FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2056081796> ?p ?o ?g. }

• W2056081796 endingPage "18520" @default.
• W2056081796 startingPage "18511" @default.
• W2056081796 abstract "Transcription and repair of many DNA helix-distorting lesions such as cyclobutane pyrimidine dimers have been shown to be coupled in cells across phyla from bacteria to humans. The signal for transcription-coupled repair appears to be a stalled transcription complex at the lesion site. To determine whether oxidative DNA lesions can block correctly initiated human RNA polymerase II, we examined the effect of site-specifically introduced oxidative damages on transcription in HeLa cell nuclear extracts. We found that transcription was blocked by single-stranded breaks, common oxidative DNA lesions, when present in the transcribed strand of the transcription template. Cyclobutane pyrimidine dimers, which have been previously shown to block transcription both in vitro and in vivo, also blocked transcription in the HeLa cell nuclear transcription assay. In contrast, the oxidative DNA base lesions, 8-oxoguanine, 5-hydroxycytosine, and thymine glycol did not inhibit transcription, although pausing was observed with the thymine glycol lesion. Thus, DNA strand breaks but not oxidative DNA base damages blocked transcription by RNA polymerase II. Transcription and repair of many DNA helix-distorting lesions such as cyclobutane pyrimidine dimers have been shown to be coupled in cells across phyla from bacteria to humans. The signal for transcription-coupled repair appears to be a stalled transcription complex at the lesion site. To determine whether oxidative DNA lesions can block correctly initiated human RNA polymerase II, we examined the effect of site-specifically introduced oxidative damages on transcription in HeLa cell nuclear extracts. We found that transcription was blocked by single-stranded breaks, common oxidative DNA lesions, when present in the transcribed strand of the transcription template. Cyclobutane pyrimidine dimers, which have been previously shown to block transcription both in vitro and in vivo, also blocked transcription in the HeLa cell nuclear transcription assay. In contrast, the oxidative DNA base lesions, 8-oxoguanine, 5-hydroxycytosine, and thymine glycol did not inhibit transcription, although pausing was observed with the thymine glycol lesion. Thus, DNA strand breaks but not oxidative DNA base damages blocked transcription by RNA polymerase II. Transcription-coupled repair (TCR) 1The abbreviations used are: TCR, transcription-coupled repair; Tg, thymine glycol; 8-oxoG, 7,8-dihydro-8-oxoguanine; SSB, single-stranded break; BER, base excision repair; XP, xeroderma pigmentosum; CS, Cockayne syndrome; HIV, human immunodeficiency virus; 5-OHC, 5-hydroxycytosine; CPD, cyclobutane pyrimidine dimer; DTT, dithiothreitol; DHU, dihydrouracil; nt, nucleotide(s); UGI, uracil DNA glycosylase inhibitor; TFIIH, transcription factor II H; AP, apurinic apyrimidinic. is a specialized form of DNA repair where damages are repaired preferentially in the transcribed strand of actively transcribed genes (for reviews, see Refs. 1Hanawalt P.C. Spivak G. Dizdaroglu M. Karakaya A. Advances in DNA Damage and Repair. Kluwer Academic/Plenum Publishers, New York1999: 169-179Google Scholar and 2Svejstrup J.Q. Nat. Rev. Mol. Cell. Biol. 2002; 3: 21-29Google Scholar). TCR was originally believed to be a subpathway of nucleotide excision repair; however, ionizing radiation damage (3Leadon S.A. Cooper P.K. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 10499-10503Google Scholar), 5,6-dihydroxy-5,6-dihydrothymine (thymine glycol; Tg) (4Cooper P.K. Nouspikel T. Clarkson S.G. Leadon S.A. Science. 1997; 275: 990-993Google Scholar, 5Le Page F. Kwoh E.E. Avrutskaya A. Gentil A. Leadon S.A. Sarasin A. Cooper P.K. Cell. 2000; 101: 159-171Google Scholar), and 7,8-dihydro-8-oxoguanine (8-oxoG) (5Le Page F. Kwoh E.E. Avrutskaya A. Gentil A. Leadon S.A. Sarasin A. Cooper P.K. Cell. 2000; 101: 159-171Google Scholar) are removed in a TCR-dependent manner from human cells that lack nucleotide excision repair. Since Tg and 8-oxoG are small nonbulky lesions that are repaired primarily by the base excision repair (BER) pathway (for reviews, see Refs. 6Wallace S.S. Scandalios J. Oxidative Stress and the Molecular Biology of Antioxidant Defenses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1997: 49-90Google Scholar, 7McCullough A.K. Dodson M.L. Lloyd R.S. Annu. Rev. Biochem. 