kachurin A. Zhang L.Yu, L. Deisenhofer J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8026-8033Crossref PubMed Scopus (259) Google Scholar). In tetragonal I4122 crystals of native oxidized bovine cytochrome bc1 complex, the position of the 2Fe2S cluster is 27 Å from heme bL and 31 Å from heme c1 (the “fixed state” position) (2Xia D., Yu, C.A. Kim H. Xia J.Z. Kachurin A.M. Zhang L., Yu, L. Deisenhofer J. Science. 1997; 277: 60-66Crossref PubMed Scopus (873) Google Scholar, 5Kim H. Xia D., Yu, C.A. Kachurin A. Zhang L.Yu, L. Deisenhofer J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8026-8033Crossref PubMed Scopus (259) Google Scholar). Binding of stigmatellin or 5-n-undecyl-6-hydroxy-4,7-dioxobenzothiazole enhances the electron density of the anomalous scattering peak of 2Fe2S, suggesting that these inhibitors arrest the mobility of ISP in the fixed state position (5Kim H. Xia D., Yu, C.A. Kachurin A. Zhang L.Yu, L. Deisenhofer J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8026-8033Crossref PubMed Scopus (259) Google Scholar). Conversely, binding of (E)-β-methoxyacrylate-stilbene or myxothiazol to the complex abolishes the electron density of the anomalous scattering peak of 2Fe2S, suggesting that these inhibitors increase the mobility of ISP in the crystal and that 2Fe2S has no predominant position (referred to as the “released” or “loose” position) in this inhibited state (5Kim H. Xia D., Yu, C.A. Kachurin A. Zhang L.Yu, L. Deisenhofer J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8026-8033Crossref PubMed Scopus (259) Google Scholar). In orthorhombic crystals (P212121) of the chicken enzyme, binding of stigmatellin shifts 2Fe2S from the so-called “distal or c1 position” to the “proximal or b position” (4Zhang Z.L. Huang L-S. Shulmeister V.M. Chi Y-I. Kim K.K. Huang L-W. Crofts A.R. Berry E.A. Kim S-H Nature. 1998; 392: 677-684Crossref PubMed Scopus (939) Google Scholar). The b position in theP212121 crystal is believed to be the same as the fixed state position observed inI4I22 crystals. In bovineP65 crystals 2Fe2S is located between theb state and c1 state positions (the “intermediate” position) (3Iwata S. Lee J.W. Okada K. Lee J.K. Iwata M. Rasmussen B. Link T.A. Ramaswamy S. Jap B.K. Science. 1998; 281: 64-71Crossref PubMed Scopus (1069) Google Scholar). The observation of more than two positions (intermediate and c1 positions) of 2Fe2S in P65 crystals (3Iwata S. Lee J.W. Okada K. Lee J.K. Iwata M. Rasmussen B. Link T.A. Ramaswamy S. Jap B.K. Science. 1998; 281: 64-71Crossref PubMed Scopus (1069) Google Scholar) supports the idea of one fixed position and other released (loose) positions, suggested by the I4I22 structure. If movement of the head domain of ISP is required forbc1 catalysis, locking the head domain of ISP in a given position should abolish the bc1 complex activity. One way to lock the 2Fe2S cluster of ISP in a fixed position is to form a disulfide bond (disulfide bridge) between a pair of genetically engineered cysteines on the interface between the head domain of ISP and cytochrome b. However, genetic manipulation of bovine heart mitochondria is not practical.Rhodobacter sphaeroides is an ideal system for studying the intersubunit disulfide bond formation by molecular genetics. The four-subunit bacterial complex is functionally analogous to the mitochondrial enzyme; the largest three subunits (cytochromeb, cytochrome c1, and ISP) are homologous to their mitochondrial counterparts, and this system is readily manipulated genetically. In addition, R. sphaeroidesexpressing His6-tagged cytochromebc1 complex has been prepared (6Tian H., Yu, L. Michael W. Yu C.A. J. Biol. Chem. 1998; 273: 27953-27959Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 7Guergova-Kuras M. Salcedo-Hernandez R. Bechmann G. Kuras R. Gennis R.B. Crofts A.R. Protein Expression Purif. 