FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2056519857> ?p ?o ?g. }

• W2056519857 endingPage "22763" @default.
• W2056519857 startingPage "22758" @default.
• W2056519857 abstract "A cDNA clone, predicted to encode a variant form of the type 1 fibroblast growth factor receptor (FGFR1) containing a dipeptide Val-Thr (VT) deletion at amino acid positions 423 and 424 located within the juxtamembrane region, was isolated from a Xenopus embryo (stage 8 blastula) library. Sequence analysis of genomic DNA encoding a portion of the FGFR1 juxtamembrane region demonstrated that this variant form arises from use of an alternative 5′ splice donor site. RNase protection analysis revealed that both VT- and VT+ forms of the FGFR1 were expressed throughout embryonic development, the VT+ being the major form. Amino acid position 424 is located within a consensus sequence for phosphorylation by a number of Ser/Thr kinases. We demonstrate that a VT+ peptide was specifically phosphorylated by protein kinase C (PKC) in vitro, but not by protein kinase A (PKA). A VT- peptide, on the other hand, was not a substrate for either enzyme. Phosphorylation levels of in vitro synthesized FGFR-VT+ protein by PKC were twice that of FGFR-VT- protein. In a functional assay, Xenopus oocytes expressing FGFR-VT- or FGFR-VT+ protein were equally able to mobilize intracellular Ca2+ in response to basic fibroblast growth factor (bFGF). However, pretreatment with phorbol 12-myristate 13-acetate significantly reduced this mobilization in oocytes expressing FGFR-VT+ while having little effect on oocytes expressing FGFR-VT-. These findings demonstrate that alternative splicing of Val423-Thr424 generates isoforms which differ in their ability to be regulated by phosphorylation and thus represents an important mechanism for regulating FGFR activity. A cDNA clone, predicted to encode a variant form of the type 1 fibroblast growth factor receptor (FGFR1) containing a dipeptide Val-Thr (VT) deletion at amino acid positions 423 and 424 located within the juxtamembrane region, was isolated from a Xenopus embryo (stage 8 blastula) library. Sequence analysis of genomic DNA encoding a portion of the FGFR1 juxtamembrane region demonstrated that this variant form arises from use of an alternative 5′ splice donor site. RNase protection analysis revealed that both VT- and VT+ forms of the FGFR1 were expressed throughout embryonic development, the VT+ being the major form. Amino acid position 424 is located within a consensus sequence for phosphorylation by a number of Ser/Thr kinases. We demonstrate that a VT+ peptide was specifically phosphorylated by protein kinase C (PKC) in vitro, but not by protein kinase A (PKA). A VT- peptide, on the other hand, was not a substrate for either enzyme. Phosphorylation levels of in vitro synthesized FGFR-VT+ protein by PKC were twice that of FGFR-VT- protein. In a functional assay, Xenopus oocytes expressing FGFR-VT- or FGFR-VT+ protein were equally able to mobilize intracellular Ca2+ in response to basic fibroblast growth factor (bFGF). However, pretreatment with phorbol 12-myristate 13-acetate significantly reduced this mobilization in oocytes expressing FGFR-VT+ while having little effect on oocytes expressing FGFR-VT-. These findings demonstrate that alternative splicing of Val423-Thr424 generates isoforms which differ in their ability to be regulated by phosphorylation and thus represents an important mechanism for regulating FGFR activity. Fibroblast growth factors (FGFs) 1The abbreviations used are: FGFsfibroblast growth factorsbFGFbasic FGFXbFGFXenopus bFGFFGFRsFGF receptorsPKCprotein kinase CPKAprotein kinase Abpbase pair(s)kbkilobase(s)PCRpolymerase chain reactionPMAphorbol 12-myristate 13-acetate. play a role in a number of cellular responses, including mitogenesis, differentiation, angiogenesis, and transformation (reviewed in (1Baird A. Klagsburn M. The Fibroblast Growth Factor Family. The New York Academy of Sciences, New York1991Google Scholar)). The family of FGFs consists of nine distinct members(2Miyamoto M. Naruo K.