1999; 68: 255-285Google Scholar, 8Lindahl T. Wood R.D. Science. 1999; 286: 1897-1905Google Scholar), TCR of Tg and 8-oxoG in cells that lack nucleotide excision repair (5Le Page F. Kwoh E.E. Avrutskaya A. Gentil A. Leadon S.A. Sarasin A. Cooper P.K. Cell. 2000; 101: 159-171Google Scholar) links TCR to BER. TCR of 8-oxoG has also been shown to occur in nonreplicating Escherichia coli cells (9Bregeon D. Doddridge Z.A. You H.J. Weiss B. Doetsch P.W. Mol. Cell. 2003; 12: 959-970Google Scholar). TCR of oxidative damage does not appear to be universal, since in Chinese hamster ovary cells, TCR of oxidative damage produced by photosensitization and oxidizing agents is not observed in the Dhfr and cFos genes (10Taffe B.G. Larminat F. Laval J. Croteau D.L. Anson R.M. Bohr V.A. Mutat. Res. 1996; 364: 183-192Google Scholar, 11Thorslund T. Sunesen M. Bohr V.A. Stevnsner T. DNA Repair. 2002; 1: 261-273Google Scholar, 12Grishko V.I. Driggers W.J. LeDoux S.P. Wilson G.L. Mutat. Res. 1997; 384: 73-80Google Scholar). Furthermore, DNA strand breaks, oxidative lesions also repaired by BER, do not appear to be repaired by TCR in the Dhfr gene from Chinese hamster ovary cells (13Ljungman M. Radiat. Res. 1999; 152: 444-449Google Scholar) or human colon cancer cells (14May A. Bohr V.A. Biochem. Biophys. Res. Commun. 2000; 269: 433-437Google Scholar). Interestingly, recent measurements of TCR of cyclobutane pyrimidine dimers in the Hprt gene, integrated at different sites in Chinese hamster ovary cell chromosomes, have suggested that preferential repair of actively transcribed genes, as well as preferential repair of damages in the transcribed strand, is significantly affected by genomic context (15Feng Z. Hu W. Komissarova E. Pao A. Hung M.C. Adair G.M. Tang M.S. J. Biol. Chem. 2002; 277: 12777-12783Google Scholar). The proposed signal for TCR is an RNA polymerase transcription complex stalled at a lesion, which recruits the repair proteins to the damage site (16Mellon I. Spivak G. Hanawalt P.C. Cell. 1987; 51: 241-249Google Scholar, 17Selby C.P. Sancar A. Science. 1993; 260: 53-58Google Scholar, 18Park J.-S. Marr M.T. Roberts J.W. Cell. 2002; 109: 757-767Google Scholar); the ability of a lesion on the transcribed strand to block the RNA polymerase transcription complex has been assumed to be crucial for TCR. In addition to bulky lesions such as cyclobutane pyrimidine dimers, DNA polymerases are blocked by a number of oxidative lesions including sites of base loss (AP sites), single-stranded breaks (SSBs), and Tg, which are thus potentially lethal lesions (for reviews, see Refs. 19Hatahet Z. Wallace S.S. Nickoloff J.A. Hoekstra M.F. DNA Damage and Repair. Vol. 1. Humana Press, Inc., Totowa, NJ1998: 229-262Google Scholar, 20Wallace S.S. Radiat. Res. 1998; 150: S60-S79Google Scholar, 21Wallace S.S. Free Radical Biol. Med. 2002; 33: 1-14Google Scholar). DNA polymerases bypass 5,6-dihydrothymine, 5-hydroxycytosine (5-OHC), 5-hydroxyuracil, 5,6-dihydroxy-5,6-dihydrouracil, dihydrouracil, 7,8-dihydro-8-oxoadenine, and 8-oxoG. The oxidized cytosine lesions and 8-oxoG are potentially mutagenic, since they can mispair (for reviews, see Refs. 19Hatahet Z. Wallace S.S. Nickoloff J.A. Hoekstra M.F. DNA Damage and Repair. Vol. 1. Humana Press, Inc., Totowa, NJ1998: 229-262Google Scholar, 20Wallace S.S. Radiat. Res. 1998; 150: S60-S79Google Scholar, 21Wallace S.S. Free Radical Biol. Med. 2002; 33: 1-14Google Scholar, 22Wang D. Kreutzer D.A. Essigmann J.M. Mutat. Res. 1998; 400: 99-115Google Scholar). In many cases, the effects of oxidative DNA damages on transcription by RNA polymerases differ from their effects on DNA polymerases. Tg is a block to T7 RNA polymerase (23Hatahet Z. Purmal A.A. Wallace S.S. Ann. N. Y. Acad. Sci. 1994; 726: 346-348Google Scholar, 24Tornaletti S. Maeda L.S. Lloyd D.R. Reines D. Hanawalt P.C. J. Biol. Chem. 2001; 276: 45367-45371Google Scholar, 25Chen Y.H. Bogenhagen D.F. J. Biol. Chem. 1993; 268: 5849-5855Google Scholar). However, RNA polymerase II, partially purified from rat liver, completely bypassed Tg lesions in the transcribed strand located downstream from the adenovirus major late promoter, and the addition of