1999; 15: 378-380Crossref Scopus (44) Google Scholar). This greatly speeds up the isolation of the bc1complex from wild type or mutant cells. In fact, the study of the neck region of ISP using this system (6Tian H., Yu, L. Michael W. Yu C.A. J. Biol. Chem. 1998; 273: 27953-27959Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 8Tian H. White S., Yu, L. Yu C.A. J. Biol. Chem. 1999; 274: 7146-7152Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar) provided the first functional evidence for movement of the head domain of ISP during bc1 catalysis. The molecule of ISP can be divided into three domains: head, tail, and neck, with the 2Fe2S cluster located at the tip of the head (9Iwata S. Saynovits M. Link T.A. Michel H. Structure. 1996; 4: 567-579Abstract Full Text Full Text PDF PubMed Scopus (279) Google Scholar, 10Link T.A. Saynovits M. Assmann C. Iwata S. Ohnishi T. Von Jagow G. Eur. J. Biochem. 1996; 237: 71-75Crossref PubMed Scopus (49) Google Scholar). Because the three-dimensional structures of the head and tail domains are rigid and are the same in the fixed and released states, a bending of the neck is required for movement of the head domain. For the neck region to bend, some flexibility is imperative. Mutants with increased neck rigidity, generated by deletion or double- or triple-proline substitution, have greatly reduced electron transfer activity with an increased activation energy (6Tian H., Yu, L. Michael W. Yu C.A. J. Biol. Chem. 1998; 273: 27953-27959Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar). Formation of a disulfide bond between two engineered cysteines, having only one amino acid residue between them, in the neck region near the transmembrane helix, also drastically reduces electron transfer activity (8Tian H. White S., Yu, L. Yu C.A. J. Biol. Chem. 1999; 274: 7146-7152Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar), presumably because of increased neck rigidity. Cleavage of the disulfide bond by reduction or alkylation restores activity to that of the wild type enzyme (8Tian H. White S., Yu, L. Yu C.A. J. Biol. Chem. 1999; 274: 7146-7152Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). These results clearly demonstrate a need for neck flexibility in catalysis. To further establish that movement of the head domain of ISP is essential for the bc1 complex, we generated mutants expressing His6-tagged bc1complex with pairs of cysteine substituted (one cysteine each) at the interface between cytochrome b and the head domain of ISP. We predicted that formation of an intersubunit disulfide bond between the engineered cysteine pair would arrest the mobility of ISP to the fixed state and decrease electron transfer activity. Herein we report procedures for generating three cysteine pair mutants with one each on cytochrome b and ISP in close proximity (interface) to each other. Mutants with single cysteine substitutions at indicated positions were also generated and characterized to confirm that the generated cysteine pair mutants are not at critical positions in thebc1 complex and, hence, are suitable for this study. The photosynthetic growth behavior, cytochromebc1 complex activity, SDS-PAGE patterns, and EPR characteristics of the 2Fe2S cluster in purified complexes from wild type and mutant strains were examined and compared as were the rates of pH induced intramolecular electron transfer between 2Fe2S and heme c1. Cytochrome c (horse heart, type III) was purchased from Sigma.N-Dodecyl-β-d-maltoside andN-octyl-β-d-glucoside were from Anatrace. 