-I. Seko C. Matsumoto S. Kondo T. Kurokawa T. Mol. Cell. Biol. 1993; 13: 4251-4259Google Scholar), related by amino acid sequence and their ability to bind heparin, that mediate their response by binding to high affinity cell surface FGF receptors (FGFRs). Functional FGFRs are transmembrane proteins composed of an extracellular ligand-binding domain containing two or three immunoglobulin (Ig)-like domains and an intracellular domain consisting of a juxtamembrane region, a split tyrosine kinase domain and a COOH-terminal tail (reviewed in (3Jaye M. Schlessinger J. Dionne C.A. Biochim. Biophys. Acta. 1992; 1135: 185-199Google Scholar)). FGF binding to the extracellular domain of the FGFR results in receptor activation through dimerization and autophosphorylation. The activated receptor can then bind and phosphorylate a number of intracellular substrates, thus altering their catalytic activity and initiating intracellular signal transduction cascades (reviewed in (3Jaye M. Schlessinger J. Dionne C.A. Biochim. Biophys. Acta. 1992; 1135: 185-199Google Scholar)). fibroblast growth factors basic FGF Xenopus bFGF FGF receptors protein kinase C protein kinase A base pair(s) kilobase(s) polymerase chain reaction phorbol 12-myristate 13-acetate. FGFRs are encoded by four genes whose transcripts are alternatively spliced to produce a number of variant forms (reviewed in (3Jaye M. Schlessinger J. Dionne C.A. Biochim. Biophys. Acta. 1992; 1135: 185-199Google Scholar)). Each of the four FGFR types is capable of binding more than one member of the FGF family, the ligand binding specificity being determined not only by the receptor type but by the splicing form. For example, alternative splicing of exons encoding the COOH-terminal half of the third Ig domain of FGFR2 leads to production of FGFRs that no longer recognize FGF-7(4Miki T. Bottaro D.P. Fleming T.P. Smith C.L. Burgess W.H. Chan A.M.-L. Aaronson S.A. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 246-250Scopus (655) Google Scholar). In addition, Shi et al.(5Shi E. Kan M. Xu J. Wang F. Hou J. McKeehan W.L. Mol. Cell. Biol. 1993; 13: 3907-3918Google Scholar) has described an alternatively spliced FGFR isoform that encodes a truncated, kinase-defective receptor which can heterodimerize with full-length FGFRs and reduce tyrosine kinase activity. Clearly, alternative splicing represents an important mechanism by which FGFR activity can be regulated. FGFs induce differentiation of mesoderm in Xenopus embryonic tissue(6Slack J.M.W. Darlington B.G. Heath J.K. Godsave S.F. Nature. 1987; 326: 197-200Google Scholar, 7Paterno G.D. Gillespie L.L. Dixon M.S. Slack J.M.W. Heath J.K. Development (Camb.). 1989; 106: 79-83Google Scholar, 8Isaacs H.V. Tannahill D. Slack J.M.W. Development (Camb.). 1992; 114: 711-720Google Scholar), and FGFR signaling has been shown to be required for this developmental event(9Amaya E. Musci T.J. Kirschner M.W. Cell. 1991; 66: 257-270Google Scholar). Mesoderm induction during embryonic development is precisely regulated in time and space to produce a distinct pattern of mesodermal tissues. In order to investigate the molecular mechanisms involved in regulating this complex developmental process, it is important initially to determine which FGFR genes are involved and how FGFR signaling is regulated. Evidence to date suggests that FGFR1 is likely to be important, since both mRNA (10Musci T.J. Amaya E. Kirschner M.W. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 8365-8369Google Scholar, 11Friesel R. Dawid I. Mol. Cell. Biol. 1991; 11: 2481-2488Google Scholar) and protein (12Ryan P.J. Gillespie L.L. Dev. Biol. 1994; 166: 101-111Google Scholar) for FGFR1 are present in Xenopus blastulae, the stage during which mesoderm induction takes place in the embryo. In addition, we have demonstrated that FGFR1 was activated during FGF-induced mesoderm differentiation in Xenopus(12Ryan P.J. Gillespie L.L. Dev. Biol. 1994; 166: 101-111Google Scholar). Consequently, we decided to focus on the FGFR1 gene and determine which FGFR1 isoforms may be important for mesoderm induction. Two reports have described FGFR1s cloned from Xenopus, however, neither isolated cDNA from embryos. Musci et al.(10Musci T.J. Amaya E. Kirschner M.W. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 8365-8369Google Scholar) cloned a three-Ig domain FGFR1 from an oocyte library, whereas Friesel and Dawid (11Friesel R. Dawid I. Mol. Cell. Biol. 1991; 11: 2481-2488Google Scholar) cloned both two- and three-Ig forms from a Xenopus cell line (XTC). Accordingly, we prepared and screened a cDNA library from Xenopus blastulae for FGFR1 species. This paper describes a Xenopus FGFR1 isoform which differs in its ability to be regulated by protein kinase C (PKC). Xenopus laevis were purchased from Nasco and maintained as described in (13Wu M. Gerhart J. Methods Cell Biol. 1991; 36: 3-17Google Scholar). Eggs were artificially inseminated, the jelly coats removed, and the embryos cultured as described in Godsave et al.