fractions containing transcription factor II D and transcription factor II H (TFIIH) did not have any measurable effect (24Tornaletti S. Maeda L.S. Lloyd D.R. Reines D. Hanawalt P.C. J. Biol. Chem. 2001; 276: 45367-45371Google Scholar). As with DNA polymerases, 8-oxoG does not block T7 (23Hatahet Z. Purmal A.A. Wallace S.S. Ann. N. Y. Acad. Sci. 1994; 726: 346-348Google Scholar, 25Chen Y.H. Bogenhagen D.F. J. Biol. Chem. 1993; 268: 5849-5855Google Scholar) or E. coli RNA polymerase in vitro (26Viswanathan A. Doetsch P.W. J. Biol. Chem. 1998; 273: 21276-21281Google Scholar) or in cells (9Bregeon D. Doddridge Z.A. You H.J. Weiss B. Doetsch P.W. Mol. Cell. 2003; 12: 959-970Google Scholar) and at best stalls RNA polymerase II in vitro with a template containing a poly(C) tail (27Kuraoka I. Endou M. Yamaguchi Y. Wada T. Handa H. Tanaka K. J. Biol. Chem. 2003; 278: 7294-7299Google Scholar). In contrast to DNA polymerases, abasic sites in a poly(C)-tailed template are easily bypassed by RNA polymerase II (27Kuraoka I. Endou M. Yamaguchi Y. Wada T. Handa H. Tanaka K. J. Biol. Chem. 2003; 278: 7294-7299Google Scholar); abasic sites are also bypassed by T7 RNA polymerase (19Hatahet Z. Wallace S.S. Nickoloff J.A. Hoekstra M.F. DNA Damage and Repair. Vol. 1. Humana Press, Inc., Totowa, NJ1998: 229-262Google Scholar, 25Chen Y.H. Bogenhagen D.F. J. Biol. Chem. 1993; 268: 5849-5855Google Scholar), SP6 (28Zhou W. Doetsch P.W. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6601-6605Google Scholar), and E. coli (28Zhou W. Doetsch P.W. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6601-6605Google Scholar) RNA polymerase. A single-stranded break is a common oxidative lesion produced directly by free radicals and as BER processing intermediates. Depending on the 5′- and 3′-end chemistries at the strand break site, single-stranded breaks in the transcribed strand can block transcription by SP6, Escherichia coli, and T7 RNA polymerase. T7 RNA polymerase bypasses an SSB with an intact deoxyribose at the 3′ terminus and a hydroxyl group on the 5′ terminus (28Zhou W. Doetsch P.W. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6601-6605Google Scholar, 29Zhou W. Doetsch P.W. Biochemistry. 1994; 33: 14926-14934Google Scholar), whereas a single nucleotide gap with terminal 3′- and 5′-phosphoryl groups blocks transcription by SP6, E. coli, and T7 RNA polymerase (28Zhou W. Doetsch P.W. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6601-6605Google Scholar, 29Zhou W. Doetsch P.W. Biochemistry. 1994; 33: 14926-14934Google Scholar). When gaps in the transcribed strand are bypassed by prokaryotic RNA polymerases, the corresponding transcripts are shortened by the length of the gap (30Zhou W. Reines D. Doetsch P.W. Cell. 1995; 82: 577-585Google Scholar, 31Liu J. Doetsch P.W. Biochemistry. 1996; 35: 14999-15008Google Scholar). Xeroderma pigmentosum (XP) and Cockayne syndrome (CS) are two rare human hereditary disorders that are caused by defective DNA repair (for a review, see Ref. 32Thompson L.H. Nickoloff J.A. Hoekstra M.F. DNA Damage and Repair: DNA Repair in Higher Eukaryotes. Vol. 2. Humana Press, Totowa, NJ1998: 335-393Google Scholar). Xeroderma pigmentosum patients lack nucleotide excision repair and are cancer-prone, whereas Cockayne syndrome patients retain nucleotide excision repair and are not cancer-prone (32Thompson L.H. Nickoloff J.A. Hoekstra M.F. DNA Damage and Repair: DNA Repair in Higher Eukaryotes. Vol. 2. Humana Press, Totowa, NJ1998: 335-393Google Scholar). Patients with Cockayne syndrome can be divided into two complementation groups, CS-A or CS-B (33Lehmann A.R. Mutat. Res. 1982; 106: 347-356Google Scholar, 34Tanaka K. Kawai K. Kumahara Y. Ikenaga M. Okada Y. Somatic Cell Genet. 1981; 7: 445-455Google Scholar). The gene products associated with these complementation groups are required for TCR (3Leadon S.A. Cooper P.K. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 10499-10503Google Scholar, 35Venema J. Mullenders L.H. Natarajan A.T. van Zeeland A.A. Mayne L.V. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 4707-4711Google Scholar). Although CSA and CSB do not form stable complexes (36van Gool A. Citterio E. Rademakers S. van Os R. Vermeulen W. Constantinou A. Egly J. Bootsma D. Hoeijmakers J. EMBO J. 1997; 16: 5955-5965Google Scholar), they interact with each other and the human RNA polymerase II transcription factor TFIIH (37Henning K.A. Li L. Iyer N. McDaniel L.D. Reagan M.S. Legerski R. Schultz R.A. Stefanini M. Lehmann A.R. Mayne L.V. Friedberg E.C. Cell. 1995; 82: 555-564Google Scholar) and function in the TCR process. Cockayne syndrome cells have defects in the TCR of oxidative lesions (3Leadon S.A. Cooper P.K. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 10499-10503Google Scholar, 4Cooper P.K. Nouspikel T. Clarkson S.G. Leadon S.A. Science. 1997; 275: 990-993Google Scholar, 5Le Page F. Kwoh E.E. Avrutskaya A. Gentil A. Leadon S.A. Sarasin A. Cooper P.K. Cell. 2000; 101: 159-171Google Scholar). Some xeroderma pigmentosum patients from the XP-B, XP-D, and XP-G complementation groups also exhibit the neurological and developmental deficiencies associated with Cockayne syndrome compounded by the sun sensitivity and skin cancer susceptibility associated with xeroderma pigmentosum. The XPB and XPD gene products are helicase components of TFIIH and interact with three other TFIIH subunits, p62, p44, and p34 (38Iyer N. Reagan M.S. Wu K.J. Canagarajah B. Friedberg E.C. Biochemistry. 1996; 35: 2157-2167Google Scholar). XPG interacts with multiple subunits of TFIIH and CSB (38Iyer N. Reagan M.S. Wu K.J. Canagarajah B. Friedberg E.C. Biochemistry. 1996; 35: 2157-2167Google Scholar) and is required for TCR as well as global genomic repair of Tg (4Cooper P.K. Nouspikel T. Clarkson S.G. Leadon S.A. Science. 1997; 275: 990-993Google Scholar) and 8-oxoG (5Le Page F. Kwoh E.E. Avrutskaya A. Gentil A. Leadon S.A. Sarasin A. Cooper P.K. Cell. 2000; 101: 159-171Google Scholar). TCR of oxidative damages in mammals is paradoxical, since the proposed signal for TCR is a stalled RNA polymerase complex, but most oxidative DNA damages do not appear to block purified RNA polymerases. In this study, we asked whether oxidative DNA lesions block transcription by correctly initiated RNA polymerase II and thus serve as the signal for TCR. To address this, we carried out in vitro transcription assays with HeLa cell nuclear extracts, commonly used for transcription studies, and DNA templates containing oxidative damages placed downstream from the HIV-1 promoter and determined whether the damaged templates blocked transcription in a nuclear run-off assay. We also assumed that any constitutive activities essential to block transcription and signal TCR would be present in the extracts. In order to determine whether oxidative damages could block RNA polymerase II, specific oxidative lesions and a cyclobutane pyrimidine dimer known to block transcription (39Donahue B.A. Yin S. Taylor J.S. Reines D. Hanawalt P.C. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8502-8506Google Scholar) were inserted into the transcribed strand of the template at a defined distance from the transcription start site. A thymine-thymine dimer was used as the representative cyclobutane pyrimidine dimer lesion in our study. We found that correctly initiated RNA polymerase II from HeLa cell nuclear extracts was blocked by site-specifically introduced single-stranded breaks. As expected, a site-specific cyclobutane pyrimidine dimer also blocked transcription. In contrast, the oxidized base lesions tested, 8-oxoG, 5-OHC, and Tg, did not block RNA polymerase II. Some of the 5-OHC and Tg lesions were, however, converted to single-stranded breaks during the transcription assay, which then blocked transcription at these sites. In addition, RNA polymerase II initially paused at Tg, but eventually most of the transcription complexes bypassed this damage. Introduction of Unique Damages to Transcription Templates—The damages in the transcription templates were located exclusively on the transcribed strand throughout this study. PCR was used to generate the transcription templates with lesions that do not block DNA polymerases. A sequence containing the M13 reverse sequencing primer plus additional sequence (TGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATG) (obtained from Operon, Alameda, CA) and the oligoncleotides containing the lesion to be studied (GGGGATCCTCTAGAGTCATTCCAGACTGTCAATAACACGG8-oxoGGGACCAGTCGATCCTGGGCTGCAGGAATTC (obtained from Operon, Alameda, CA), GGGGATCCTCTAGAGTCATTCCAGACTGTCAATAACACGGUGGACCAGTCGATCCTGGGCTGCAGGAATTC (obtained from Operon, Alameda, CA) and