2,3-Dimethoxy-5-methyl-6-geranyl-1,4-benzoquinol (Q2H2) was prepared in our laboratory as previously reported (11Yu C.A. Yu L. Biochemistry. 1982; 21: 4096-4101Crossref PubMed Scopus (71) Google Scholar). All other chemicals were of the highest purity commercially available. Mutations were constructed by site-directed mutagenesis using the Altered Sites system from Promega. The oligonucleotides used for mutagenesis were as follows: K70C (ISP), GTCAAGTTCCTCGGCTGCCCGATCTTCATCCGCCGCCGCACCGAGGCCGACATCG; G165C (ISP), CCGTATCCGGAAGTGCCCCGCGCCCGAGAACC; K164C (ISP), ACAGTGCCGGCCGTATCCGGTGCGGCCCCGCGCCCGAGAACC; A185C (cytb), GCTGCTCGGCGGCCCGTGCGTGGACAATGCCA; I326C (cytb), CATCAGCTTCGGCATCTGCGACGCCAAGTTCTTCGGCGTGCTCGCGATGT; and T386C (cytb), GGGTCGGCGCCCAGCAGACCTGCTTCCCCTACGACTGGATCTCG. The single-stranded pSELNB3503 (12Mather M.W., Yu, L. Yu C.A. J. Biol. Chem. 1995; 270: 28668-28675Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar) was used as the template for mutagenesis. A plate mating procedure (12Mather M.W., Yu, L. Yu C.A. J. Biol. Chem. 1995; 270: 28668-28675Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar) was used to mobilize the pRKDfbcFmBmCHQ plasmid in Escherichia coli S17–1 cells into R. sphaeroides BC17 cells. The presence of engineered mutations was confirmed by DNA sequencing before and after photosynthetic or semi-aerobic growth of the cells. Expression plasmid pRKDfbcFmBmCHQ was purified from an aliquot of a photosynthetic or semi-aerobic culture using the Qiagen Plasmid Mini Prep kit. Because R. sphaeroides cells contain four types of endogenous plasmids, the isolated plasmids lack the purity and concentration needed for direct sequencing. Therefore, a 2.5-kilobase pair DNA segment containing the mutation sequence was amplified from the isolated plasmids by the polymerase chain reaction and purified by 1% agarose gel electrophoresis. The 2.5-kilobase pair polymerase chain reaction product was recovered from the gel with an extraction kit from Qiagen. DNA sequencing and oligonucleotide syntheses were performed by the Recombinant DNA/Protein Core Facility at the Oklahoma State University. E. coli cells were grown at 37 °C in LB medium. For photosynthetic growth of the plasmid-bearingR. sphaeroides BC17 cells, an enriched Siström's medium containing 5 mm glutamate and 0.2% casamino acids was used. Photosynthetic growth conditions for R. sphaeroides were essentially as described previously (6Tian H., Yu, L. Michael W. Yu C.A. J. Biol. Chem. 1998; 273: 27953-27959Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar). Cells harboring mutated fbc genes on the pRKDfbcFBCHQ plasmid were grown photosynthetically for one or two serial passages to minimize any pressure for reversion. For semi-aerobic growth of R. sphaeroides, an enriched Siström's medium supplemented with 20 amino acids and extra rich vitamins was used. These semi-aerobic cultures were grown in 500 ml of enriched Siström's medium in 2-liter Bellco flasks with vigorous shaking (220 rpm) for 26 h at 30 °C. The inoculation volumes used for both photosynthetic and semi-aerobic cultures were at least 5% of the total volume. Antibiotics were added to the following concentrations: ampicillin (125 μg/ml), kanamycin sulfate (30 μg/ml), tetracycline (10 μg/ml forE. coli and 1 μg/ml for R. sphaeroides), and trimethoprim (100 μg/ml for E. coli and 30 μg/ml forR. sphaeroides). Chromatophore and intracytoplasmic membrane (ICM) were prepared as described previously (6Tian H., Yu, L. Michael W. Yu C.A. J. Biol. Chem. 1998; 273: 27953-27959Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar) and stored at −80 °C