(14Godsave S.F. Isaacs H. Slack J.M.W. Development (Camb.). 1988; 102: 555-566Google Scholar). Synthetic peptides corresponding to FGFR-VT+ (IPLRRQVTVSGDSS) and FGFR-VT- (IPLRRQVSGDSS) were purchased from the Alberta Peptide Institute (Edmonton, Alberta). Recombinant Xenopus bFGF was expressed and purified according to Kimelman et al.(15Kimelman D. Abraham J.A. Haaparanta T. Palisi T.M. Kirschner M.W. Science. 1988; 242: 1053-1056Google Scholar) then stored at −20°C. The anti-FGFR1 used for immunoprecipitation in this study was a polyclonal antibody raised against a synthetic COOH-terminal peptide (12Ryan P.J. Gillespie L.L. Dev. Biol. 1994; 166: 101-111Google Scholar). A cDNA library was constructed from mRNA isolated from stage 8 Xenopus blastulae using the λ ZAP II kit (Stratagene) as directed. The library was screened using a 400-bp fragment of the Xenopus FGFR1 cDNA previously cloned by PCR. 2L. L. Gillespie, unpublished data. This 400-bp fragment was amplified from Xenopus stage 17 first strand cDNA using oligonucleotide primers within the FGFR1 tyrosine kinase domain. The 400-bp amplification product was then cloned in the EcoRV site of Bluescript KS+ and sequenced on both strands, verifying its identity as a fragment of the Xenopus FGFR1. The 400-bp fragment was radiolabeled by random primer labeling (Life Technologies, Inc.) to a specific activity of 5 × 108 cpm/μg. This probe was used to screen 1.5 × 106 recombinant plaques, as described in Wahl and Berger(16Wahl G.M. Berger S.L. Methods Enzymol. 1987; 152: 415-423Google Scholar). Twelve positive plaques were isolated and the largest of these contained a 3.8-kb insert which was further characterized. The cDNA sequence for both strands of the 3.8-kb insert was determined by the dideoxy chain termination method (17Sanger F. Nicklen S. Coulson A.R. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 5463-5467Google Scholar) using the Sequenase system (U. S. Biochemical Corp.). A 1.2-kb genomic fragment containing the VT region was amplified from a Xenopus genomic library (Stratagene). The amplification was performed with oligonucleotide primers 5′(GGGCTGCTTTTGTGTCCGCAAT) and 3′(GCCATGACTACTTGCC) bracketing the VT region (see Fig. 1 for location of primers), for 30 cycles consisting of denaturation at 94°C for 1 min, annealing at 50°C for 1 min and extension at 72°C for 2 min. PCR products were separated on 1% agarose, the 1.2-kb band cut out and the DNA extracted from the agarose gel with Qiaex (Qiagen) according to the manufacturer's directions. Sequencing was performed as above, using the PCR primers. RNA was extracted and purified from whole embryos using the LiCl/urea protocol described in Goldin (18Goldin A.L. Methods Cell Biol. 1991; 36: 487-509Google Scholar). RNase protections were performed as in Paterno et al.(7Paterno G.D. Gillespie L.L. Dixon M.S. Slack J.M.W. Heath J.K. Development (Camb.). 1989; 106: 79-83Google Scholar). The RNA antisense probe was prepared from a BstEII-HgaI cDNA fragment of XFGFR-A2 (gift from Dr. Robert Friesel, American Red Cross) cloned into the EcoRV site of pBluescript KS+ (Stratagene). Transcription from the T7 promoter yielded a 261-base probe which protected a fragment of 162 bases for the VT+ isoform and two fragments of 107 and 49 bases for the VT- isoform. Phosphorylation by PKC of both the peptides (see “Materials” for sequence) and full-length FGFR1 protein was measured using a PKC assay kit (Life Technologies, Inc.), 15 ng of purified PKC enzyme (Upstate Biotechnology, Inc.), and 10 μCi [γ-32P]ATP (Amersham Corp.) per reaction. The FGFR1 proteins used in this assay were synthesized in vitro from the FGFR-VT-pcDNAIneo or FGFR-VT+pcDNAIneo plasmids (plasmid construction described below) using a coupled transcription/translation system (Promega) as described in Ryan and Gillespie(12Ryan P.J. Gillespie L.L. Dev. Biol. 1994; 166: 101-111Google Scholar). The assays were performed according the manufacturer's directions with the exception that the 5 × substrate solution supplied with the kit was replaced with one lacking the control peptide substrate. The substrate was then added separately to each reaction: 25 μM peptide or in vitro synthesized FGFR1-VT- or -VT+ protein that had been purified by immunoprecipitation from equal inputs of trichloroacetic acid-precipitable counts/min. The control substrate was a gift from Dr. J. Reynolds (Memorial University) and consisted of a synthetic peptide (CNPLLRMFSFKAPT) corresponding to amino acids 336-348 of the γ2L subunit of the γ-aminobutyric acid receptor, which contains a Ser that is phosphorylated by PKC(19Whiting P. Mckernan R.M. Iversen L.L. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 9966-9970Google Scholar). PKA phosphorylation assays were performed using 115 ng of PKA (Upstate Biotechnology, Inc.), 25 μM peptide, 10 μCi of [γ-32P]ATP in a buffer containing 20 mM Tris, pH 7.5, 1 mM EGTA, 5 mM MgCl2, and 200 μM ATP. The control substrate was a 9-amino acid synthetic peptide (GRTGRRNSI) purchased from Upstate Biotechnology, Inc. An FGFR-VT- receptor construct lacking both 5′- and 3′-untranslated regions was generated by subcloning a BseAI-RcaI cDNA fragment (Fig. 1), which encodes most of the open reading frame (amino acids 3-789) of the FGFR-VT- cDNA, into the same sites of a pcDNAIneo mammalian expression vector containing the FGFR-A2 cDNA. The FGFR-A2pcDNAIneo plasmid contains the coding region of an FGFR1 isoform lacking the first Ig domain (11Friesel R. Dawid I. Mol. Cell. Biol. 1991; 11: 2481-2488Google Scholar) inserted into the BamHI site of pcDNAIneo (Invitrogen). The FGFR-VT+ receptor construct was generated by subcloning a BstEII-RcaI cDNA fragment (Fig. 1) of the FGFR-A2pcDNAIneo, encoding the transmembrane and intracellular domains, into the same sites of FGFR-VT-pcDNAIneo plasmid. The FGFRSP64T constructs used for expression in Xenopus oocytes were generated by subcloning a BamHI fragment, containing the entire FGFR coding region, from the FGFR-VT-pcDNAIneo or FGFR-VT+pcDNAIneo constructs in the BglII site of the SP64T vector(20Kreig P.A. Melton D.A. Nucleic Acids Res. 1984; 12: 7057-7070Google Scholar). cRNA was transcribed using the SP6 Ribomax system (Promega) from the FGFRSP64T constructs (described above) that had been linearized with XbaI. 4.6 nl containing 500 pg of cRNA was microinjected into stage VI Xenopus oocytes prepared and cultured as described in Amaya et al.(9Amaya E. Musci T.J. Kirschner M.W. Cell. 1991; 66: 257-270Google Scholar). Injected oocytes were metabolically labeled by culturing for 24 h at 22°C in medium containing 1 mCi/ml [35S]methionine (1000 Ci/mmol; DuPont NEN). After extensive washing, the oocytes were solubilized and the FGFR immunoprecipitated as described in Ryan and Gillespie(12Ryan P.J. Gillespie L.L. Dev. Biol. 1994; 166: 101-111Google Scholar). The immunoprecipitates were analyzed by 8% SDS-polyacrylamide gel electrophoresis followed by autoradiography. Microinjected oocytes were maintained at 22°C for 24 h, washed extensively in Ca2+-free medium, then loaded for 3 h with 45Ca2+ (10 Ci/g; DuPont NEN) at a final concentration of 100 μCi/ml. 45Ca2+ release was measured from groups of 10 oocytes as described in Amaya et al.(9Amaya E. Musci T.J. Kirschner M.W. Cell. 1991; 66: 257-270Google Scholar). Phorbol 12-myristate 13-acetate (PMA; Life Technologies, Inc.) and Xenopus bFGF were added at the indicated times to a final concentration of 250 nM and 100 ng/ml, respectively. Mesoderm induction takes place during blastula stages of Xenopus development. In our efforts to understand the role of the FGFR in this induction event, we set out to identify FGFR1 isoforms that are expressed during blastula stages. We prepared a cDNA library from mid-blastula (stage 8) Xenopus embryos and screened it for FGFR1. A positive plaque containing a 3.8-kb insert was purified and sequenced. The cDNA consisted of an open reading frame of 2.4 kb bracketed by a 183-bp 5′-untranslated region and 1.3-kb 3′-untranslated region. The amino acid of our clone was compared with previously cloned Xenopus FGFR1s: XFGFR (10Musci T.J. Amaya E. Kirschner M.W. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 8365-8369Google Scholar) and XFGFR-A2 (11Friesel R. Dawid I. Mol. Cell. Biol. 1991; 11: 2481-2488Google Scholar) (Fig. 1). Our clone and XFGFR encode FGFRs containing three Ig domains in the extracellular region while XFGFR-A2 contains only two; this is a common variation of the FGFR1 that has been extensively studied in other species (reviewed in (3Jaye M. Schlessinger J. Dionne C.A. Biochim. Biophys. Acta. 1992; 1135: 185-199Google Scholar)). Our clone was most similar to XFGFR-A2 in the remaining sequence, with only four amino acid changes as opposed to eight for XFGFR. Examination of these amino acid changes revealed one common difference between our clone and the other two: the deletion of Val423-Thr424 (VT) in the juxtamembrane region of our FGFR1 cDNA. We have therefore named our clone FGFR-VT-. To investigate the possibility that this deletion is generated by alternative splicing, we sequenced a genomic fragment containing the VT region (Fig. 2). By comparing the genomic DNA sequence to the cDNA sequence, the amino acid sequence and 5′ and 3′ consensus splice sequences (5′: (C/A)AG/GU(G/A)AG; 3′: ((C/U))nNCAG/G; reviewed in (21Green M. Annu. Rev. Cell Biol. 1991; 7: 559-599Google Scholar) and (22Horowitz D.S. Krainer A.R. Trends Genet. 1994; 10: 100-106Google Scholar)), we were able to examine a number of possible origins for these two isoforms, including alternative exons and alternative 5′ and/or 3′ splice sites. We concluded that the most likely mechanism for the production of the two receptor forms is the use of alternative 5′ splice donor sites (Fig. 2). Splicing to produce FGFR-VT- would make use of an excellent consensus 5′ splice donor site, whereas the splice site to produce FGFR-A2 or XFGFR lacks three of the eight consensus nucleotides. Therefore, one would predict that the major splicing product would be FGFR-VT- mRNA. Interestingly, RNase protection of total RNA from embryos at various developmental stages revealed that in fact VT+ mRNA was the major form (Fig. 3). In addition, there appeared to be little change in ratio of the VT+/VT- isoforms at the developmental stages examined.Figure 3:RNase protection of total RNA isolated from various stages of Xenopus embryonic development. A 32P-labeled 261-base probe corresponding to sequence of the VT+ isoform and spanning the VT region was used in RNase protection assays of total RNA isolated from embryos at various development stages. Digestion of probe:VT+ hybrids resulted in a 162-bp protected fragment while digestion of probe:VT- hybrids resulted in digestion of the six nucleotide single strand loop encoding the VT, producing two protected fragments of 107 and 49 bp. Thus, the two FGFR1 isoforms could be distinguished in the same sample. Lane a, probe; lane b, digested probe; lane c, in vitro transcribed FGFR-VT+ cRNA; lane d, in vitro transcribed FGFR-VT- cRNA; lanes e-l, total RNA isolated from the following developmental stages: stage 1, fertilized egg; stage 2, 2-cell; stage 6, 32-cell; stage 8, mid-blastula; stage 10, gastrula; stage 16, neurula; stage 24, tailbud; and stage 41, tadpole. The positions of the undigested probe and the VT+ and VT- protected fragments are indicated.View Large Image Figure ViewerDownload (PPT) A similar deletion of Thr-Val was reported for a FGFR1 cDNA cloned from a human hepatoma cell line(23Hou J. Kan M. McKeehan K. McBride G. Adams P. McKeehan W.L. Science. 1991; 251: 665-668Google Scholar). These authors suggested that this location may represent a possible site for phosphorylation by a Ser/Thr kinase. Comparison with consensus sequences for various Ser/Thr kinases (24Kennelly P.J. Krebs E.G. J. Biol. Chem. 1991; 266: 15555-15558Google Scholar) revealed that amino acid position 424 was located within a consensus sequence for phosphorylation by PKC and PKA; in FGFR-VT-, a Ser is in this position, whereas in the VT+ isoform, a Thr is in this location. We decided to examine whether this Ser or Thr could be phosphorylated by PKC or PKA. Two peptides, corresponding to amino acids 417-428 of FGFR-VT- or amino acids 417-430 of the VT+ isoform, were synthesized and used in in vitro kinase assays. As can be seen in Fig. 4A, neither peptide was phosphorylated by PKA. PKC, on the other hand, selectively phosphorylated the VT+ peptide. We also examined the ability of PKC to phosphorylate the full-length proteins. For this purpose, we constructed an FGFR1 that contains 3 Ig domains and Val423-Thr424, thus differing from FGFR-VT- only by the presence of Val423-Thr424. We refer to this construct as FGFR-VT+. The substrates in this PKC