ATTCCAGACTGTCAATAACACGG5-OHCGGACCAGTCGATCCTGGGCTGCAGGAATTC) (laboratory stock prepared by Dr. Zafer Hatahet) were used to generate the double-stranded transcription template. Transcription templates containing 8-oxoguanine and uracil and 5-hydroxycytosine were produced using this method. The PCR template was a single-stranded circular M13mp19 derivative containing the HIV-1 promoter and damage sequence (Fig. 1A). An AP site (site of base loss) was introduced in the transcription template by incubating the uracil-containing PCR product with uracil DNA glycosylase (New England Biolabs) for 1 h at 37 °C. Single nucleotide gaps with different 3′-end chemistries were produced by incubating the AP site-containing transcription template with endonuclease III (supplied by Dr. Zafer Hatahet, University of Texas, Tyler, TX), endonuclease IV (Trevigen, Gaithersburg, MD), or endonuclease VIII (laboratory stock prepared as described by Jiang et al. (40Jiang D. Hatahet Z. Blaisdell J.O. Melamede R.J. Wallace S.S. J. Bacteriol. 1997; 179: 3773-3782Google Scholar)) in 10 mm Tris (pH 8.0), 1 mm ETDA, 50 mm NaCl for 1 h at 37 °C, which results in a 3′-terminal unsaturated aldehyde, hydroxyl, or phosphate group, respectively (40Jiang D. Hatahet Z. Blaisdell J.O. Melamede R.J. Wallace S.S. J. Bacteriol. 1997; 179: 3773-3782Google Scholar, 41Kim J. Linn S. Nucleic Acids Res. 1988; 16: 1135-1141Google Scholar, 42Bailly V. Verly W.G. Biochem. J. 1989; 259: 761-768Google Scholar). The 5′-end group generated by endonucleases III and VIII was a terminal phosphate, whereas the 5′-end group generated by endonuclease IV was a deoxyribose. The single nucleotide gap with a 3′-hydroxyl and a 5′-phosphate was made by incubating the AP site-containing transcription template with endonuclease IV followed by formamidopyrimidine DNA glycosylase (Fpg) (laboratory stock) (43Bailly V. Verly W.G. O'Connor T. Laval J. Biochem. J. 1989; 262: 581-589Google Scholar). A different strategy was employed to produce the in vitro transcription templates containing a Tg or a cyclobutane pyrimidine dimer (CPD), since these lesions block DNA polymerases. To prepare these transcription templates, oligonucleotides complementary to the M13mp19 derivative on either side of the insert site were annealed to the single-stranded circular M13mp19 derivative and the DNA cut by restriction enzymes with sites in the double-stranded regions. The ∼1-kb single-stranded DNA containing the HIV-1 promoter and the damage sequences was purified from an agarose gel and used as a template for Sequenase V2.0 (USB Corporation, Cleveland, OH). 10 pmol of a 54-mer containing Tg (laboratory stock prepared by Dr. Zafer Hatahet) (ATTCCAGACTGTCAATAACACGGTgGGACCAGTCGATCCTGGGCTGCAGGAATTC) was annealed to ∼5 pmol of single-stranded, linearized, ∼1-kb DNA template in water by heating to 65 °C for 10 min and cooling to room temperature over a 10-min time period. Ten pmol of a 71-mer containing the CPD (generously provided by Dr. Christopher Lawrence, University of Rochester School of Medicine and Dentistry and modified in our laboratory to extend the length) (AATTAGAGTCATTCCAGACTGCAGGCPDGGAGGTCAATAACACGGGGGACCAGTCGATCCTGGGCTGCAGGAATTC) was annealed to ∼5 pmol of single-stranded, linear, 1-kb template in water and cooled as described above for the Tg-containing primer. The primers were extended with 65 units of Sequenase V2.0 (USB Corporation) in 40 mm Tris-HCl (pH 7.5), 20 mm MgCl2, 50 mm NaCl, 1 mm dithiothreitol (DTT), and 2 mm dNTPs for 30 min at 37 °C (Fig. 1B). These transcription templates were purified from an agarose gel (Qiaquick gel purification system; Qiagen). In Vitro Transcription with Templates Containing Unique Lesions— Transcription reactions were carried out at 30 °C in 20 mm HEPES (pH 7.9), 100 mm KCl, 8 mm MgCl2, 0.2 mm EDTA, 0.5 mm DTT, 20% glycerol with 25 ng of the transcription template (44Laspia M.F. Rice A.P. Mathews M.B. Cell. 1989; 59: 283-292Google Scholar). The reactions were incubated with 92.5 μg of HeLa cell nuclear extract (Promega) for 5 min to allow the RNA polymerase transcription complex to assemble at the HIV-1 promoter. Transcription was initiated by the addition of ATP, CTP, and GTP to 400 μm, UTP to 16 μm, and [α-32P]UTP to 0.132 μm to give a final volume of 25 μl and, subsequently, transcription template at 1.5 nm. Transcription