in the presence of 20% glycerol until use. The His6-tagged cytochrome bc1complexes were purified from frozen chromatophores by the method of Tian et al. (6Tian H., Yu, L. Michael W. Yu C.A. J. Biol. Chem. 1998; 273: 27953-27959Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar). Purified cytochromebc1 complexes were stored at −80 °C in the presence of 20% glycerol. To assay ubiquinol-cytochrome creductase activity, chromatophores, ICM, or purified cytochromebc1 complexes were diluted with 50 mm Tris-Cl, pH 8.0, containing 200 mm NaCl to a final concentration of cytochrome b of 5 μm. Five μl of the diluted samples were added to 1 ml of assay mixture containing 100 mm of Na+/K+phosphate buffer, pH 7.4, 0.3 mm of EDTA, 100 μm of cytochrome c, and 25 μm of Q2H2. Activities were determined by measuring the reduction of cytochrome c (the increase of the absorbance at wavelength 550 nm) in a Shimadzu UV 2101 PC spectrophotometer at 23 °C, using a millimolar extinction coefficient of 18.5 for calculation. The nonenzymatic oxidation of Q2H2, determined under the same conditions, in the absence of enzyme, was subtracted during specific activity calculations. The wild type or mutantbc1 complex was diluted in 3 ml of 20 mm Tris-Cl buffer, pH 8.0, containing 200 mmNaCl and 0.01% dodecylmaltoside. The concentration of cytochromec1 was adjusted to about 10 μm. Different amounts of NaOH or HCl were added to give the indicated pH levels. Fully oxidized or reduced cytochrome c1and ISP was obtained by addition of K3Fe(CN)6or sodium ascorbate. Reduction of cytochrome c1was followed by measuring the increase of the α-absorption (553–545 nm) in a Shimadzu UV 2101 PC spectrophotometer. Reduction of ISP was followed by measuring the negative CD peak, at 500 nm, of partially reduced ISP minus fully oxidized complex in a JASCO J-715 spectropolarimeter (13Link T.A. Hatzfeld O.M. Unalkat P. Shergill J.K. Cammack R. Mason J.R. Biochemistry. 1996; 35: 7546-7552Crossref PubMed Scopus (58) Google Scholar, 14Crofts A.R. Ugulava N.B. FEBS Lett. 1998; 440: 409-413Crossref PubMed Scopus (63) Google Scholar, 15Zhang L. Tai C-H., Yu, L. Yu C.A. J. Biol. Chem. 2000; 275: 7656-7661Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar). The same samples were used for the absorption and CD measurements. Instrument settings for the spectropolarimeter were: scan speed, 100 nm/min; step resolution, 1 nm; accumulation, 10 traces for averaging; response, 1 s; bandwidth, 1.0 nm; sensitivity, 10 mdeg; and slit width, 500 μm. The redox status of heme c1 or the 2Fe2S cluster was determined as described above. The cytochrome c1partially reduced wild type and mutant bc1complexes were prepared and used for the absorption and CD measurements. The redox potentials of ISP were calculated from the redox statuses of heme c1 and 2Fe2S, at pH 8.0, using 230 mV for the redox potential of heme c1(16Yu L. Dong J.H. Yu C.A. Biochim. Biophys. Acta. 1986; 85 2: 203-211Crossref Scopus (37) Google Scholar). The method used is essentially the same as that previously reported (15Zhang L. Tai C-H., Yu, L. Yu C.A. J. Biol. Chem. 2000; 275: 7656-7661Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar). The His6-tagged, cytochromec1 half-reduced cytochromebc1 complex was prepared as described for the preparation of the oxidized complex (6Tian H., Yu, L. Michael W. Yu C.A. J. Biol. Chem. 1998; 273: 27953-27959Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar), except the cytochromec1 in the dodecylmaltoside-solubilized chromatophore was reduced 50% with sodium ascorbate before being applied to a nickel-nitrilotriacetic acid column. The cytochromec1 half-reduced complex was diluted in 20 mm Tris-Cl buffer, pH 6.8 or 8.9, containing 200 mm NaCl and 0.01% dodecylmaltoside to a cytochromec1 concentration of around 10 μmand mixed with buffers of various pHs at room temperature in an Olis stopped flow rapid scanning spectrophotometer. Oxidation or reduction of cytochrome c1 was monitored by the decrease or increase of absorption at 553 nm minus 545 nm. Protein concentration was determined by the method of Lowry et al.