assay were FGFR-VT- or FGFR-VT+ protein isolated by immunoprecipitation from in vitro transcription/translation reactions. Both proteins were phosphorylated by PKC (Fig. 4B); however, twice as much [32P]PO4 was incorporated into FGFR-VT+. This demonstrates that the full-length proteins were substrates for PKC and that presence of the VT increased the degree of phosphorylation. The fact that FGFR-VT- protein, but not the peptide, was phosphorylated by PKC suggests that there are additional phosphorylation sites in the protein. One of the questions that remained was whether differential phosphorylation of these two isoforms by PKC affects receptor function. To examine this question, we measured mobilization of intracellular Ca2+ stimulated by FGF in oocytes expressing either form of the FGFR1. Mobilization of intracellular Ca2+, as measured by 45Ca2+ efflux from oocytes, is commonly employed as a functional assay of FGFR activity(9Amaya E. Musci T.J. Kirschner M.W. Cell. 1991; 66: 257-270Google Scholar, 10Musci T.J. Amaya E. Kirschner M.W. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 8365-8369Google Scholar, 25Ueno H. Gunn M. Dell K. Tseng Jr., A. Williams L. J. Biol. Chem. 1992; 267: 1470-1476Google Scholar). Xenopus oocytes were microinjected with H2O (control) or mRNA encoding either FGFR-VT+ or FGFR-VT-. After a 24-h incubation period to allow for expression of FGFR protein, oocytes were loaded with 45Ca2+ in calcium-free medium. 45Ca2+ release into the medium was measured in response to addition of 100 ng/ml Xenopus bFGF (XbFGF) to oocytes; parallel samples were pretreated for 20 min with 250 nM PMA, a phorbol ester that activates PKC, before addition of XbFGF. H2O-injected oocytes showed no response to XbFGF (Fig. 5A). Oocytes expressing either FGFR isoform exhibited a similar response to XbFGF treatment alone but not when stimulated with XbFGF in the presence of PMA (Fig. 5, B and C). Pretreatment with PMA resulted in a slight reduction in the magnitude of the 45Ca2+ release by oocytes expressing FGFR-VT- (Fig. 5B), whereas the 45Ca2+ release by oocytes expressing FGFR-VT+ was significantly reduced (Fig. 5C). To verify that, in these experiments, the oocytes expressed equal amounts of FGFR-VT- or VT+ protein, FGFRs were immunoprecipitated from oocytes labeled with [35S]methionine and the precipitates analyzed by SDS-polyacrylamide gel electrophoresis. The inset in Fig. 5C shows that there was no difference in the synthesis of VT- and VT+ FGFR proteins. FGFs are known to mediate a number of diverse and complex cellular responses (reviewed in (1Baird A. Klagsburn M. The Fibroblast Growth Factor Family. The New York Academy of Sciences, New York1991Google Scholar)). The existence of nine different FGFs, four FGFR genes with a number of alternative spliced forms may in part explain the pleiotropic effects of the FGF family. Thus, it will be important to investigate the biological activity of the different FGFR gene products, in response to different FGF members, in order to elucidate the signal transduction pathways leading to these varied responses. We have isolated an FGFR1 cDNA from Xenopus blastulae that differs from previously cloned Xenopus FGFR1s by a Val-Thr deletion in the juxtamembrane region. Although similar isoforms have been cloned from a human hepatoma cell line (23Hou J. Kan M. McKeehan K. McBride G. Adams P. McKeehan W.L. Science. 1991; 251: 665-668Google Scholar) and from rat brain(26Yazaki N. Fujita H. Ohta M. Kawasaki T. Itoh N. Biochim. Biophys. Acta. 1993; 1172: 37-42Google Scholar), their biological activity was not characterized. We show here that Thr424 can be phosphorylated by PKC and in an in vivo functional assay, we demonstrate that the biological activity of the FGFR1 containing this Thr was significantly reduced by activation of PKC. Our data shows that, as in the human FGFR1 gene(27Johnson D.E. Lu J. Chen H. Werner S. Williams L.T. Mol. Cell. Biol. 1991; 11: 4627-4634Google Scholar), the nucleotides encoding the Val-Thr are located at an exon-intron boundary, indicating that this isoform is generated by the use of an alternative 5′ splice site. Both FGFR-VT- and -VT+ mRNA were expressed in Xenopus embryos at various stages of development and contrary to what one would predict from comparison to 5′ splice site consensus sequences, FGFR-VT- was the minor form. However, it has been suggested that identity of consensus sequences at the 5′ splice site is not the sole determinant in site selection but that there must be other sequence elements or factors that contribute to the choice of 5′ splice site(22Horowitz D.S. Krainer A.R. Trends Genet. 