was carried out for 1, 2, 5, and 10 min (two additional time points, 20 and 30 min, were taken with the Tg transcription template) and was terminated by the addition of 175 μl of stop solution (300 μm Tris-HCl (pH 7.4 at 25 °C), 300 μm sodium acetate, 0.5% SDS, 2 mm EDTA, and 3 μg/ml tRNA). The terminated transcription reactions were extracted with an equal volume of phenol/chloroform, mixed on a vortexer at maximum speed for 10 s, and centrifuged for 5 min at 12,000 × g. The aqueous phase was transferred to a new tube containing 15 μg of glycoBlue (Ambion), and 500 μl of ethanol was added. The samples were incubated for at least 30 min at -20 °C and then centrifuged at 12,000 × g for 10 min. The supernatant was decanted, and the pellets were air-dried and suspended in 4 μl of nuclease-free water followed by the addition of an equal volume of loading dye (98% formamide, 10 mm EDTA, 0.1% xylene cyanol, and 0.1% bromphenol blue). The samples were heated in a boiling water bath for 5–10 min, separated on a 6% (w/v) polyacrylamide sequencing gel, and visualized by autoradiography and/or analysis with an isotope imaging system (Molecular Images FX System, Bio-Rad). Determination of BER Activities in HeLa Cell Nuclear Extracts— Oligonucleotides containing a furan, dihydrouracil (DHU), and 8-oxoG, substrates for hAPE1, hNTH1 (also NEIL1 and NEIL2), and hOGG1, respectively, were end-labeled with [γ-32P]ATP by T4 polynucleotide kinase. The complementary strand was added to the labeled oligo (1:1 molar ratio), heated to 70 °C for 10 min, and cooled to room temperature to create the double-stranded substrate. Enzymatic incision of the substrates by the HeLa cell nuclear extracts was determined as follows. In each case, 10 fmol of labeled substrate was incubated with the extracts at 37 °C in a volume of 10 μl and terminated at 0, 5, 15, and 30 min by the addition of 98% formamide, 10 mm EDTA, 0.1% xylene cyanol, and 0.1% bromphenol blue. The furan-containing oligonucleotide (Microbiology and Molecular Genetics DNA Synthesis Facility, University of Vermont) (5′-AAGCTTGGCACTGFuranCCGTCGTTTTACAACGTCGTG-3′) annealed to its complement, was incubated with 36.4 ng of HeLa cell nuclear extract in 45 mm HEPES (pH 7.9), 70 mm KCl, 1 mm DTT, 2 mm EDTA, and 5 mm MgCl2. The 8-oxoG-containing oligonucleotide (Microbiology and Molecular Genetics DNA Synthesis Facility, University of Vermont) (5′-AAGCTTGGCACTGGCC8-oxoGTCGTTTTACAACGTCGTG-3′) annealed to its complement, was incubated with 3.64 μg of HeLa cell nuclear extract in 25 mm HEPES (pH 7.9), 50 mm KCl, 2 mm DTT, 2 mm EDTA, and 2.5% glycerol. The DHU-containing oligonucleotide (University of Vermont, Microbiology and Molecular Genetics DNA Synthesis Facility) (5′-AAGCTTGGCACTGGCCGTDHUGTTTTACAACGTCGTG-3′) annealed to its complement was incubated with 1.82 μg of HeLa cell nuclear extract in 45 mm HEPES (pH 7.9), 70 mm KCl, 1 mm DTT, and 2 mm EDTA. Ten fmol of the substrate containing a furan, DHU, and 8-oxoG were also incubated with HeLa cell nuclear extracts under the in vitro transcription buffer conditions described above to determine if the damage in the double-stranded 35-mer was still present at the end of the transcription assay. Detection of the Lesion in the Transcription Template—Transcription templates containing the oxidative lesions studied were end-labeled with [γ-32P]ATP by T4 polynucleotide kinase and either assayed for the presence of the lesion or added (15 fmol) to the transcription reaction as described previously except that nonradioactive UTP was substituted for the [α-32P]UTP. The transcription reaction was carried out as described above for 10 min for the AP sites, single-stranded breaks, 5-OHC, and 8-oxoG, 30 min in the case of the Tg-containing template. The nucleic acids were purified by phenol/chloroform extraction and ethanol precipitation. The nucleic acids were suspended in distilled H2O, and the template was restricted with EcoRI in 50 mm NaCl, 10 mm Tris-HCl, 10 mm MgCl2, 1 mm DTT (pH 7.9 at 25 °C) and purified with the QIAquick PCR purification kit (Qiagen, Valencia, CA) to remove the restriction enzyme and exchange the buffer to 10 mm Tris, pH 8.0. To assay for the presence of the lesion, 2.5 fmol of template/substrate was incubated with 60 fmol of the appropriate enzyme for 60 min at 37 °C in 10 mm Tris (pH 