(17Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar). Cytochrome b (18Berden J.A. Slater E.C. Biochim. Biophys. Acta. 1970; 216: 237-249Crossref PubMed Scopus (152) Google Scholar) and cytochromec1 (16Yu L. Dong J.H. Yu C.A. Biochim. Biophys. Acta. 1986; 85 2: 203-211Crossref Scopus (37) Google Scholar) contents were determined according to published methods. SDS-PAGE was performed according to Laemmli (19Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207231) Google Scholar) using a Bio-Rad Mini-Protean dual slab vertical cell. Samples were digested with 10 mm Tris-Cl buffer, pH 6.8, containing 1% SDS, and 3% glycerol in the presence and absence of 0.4% β-ME for 2 h at 37 °C before being subjected to electrophoresis. The intersubunit disulfide bond linked adduct protein was obtained by electrophoretic elution (20Yu L. Wei Y-Y. Usui S. Yu C.A. J. Biol. Chem. 1992; 267: 24508-24515Abstract Full Text PDF PubMed Google Scholar) of a protein band, with an apparent molecular mass of 64 kDa, from SDS-PAGE of the purified A185C(cytb)/K70C(ISP) mutant complex without β-ME treatment. Western blotting was performed with rabbit polyclonal antibodies against cytochrome b, cytochrome c1, and ISP of the R. sphaeroides bc1 complex (6Tian H., Yu, L. Michael W. Yu C.A. J. Biol. Chem. 1998; 273: 27953-27959Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar). The polypeptides separated by SDS-PAGE gel were transferred to polyvinylidene difluoride membrane for immunoblotting. Goat anti-rabbit IgG conjugated to alkaline phosphatase or protein A conjugated to horseradish peroxidase was used as the second antibody. EPR spectra were recorded in a Bruker ER 200D apparatus equipped with liquid Nitrogen Dewar, at 77 K. The instrument settings are detailed in the figure legends. Three pairs of amino acid residues: Ala185(cytb)/Lys70(ISP), Ile326(cytb)/Gly165(ISP), and Thr386(cytb)/Lys164(ISP) were selected for mutation to cysteines. These choices were based on the three-dimensional structural model of the four-subunit cytochromebc1 complex of R. sphaeroides (Fig. 1 A) constructed with coordinates from bovine cytochromes b andc1, ISP, and subunit XII (21Tso S-C. Shenoy S.K. Quinn B. Yu L. J. Biol. Chem. 2000; 275: 15287-15294Abstract Full Text Full Text PDF PubMed Scopus (18) Google Scholar). The distances between these three cysteine pairs are 6.1, 6.1, and, 7.5 Å, respectively, in the bacterial complex (Fig. 1 B). They are 6.5, 6.8, and 6.4 Å (Table I), respectively, when calculations are based on corresponding residues in the bovine enzyme. Mutants with a single cysteine substitution, at positions Ala185(cytb), Ile326(cytb), Thr386(cytb), Lys70(ISP), Gly165(ISP), or Lys164(ISP), were also generated and used as controls.Table ICharacterization of ISP and cytochrome b interface cysteine mutantsMutantsSingle mutationDouble mutant residue distance 1-aThe distances were measured from C-β to C-β (except with glycine, which is to C-α).Ps 1-bPs, photosynthetic growth. ++, the cells growth rate is essentially the same as that of the wild type cells; +, the cells can grow photosynthetically but at a rate slower than that of the wild type cells; −, no photosynthetic growth in 4 days.Enzymatic activity 1-cEnzymatic activity is expressed as μmol of cytochrome c reduced/min/nmol cytochromeb at room temperature.Corresponding residues in bovineLocationIn bovine structureIn bacterial modelingChromatophorePurified complex 1-dThe cytochromebc1 complex was in 50 mm Tris-Cl, pH 8.0, containing 200 mm NaCl, 200 mm histidine, and 0.5% octyl glucoside.