1994; 10: 100-106Google Scholar). We have shown that Thr424 can be phosphorylated by PKC. In the VT- peptide, a Ser is in position 424, but was not a substrate for PKC. Since PKC requires basic residues in the −3 to +3 region of the phosphoacceptor site(24Kennelly P.J. Krebs E.G. J. Biol. Chem. 1991; 266: 15555-15558Google Scholar), one possible explanation for this discrepancy is the presence of an acidic residue (Asp) in the +2 position. Alternatively, deletion of Val-Thr may change the secondary structure in this region, modifying recognition by PKC. Members of the FGF family induce mesoderm differentiation in explanted tissue from Xenopus embryos (6Slack J.M.W. Darlington B.G. Heath J.K. Godsave S.F. Nature. 1987; 326: 197-200Google Scholar, 7Paterno G.D. Gillespie L.L. Dixon M.S. Slack J.M.W. Heath J.K. Development (Camb.). 1989; 106: 79-83Google Scholar, 8Isaacs H.V. Tannahill D. Slack J.M.W. Development (Camb.). 1992; 114: 711-720Google Scholar) and are thought to play a role in mesodermal patterning in the developing embryo. Convincing evidence for this comes from experiments with a dominant negative mutant construct of the FGFR1 which inhibited wild-type receptor activity(9Amaya E. Musci T.J. Kirschner M.W. Cell. 1991; 66: 257-270Google Scholar). These authors showed that expression of mutant FGFR1 in Xenopus embryos resulted in deficiencies in organized mesodermal tissue, suggesting a specific role for FGF in differentiation of presumptive mesodermal tissue. However, FGFRs are present on the surface of all cells in the embryo during blastula stages(28Gillespie L.L. Paterno G.D. Slack J.M.W. Development (Camb.). 1989; 106: 203-208Google Scholar), making it was unclear how FGF induction might be limited to presumptive mesoderm. In further studies, we demonstrated that PKC was activated during mesoderm induction by FGF in explants(29Gillespie L.L. Paterno G.D. Mahadevan L.C. Slack J.M.W. Mech. Dev. 1992; 38: 99-108Google Scholar). Our data suggested that PKC was involved in the negative regulation of FGFR activity, since pretreatment of explants with PMA inhibited FGF induction in this tissue. These data suggest there may be an autocrine regulation of FGFR activity whose extent may depend upon the proportion of VT+ and VT- forms expressed by individual cells or tissues. Certainly, the tissue-specific expression pattern of the two isoforms in the adult rat suggests that the VT- isoform plays an important role in mediating FGF responses in the brain(26Yazaki N. Fujita H. Ohta M. Kawasaki T. Itoh N. Biochim. Biophys. Acta. 1993; 1172: 37-42Google Scholar). Although we observed no change in the temporal expression pattern of mRNA encoding the two isoforms in the whole embryo, differential expression may occur over shorter time periods than those examined or FGFR-VT- mRNA may be selectively expressed in a subpopulation of cells within the embryo. We are currently investigating which FGFR1 isoforms are expressed in different tissues of the Xenopus blastula and determining the biological role of these two isoforms in the developing embryo. We thank Langtuo Deng for technical assistance." @default.
• W2056519857 created "2016-06-24" @default.
• W2056519857 creator A5045067652 @default.
• W2056519857 creator A5047654654 @default.
• W2056519857 creator A5068701513 @default.
• W2056519857 date "1995-09-01" @default.
• W2056519857 modified "2023-09-28" @default.
• W2056519857 title "Cloning of a Fibroblast Growth Factor Receptor 1 Splice Variant from Xenopus Embryos That Lacks a Protein Kinase C Site Important for the Regulation of Receptor Activity" @default.
• W2056519857 cites W1153033785 @default.
• W2056519857 cites W1439772343 @default.
• W2056519857 cites W1504478980 @default.
• W2056519857 cites W1538827891 @default.
• W2056519857 cites W1964629878 @default.
• W2056519857 cites W1965918354 @default.
• W2056519857 cites W2003632139 @default.
• W2056519857 cites W2014664965 @default.
• W2056519857 cites W2019582933 @default.
• W2056519857 cites W2020693389 @default.
• W2056519857 cites W2029508452 @default.
• W2056519857 cites W2064864270 @default.