8), 1 mm EDTA, 50 mm NaCl. The oligonucleotide containing the CPD dimer was end-labeled with [γ-32P]ATP by T4 polynucleotide kinase and annealed to its complementary strand. The double-stranded CPD dimer substrate was incubated with T4 endonuclease V (Trevigen, Gaithersburg, MD) at 37 °C in 25 mm NaPO4 (pH 6.8), 1 mm EDTA, 100 mm NaCl, 1 mm DTT, and 0.1 mg/ml bovine serum albumin for 60 min. All reactions were terminated by the addition of an equal volume of loading dye (98% formamide, 10 mm EDTA, 0.1% xylene cyanol, and 0.1% bromphenol blue). All samples, except the AP site-containing DNA, were heated in a boiling water bath for 5 min before subsequent separation on a 12% (w/v) polyacrylamide, 7 m urea sequencing gel. The results were visualized and quantified by autoradiography and/or analysis on an isotope imaging system (Molecular Images FX System, Bio-Rad). RNA Polymerase II Transcription Is Blocked by Site-specific Single-stranded Breaks in the Template Strand—To determine what effect SSBs had on transcription by RNA polymerase II, we carried out run-off transcription assays with HeLa cell nuclear extracts on templates containing SSBs with different end chemistries located on the transcribed strand downstream from the HIV-1 promoter. For all transcription reactions, the extent of lesion bypass is calculated as the amount of full-length transcript divided by the amount of full-length transcript plus blocked transcript and quantified using an isotope imaging system. The number of radioactive nucleotides incorporated into the transcript was taken into account, since the difference in the number of radioactive nucleotides incorporated between the run-off transcript and a transcript blocked at the lesion was significant (∼7% in the case of the 54-mer damage-containing oligonucleotides and ∼9% in the case of the 71-mer damage-containing oligonucleotides). All SSBs tested inhibited transcription by RNA polymerase II (Fig. 2). It should be noted that all the SSBs examined here are actually single base gaps where the gaps have the end chemistries described and are intermediates in the BER process. An SSB with a 3′-unsaturated aldehyde and a 5′-phosphate caused almost 90% blockage between 2 and 10 min from transcript initiation (Fig. 2, lanes 2–4, and Table II). An SSB with a 3′-hydroxyl and a 5′-deoxyribose demonstrated ∼80% blockage between 2 and 10 min (Fig. 2, lanes 6–8, and Table II), whereas an SSB with a 3′-phosphate and a 5′-phosphate showed about 85% blockage between 2 and 10 min (Fig. 2, lanes 10–12, and Table II). Finally, an SSB with a 3′-hydroxyl and a 5′-phosphate demonstrated just over 75% blockage at 2 min that decreased to ∼65% at 10 min (Fig. 2, lanes 14–16, and Table II). The majority of transcripts had a length of ∼364 nucleotides (nt), which corresponds to the position of the SSB. The transcription template containing an SSB with a 3′-hydroxyl and 5′-deoxyribose produced an additional transcript at ∼344 nt (Fig. 2, lanes 6–8). Some transcripts corresponding to full length were produced from all of the SSB-containing transcription templates, due to a small fraction of the template that did not contain a SSB as well as possible repair of the SSB by the nuclear extract. In fact, there were 10–20% fewer SSB in the transcription templates after the assay (see Table I), suggesting that some repair did occur (see below). Some full-length transcripts may reflect lesion bypass and presumably would be 1 nt shorter than a full-length transcript. The limited resolution of the 6% poly-acrylamide gel used in these assays did not allow us to discern whether the longest transcripts are actually full-length or 1 nt short of full-length as a consequence of single nucleotide gap bypass in the transcribed strand. At 10 min, the SSB with a 3′-unsaturated aldehyde and a 5′-phosphate showed little by-pass (Fig. 2, lane 4, and Table II), whereas the SSBs with a 3′-hydroxyl and 5′-deoxyribose (Fig. 2, lane 8) or a 3′-phosphate and a 5′-phosphate (Fig. 2, lane 12) showed about 20% bypass (Table II). Only the SSB" @default.
• W2056081796 created "2016-06-24" @default.
• W2056081796 creator A5029549635 @default.
• W2056081796 creator A5044576321 @default.
• W2056081796 creator A5051791551 @default.
• W2056081796 date "2004-04-01" @default.
• W2056081796 modified "2023-09-30" @default.