ÅWild type++2.3 (100%)2.5 (100%)A185C(cytb)Ser169cd2++2.3 (100%)2.5 (100%)K70C(ISP)Lys95β3++1.3 (57%)1.4 (56%)A185C(cytb)/K70C(ISP)6.56.1++1.3 (57%)0.3 (12%) 1-cEnzymatic activity is expressed as μmol of cytochrome c reduced/min/nmol cytochromeb at room temperature.I326C(cytb)Ile284ef loop++0.8 (35%)0.8 (32%)G165C(ISP)Gly174Pro loop−NA 1-fNA, not applicable.NAI326C(cytb)/G165C(ISP)6.86.1−NANAT386C(cytb)Glu344gh loop++0.9 (39%)1.0 (40%)K164C(ISP)Lys173Pro loop+1.0 (43%)1.0 (40%)T386C(cytb)/K164C(ISP)6.47.5+0.8 (35%)0.8 (32%)e The cytochromebc1 complex activity of the A185C/K70C mutant complex was measured immediately after preparation.1-a The distances were measured from C-β to C-β (except with glycine, which is to C-α).1-b Ps, photosynthetic growth. ++, the cells growth rate is essentially the same as that of the wild type cells; +, the cells can grow photosynthetically but at a rate slower than that of the wild type cells; −, no photosynthetic growth in 4 days.1-c Enzymatic activity is expressed as μmol of cytochrome c reduced/min/nmol cytochromeb at room temperature.1-d The cytochromebc1 complex was in 50 mm Tris-Cl, pH 8.0, containing 200 mm NaCl, 200 mm histidine, and 0.5% octyl glucoside.1-f NA, not applicable. Open table in a new tab e The cytochromebc1 complex activity of the A185C/K70C mutant complex was measured immediately after preparation. For a cysteine pair mutant to be useful in this study, the engineered cysteine positions must not be critical for cytochromebc1 complex activity. Because thebc1 complex is absolutely required for the photosynthetic growth of R. sphaeroides, whether or not the engineered cysteine positions are critical to the complex can be determined by assaying photosynthetic growth. Mutants with cysteine substitutions at critical positions in the complex will not grow photosynthetically, whereas mutants with substitutions at noncritical positions will grow. When mid-log phase, aerobically dark grown wild type and mutant cells were inoculated into enriched Siström's medium and subjected to anaerobic photosynthetic growth conditions, the A185C(cytb), K70C(ISP), A185C(cytb)/K70C(ISP), I326C(cytb), and T386C(cytb) mutants grew at rates comparable with that of wild type cells, the K164C(ISP) and T386C(cytb)/K164C(ISP) mutants grew at a retarded rate (60%), and the G165C(ISP) and I326C(cytb)/G165C(ISP) did not grow photosynthetically (Table I). Because Gly165 of ISP is a critical position, mutant I326C(cytb)/G165C(ISP) does not support photosynthetic growth and cannot be used to study the effect of disulfide bond formation on thebc1 complex. The structural importance of Gly165 was further investigated by substituting alanine or threonine at this position. The ISP:G165A or G165T substitution also results in cells that do not grow photosynthetically, indicating that the size of the amino acid side chain at position 165 of ISP is critical. A similar size-activity relationship was previously observed for Gly158 of cytochrome b in Rhodobacter capsulatus (22Atta-Asafo-Adjei E. Daldal F. Proc. Natl. Acad. Sci. U. S. A. 1991; 88 (496): 492Crossref PubMed Scopus (106) Google Scholar) and Ser155 of cytochrome bin R. sphaeroides (23Tian H., Yu, L. Mather M.W. Yu C.A. J. Biol. Chem. 1997; 272: 23722-23728Crossref PubMed Scopus (19) Google Scholar). On the other hand, mutants