• W2056519857 cites W2067601118 @default.
• W2056519857 cites W2086103921 @default.
• W2056519857 cites W2088775512 @default.
• W2056519857 cites W2091630371 @default.
• W2056519857 cites W2125423296 @default.
• W2056519857 cites W2132978049 @default.
• W2056519857 cites W2138270253 @default.
• W2056519857 cites W2183471011 @default.
• W2056519857 cites W2184413574 @default.
• W2056519857 cites W2303985294 @default.
• W2056519857 cites W2461527720 @default.
• W2056519857 cites W28739571 @default.
• W2056519857 cites W4213381917 @default.
• W2056519857 doi "https://doi.org/10.1074/jbc.270.39.22758" @default.
• W2056519857 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/7559402" @default.
• W2056519857 hasPublicationYear "1995" @default.
• W2056519857 type Work @default.
• W2056519857 sameAs 2056519857 @default.
• W2056519857 citedByCount "33" @default.
• W2056519857 countsByYear W20565198572015 @default.
• W2056519857 crossrefType "journal-article" @default.
• W2056519857 hasAuthorship W2056519857A5045067652 @default.
• W2056519857 hasAuthorship W2056519857A5047654654 @default.
• W2056519857 hasAuthorship W2056519857A5068701513 @default.
• W2056519857 hasBestOaLocation W20565198571 @default.
• W2056519857 hasConcept C104317684 @default.
• W2056519857 hasConcept C121050878 @default.
• W2056519857 hasConcept C144174609 @default.
• W2056519857 hasConcept C147708747 @default.
• W2056519857 hasConcept C153911025 @default.
• W2056519857 hasConcept C170493617 @default.
• W2056519857 hasConcept C199360897 @default.
• W2056519857 hasConcept C2775960820 @default.
• W2056519857 hasConcept C2779535977 @default.
• W2056519857 hasConcept C2780989783 @default.
• W2056519857 hasConcept C41008148 @default.
• W2056519857 hasConcept C50044444 @default.
• W2056519857 hasConcept C54355233 @default.
• W2056519857 hasConcept C66400584 @default.
• W2056519857 hasConcept C74373430 @default.
• W2056519857 hasConcept C82867764 @default.
• W2056519857 hasConcept C86803240 @default.
• W2056519857 hasConcept C95444343 @default.
• W2056519857 hasConceptScore W2056519857C104317684 @default.
• W2056519857 hasConceptScore W2056519857C121050878 @default.
• W2056519857 hasConceptScore W2056519857C144174609 @default.
• W2056519857 hasConceptScore W2056519857C147708747 @default.
• W2056519857 hasConceptScore W2056519857C153911025 @default.
• W2056519857 hasConceptScore W2056519857C170493617 @default.
• W2056519857 hasConceptScore W2056519857C199360897 @default.
• W2056519857 hasConceptScore W2056519857C2775960820 @default.
• W2056519857 hasConceptScore W2056519857C2779535977 @default.
• W2056519857 hasConceptScore W2056519857C2780989783 @default.
• W2056519857 hasConceptScore W2056519857C41008148 @default.
• W2056519857 hasConceptScore W2056519857C50044444 @default.
• W2056519857 hasConceptScore W2056519857C54355233 @default.
• W2056519857 hasConceptScore W2056519857C66400584 @default.
• W2056519857 hasConceptScore W2056519857C74373430 @default.
• W2056519857 hasConceptScore W2056519857C82867764 @default.
• W2056519857 hasConceptScore W2056519857C86803240 @default.
• W2056519857 hasConceptScore W2056519857C95444343 @default.
• W2056519857 hasIssue "39" @default.
• W2056519857 hasLocation W20565198571 @default.
• W2056519857 hasOpenAccess W2056519857 @default.
• W2056519857 hasPrimaryLocation W20565198571 @default.
• W2056519857 hasRelatedWork W127170646 @default.
• W2056519857 hasRelatedWork W1923539252 @default.
• W2056519857 hasRelatedWork W1979761296 @default.
• W2056519857 hasRelatedWork W1983337938 @default.
• W2056519857 hasRelatedWork W1991202673 @default.
• W2056519857 hasRelatedWork W2068782312 @default.
• W2056519857 hasRelatedWork W2090040908 @default.
• W2056519857 hasRelatedWork W2135949891 @default.
• W2056519857 hasRelatedWork W2396683970 @default.
• W2056519857 hasRelatedWork W4252735339 @default.
• W2056519857 hasVolume "270" @default.
• W2056519857 isParatext "false" @default.
• W2056519857 isRetracted "false" @default.

• next