• W2056081796 title "Single-Stranded Breaks in DNA but Not Oxidative DNA Base Damages Block Transcriptional Elongation by RNA Polymerase II in HeLa Cell Nuclear Extracts" @default.
• W2056081796 cites W1533647724 @default.
• W2056081796 cites W1562498242 @default.
• W2056081796 cites W1935503261 @default.
• W2056081796 cites W1963718031 @default.
• W2056081796 cites W1964767598 @default.
• W2056081796 cites W1966425882 @default.
• W2056081796 cites W1969504098 @default.
• W2056081796 cites W1973517823 @default.
• W2056081796 cites W1975494947 @default.
• W2056081796 cites W1985063313 @default.
• W2056081796 cites W1990586926 @default.
• W2056081796 cites W1990731481 @default.
• W2056081796 cites W1992142601 @default.
• W2056081796 cites W1998395498 @default.
• W2056081796 cites W2003633196 @default.
• W2056081796 cites W2004632795 @default.
• W2056081796 cites W2004660918 @default.
• W2056081796 cites W2004864721 @default.
• W2056081796 cites W2004988279 @default.
• W2056081796 cites W2007998684 @default.
• W2056081796 cites W2009187135 @default.
• W2056081796 cites W2009536322 @default.
• W2056081796 cites W2010208551 @default.
• W2056081796 cites W2010992218 @default.
• W2056081796 cites W2011657625 @default.
• W2056081796 cites W2017519940 @default.
• W2056081796 cites W2022929617 @default.
• W2056081796 cites W2028805078 @default.
• W2056081796 cites W2036103078 @default.
• W2056081796 cites W2040939833 @default.
• W2056081796 cites W2048953739 @default.
• W2056081796 cites W2049353359 @default.
• W2056081796 cites W2049812251 @default.
• W2056081796 cites W2051883249 @default.
• W2056081796 cites W2057691240 @default.
• W2056081796 cites W2058488980 @default.
• W2056081796 cites W2059901912 @default.
• W2056081796 cites W2067953727 @default.
• W2056081796 cites W2068237150 @default.
• W2056081796 cites W2074255998 @default.
• W2056081796 cites W2080058548 @default.
• W2056081796 cites W2087597149 @default.
• W2056081796 cites W2090219305 @default.
• W2056081796 cites W2095464964 @default.
• W2056081796 cites W2107981920 @default.
• W2056081796 cites W2112652171 @default.
• W2056081796 cites W2123678649 @default.
• W2056081796 cites W2127136618 @default.
• W2056081796 cites W2158742644 @default.
• W2056081796 cites W2160776688 @default.
• W2056081796 cites W2162298033 @default.
• W2056081796 cites W2163076785 @default.
• W2056081796 cites W2163210351 @default.
• W2056081796 cites W2168044649 @default.
• W2056081796 cites W2169534592 @default.
• W2056081796 cites W2314446635 @default.
• W2056081796 cites W2324088364 @default.
• W2056081796 cites W2331622751 @default.
• W2056081796 cites W2792152836 @default.
• W2056081796 doi "https://doi.org/10.1074/jbc.m313598200" @default.
• W2056081796 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14978042" @default.
• W2056081796 hasPublicationYear "2004" @default.
• W2056081796 type Work @default.
• W2056081796 sameAs 2056081796 @default.
• W2056081796 citedByCount "128" @default.
• W2056081796 countsByYear W20560817962012 @default.
• W2056081796 countsByYear W20560817962013 @default.
• W2056081796 countsByYear W20560817962014 @default.
• W2056081796 countsByYear W20560817962015 @default.
• W2056081796 countsByYear W20560817962016 @default.
• W2056081796 countsByYear W20560817962017 @default.
• W2056081796 countsByYear W20560817962018 @default.
• W2056081796 countsByYear W20560817962019 @default.
• W2056081796 countsByYear W20560817962020 @default.
• W2056081796 countsByYear W20560817962021 @default.
• W2056081796 countsByYear W20560817962022 @default.
• W2056081796 countsByYear W20560817962023 @default.
• W2056081796 crossrefType "journal-article" @default.
• W2056081796 hasAuthorship W2056081796A5029549635 @default.
• W2056081796 hasAuthorship W2056081796A5044576321 @default.
• W2056081796 hasAuthorship W2056081796A5051791551 @default.
• W2056081796 hasBestOaLocation W20560817961 @default.
• W2056081796 hasConcept C101762097 @default.
• W2056081796 hasConcept C104317684 @default.
• W2056081796 hasConcept C112950240 @default.
• W2056081796 hasConcept C143425029 @default.
• W2056081796 hasConcept C1491633281 @default.
• W2056081796 hasConcept C150194340 @default.
• W2056081796 hasConcept C153911025 @default.
• W2056081796 hasConcept C185581394 @default.

• next