A185C(cytb)/K70C(ISP) and T386C(cytb)/K164C(ISP) support photosynthetic growth, indicating that the engineered cysteine positions are noncritical to the complex. Therefore, formation of an intersubunit disulfide bond between cytochrome b and the ISP head domain was examined with these two cysteine pair mutants. Chromatophores freshly prepared from the A185C(cytb), K70C(ISP), A185C(cytb)/K70C(ISP), T386C(cytb), K164C(ISP), and T386C(cytb)/K164C(ISP) mutant cells have, respectively, 100, 57, 57, 39, 43, and 35% of the bc1 activity found in wild type chromatophores (Table I). When these chromatophore preparations were subjected to Western blot analysis using antibodies against R. sphaeroides cytochrome b and ISP, no protein band corresponding to the adduct of cytochrome b and ISP was observed, indicating that no disulfide bond is formed between the two engineered cysteines in mutants A185C(cytb)/K70C(ISP) and T386C(cytb)/K164C(ISP) during anaerobic photosynthetic growth. The lack of disulfide bond formation is expected because photosynthetic growth is under strict anaerobic conditions, whereas disulfide bond formation is an oxidative process. Without oxygen no disulfide bond can be formed even if the two cysteines are in favorable positions. When the His6-tagged bc1 complexes were purified from these six freshly prepared cysteine mutant chromatophores, all but the A185C(cytb)/K70C(ISP) mutant complex have the same bc1 activity found in their respective chromatophores (Table I), based on cytochrome b content. The A185C(cytb)/K70C(ISP) mutant complex, when assayed immediately after preparation, has about 23% of the bc1 complex activity found in its freshly prepared chromatophores. Activity in this cysteine pair mutant complex decreased during storage at 0 °C. About 7% of the activity remained after 24 h. Under identical conditions, no activity loss was observed for wild type and mutant complexes of A185C(cytb), K70C(ISP), T386C(cytb), K164C(ISP), and T386C(cytb)/K164C(ISP). To see whether or not the loss of bc1 complex activity observed for mutant A185C(cytb)/K70C(ISP) results from disulfide bon" @default.
• W2055946483 created "2016-06-24" @default.
• W2055946483 creator A5013929528 @default.
• W2055946483 creator A5053397364 @default.
• W2055946483 creator A5091115821 @default.
• W2055946483 date "2000-12-01" @default.
• W2055946483 modified "2023-09-28" @default.
• W2055946483 title "Confirmation of the Involvement of Protein Domain Movement during the Catalytic Cycle of the Cytochrome bc1Complex by the Formation of an Intersubunit Disulfide Bond between Cytochrome b and the Iron-Sulfur Protein" @default.
• W2055946483 cites W1597536177 @default.
• W2055946483 cites W1603308381 @default.
• W2055946483 cites W1775749144 @default.
• W2055946483 cites W1972024107 @default.
• W2055946483 cites W1975700276 @default.
• W2055946483 cites W1977814831 @default.
• W2055946483 cites W1981733844 @default.
• W2055946483 cites W1983935922 @default.
• W2055946483 cites W1988369492 @default.
• W2055946483 cites W1991082655 @default.
• W2055946483 cites W1993747161 @default.
• W2055946483 cites W2000539222 @default.
• W2055946483 cites W2002732447 @default.
• W2055946483 cites W2003352425 @default.
• W2055946483 cites W2018309321 @default.
• W2055946483 cites W2020402228 @default.
• W2055946483 cites W2023498524 @default.
• W2055946483 cites W2024191933 @default.
• W2055946483 cites W2027105227 @default.
• W2055946483 cites W2032275655 @default.
• W2055946483 cites W2039254203 @default.
• W2055946483 cites W2047133059 @default.
• W2055946483 cites W2072425078 @default.
• W2055946483 cites W2087477562 @default.
• W2055946483 cites W2090906357 @default.
• W2055946483 cites W2100837269 @default.
• W2055946483 cites W2145412238 @default.
• W2055946483 cites W2160088789 @default.
• W2055946483 cites W2170621128 @default.
• W2055946483 cites W2174691349 @default.
• W2055946483 doi "https://doi.org/10.1074/jbc.m007444200" @default.
• W2055946483 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10978350" @default.
• W2055946483 hasPublicationYear "2000" @default.
• W2055946483 type Work @default.
• W2055946483 sameAs 2055946483 @default.
• W2055946483 citedByCount "63" @default.
• W2055946483 countsByYear W20559464832012 @default.
• W2055946483 countsByYear W20559464832013 @default.
• W2055946483 countsByYear W20559464832015 @default.
• W2055946483 countsByYear W20559464832016 @default.
• W2055946483 countsByYear W20559464832018 @default.
• W2055946483 countsByYear W20559464832019 @default.
• W2055946483 countsByYear W20559464832020 @default.
• W2055946483 countsByYear W20559464832021 @default.
• W2055946483 countsByYear W20559464832022 @default.
• W2055946483 countsByYear W20559464832023 @default.
• W2055946483 crossrefType "journal-article" @default.
• W2055946483 hasAuthorship W2055946483A5013929528 @default.
• W2055946483 hasAuthorship W2055946483A5053397364 @default.
• W2055946483 hasAuthorship W2055946483A5091115821 @default.
• W2055946483 hasBestOaLocation W20559464831 @default.
• W2055946483 hasConcept C104317684 @default.
• W2055946483 hasConcept C148292235 @default.
• W2055946483 hasConcept C161790260 @default.
• W2055946483 hasConcept C178790620 @default.
• W2055946483 hasConcept C181199279 @default.
• W2055946483 hasConcept C185592680 @default.
• W2055946483 hasConcept C24586158 @default.
• W2055946483 hasConcept C27256138 @default.
• W2055946483 hasConcept C2780768313 @default.
• W2055946483 hasConcept C28859421 @default.
• W2055946483 hasConcept C29311851 @default.
• W2055946483 hasConcept C518881349 @default.
• W2055946483 hasConcept C55493867 @default.
• W2055946483 hasConcept C63338738 @default.
• W2055946483 hasConcept C71240020 @default.
• W2055946483 hasConceptScore W2055946483C104317684 @default.
• W2055946483 hasConceptScore W2055946483C148292235 @default.
• W2055946483 hasConceptScore W2055946483C161790260 @default.
• W2055946483 hasConceptScore W2055946483C178790620 @default.
• W2055946483 hasConceptScore W2055946483C181199279 @default.
• W2055946483 hasConceptScore W2055946483C185592680 @default.
• W2055946483 hasConceptScore W2055946483C24586158 @default.
• W2055946483 hasConceptScore W2055946483C27256138 @default.
• W2055946483 hasConceptScore W2055946483C2780768313 @default.
• W2055946483 hasConceptScore W2055946483C28859421 @default.
• W2055946483 hasConceptScore W2055946483C29311851 @default.
• W2055946483 hasConceptScore W2055946483C518881349 @default.
• W2055946483 hasConceptScore W2055946483C55493867 @default.
• W2055946483 hasConceptScore W2055946483C63338738 @default.
• W2055946483 hasConceptScore W2055946483C71240020 @default.
• W2055946483 hasIssue "49" @default.
• W2055946483 hasLocation W20559464831 @default.
• W2055946483 hasOpenAccess W2055946483 @default.
• W2055946483 hasPrimaryLocation W20559464831 @default.
• W2055946483 hasRelatedWork W1501456700 @default.
• W2055946483 hasRelatedWork W1511898761 @default.
• W2055946483 hasRelatedWork W1550221585 @default.
• W2055946483 hasRelatedWork W1563062605 @default.
• W2055946483 hasRelatedWork W1864650270 @default.

• next