SemOpenAlex |

SemOpenAlex

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2056527670> ?p ?o ?g. }

Showing items 1 to 100 of ±148 with 100 items per page.

W2056527670 endingPage "14901" @default.
W2056527670 startingPage "14893" @default.
W2056527670 abstract "The protein tyrosine kinase Pyk2 acts as an upstream regulator of mitogen-activated protein (MAP) kinase cascades in response to numerous extracellular signals. The precise molecular mechanisms by which Pyk2 activates distinct MAP kinase pathways are not yet fully understood. In this report, we provide evidence that the protein tyrosine kinase Src and adaptor proteins Grb2, Crk, and p130Cas act as downstream mediators of Pyk2 leading to the activation of extracellular signal-regulated kinase (ERK) and c-Jun amino-terminal kinase (JNK). Pyk2-induced activation of Src is necessary for phosphorylation of Shc and p130Cas and their association with Grb2 and Crk, respectively, and for the activation of ERK and JNK cascades. Expression of a Grb2 mutant with a deletion of the amino-terminal Src homology 3 domain or the carboxyl-terminal tail of Sos strongly reduced Pyk2-induced ERK activation, with no apparent effect on JNK activity. Grb2 with a deleted carboxyl-terminal Src homology 3 domain partially blocked Pyk2-induced ERK and JNK pathways, whereas expression of dominant interfering mutants of p130Cas or Crk specifically inhibited JNK but not ERK activation by Pyk2. Taken together, our data reveal specific pathways that couple Pyk2 with MAP kinases: the Grb2/Sos complex connects Pyk2 to the activation of ERK, whereas adaptor proteins p130Cas and Crk link Pyk2 with the JNK pathway. The protein tyrosine kinase Pyk2 acts as an upstream regulator of mitogen-activated protein (MAP) kinase cascades in response to numerous extracellular signals. The precise molecular mechanisms by which Pyk2 activates distinct MAP kinase pathways are not yet fully understood. In this report, we provide evidence that the protein tyrosine kinase Src and adaptor proteins Grb2, Crk, and p130Cas act as downstream mediators of Pyk2 leading to the activation of extracellular signal-regulated kinase (ERK) and c-Jun amino-terminal kinase (JNK). Pyk2-induced activation of Src is necessary for phosphorylation of Shc and p130Cas and their association with Grb2 and Crk, respectively, and for the activation of ERK and JNK cascades. Expression of a Grb2 mutant with a deletion of the amino-terminal Src homology 3 domain or the carboxyl-terminal tail of Sos strongly reduced Pyk2-induced ERK activation, with no apparent effect on JNK activity. Grb2 with a deleted carboxyl-terminal Src homology 3 domain partially blocked Pyk2-induced ERK and JNK pathways, whereas expression of dominant interfering mutants of p130Cas or Crk specifically inhibited JNK but not ERK activation by Pyk2. Taken together, our data reveal specific pathways that couple Pyk2 with MAP kinases: the Grb2/Sos complex connects Pyk2 to the activation of ERK, whereas adaptor proteins p130Cas and Crk link Pyk2 with the JNK pathway. The MAP 1The abbreviations used are: MAP, mitogen-activated protein; ERK, extracellular signal-regulated kinase; JNK, c-Jun amino-terminal kinase; GEF, guanine nucleotide exchange factor; FAK, focal adhesion kinase; GST, glutathioneS-transferase; MBP, myelin basic protein; HA, hemagglutinin antigen; PKM, Pyk2 kinase inactive mutant; PAGE, polyacrylamide gel electrophoresis; SH, Src homology; Sos-CT, carboxyl-terminal tail of sos. kinase family comprises three distinct kinases: extracellular signal-regulated kinase (ERK), c-Jun amino-terminal kinase/stress-activated protein kinase (JNK/SAPK), and p38 MAP kinase (1Robinson M.J. Cobb M.H. Curr. Opin. Cell Biol. 1997; 9: 180-186Crossref PubMed Scopus (2286) Google Scholar). MAP kinases have been implicated in the regulation of several fundamental cellular processes by transmitting extracellular signals from the cell membrane to the nucleus (1Robinson M.J. Cobb M.H. Curr. Opin. Cell Biol. 1997; 9: 180-186Crossref PubMed Scopus (2286) Google Scholar, 2Marshall C.J. Cell. 1995; 80: 179-185Abstract Full Text PDF PubMed Scopus (4236) Google Scholar, 3Karin M. J. Biol. Chem. 1995; 270: 16483-16486Abstract Full Text Full Text PDF PubMed Scopus (2256) Google Scholar). Different MAP kinases are activated by signaling pathways composed of small GTPases and cytoplasmic kinase cascades (1Robinson M.J. Cobb M.H. Curr. Opin. Cell Biol. 1997; 9: 180-186Crossref PubMed Scopus (2286) Google Scholar). Key components of the ERK pathway include the small GTPase Ras, the serine/threonine kinase Raf, and MAP kinase kinase (Mek), which phosphorylates and activates ERK (4Schlessinger J. Trends Biochem. Sci. 1993; 18: 273-275Abstract Full Text PDF PubMed Scopus (343) Google Scholar). The JNK pathway is composed of the Rho-related GTPases Rac and Cdc42 and a cytoplasmic kinase cascade in which Mek4 phosphorylates and activates JNK (5Davis R.J. J. Biol. Chem. 1993; 268: 14553-14556Abstract Full Text PDF PubMed Google Scholar, 6Kyriakis J.M. Avruch J. J. Biol. Chem. 1996; 271: 24313-24316Abstract Full Text Full Text PDF PubMed Scopus (1025) Google Scholar). Activated ERK and JNK phosphorylate transcription factors in the nucleus, leading to the modulation of gene expression (7Treisman R. Curr. Opin. Cell Biol. 1996; 8: 205-215Crossref PubMed Scopus (1163) Google Scholar). In most cases, the rate-limiting step in activation of the ERK and JNK pathways is the conversion of small GTPases from the inactive GDP-bound state to their active GTP-bound form (8Polakis P. McCormick F. J. Biol. Chem. 1993; 268: 9157-9160Abstract Full Text PDF PubMed Google Scholar, 9Cerione R.A. Zheng Y. Curr. Opin. Cell Biol. 1996; 8: 216-222Crossref PubMed Scopus (466) Google Scholar). The GDP/GTP exchange is modulated by guanine nucleotide exchange factors (GEFs), which promote formation of the GTP-bound form, and by GTPase activating proteins (GAPs), which stimulate the rate of intrinsic GTP hydrolysis of G-proteins (8Polakis P. McCormick F. J. Biol. Chem. 1993; 268: 9157-9160Abstract Full Text PDF PubMed Google Scholar). Many GEFs for Ras and Rho-like GTPases identified in mammalian cells are bound to adaptor proteins, such as Grb2, Crk, or Nck (4Schlessinger J. Trends Biochem. Sci. 1993; 18: 273-275Abstract Full Text PDF PubMed Scopus (343) Google Scholar, 8Polakis P. McCormick F. J. Biol. Chem. 1993; 268: 9157-9160Abstract Full Text PDF PubMed Google Scholar, 9Cerione R.A. Zheng Y. Curr. Opin. Cell Biol. 1996; 8: 216-222Crossref PubMed Scopus (466) Google Scholar, 10Pawson T. Scott J.D. Science. 1997; 278: 2075-2080Crossref PubMed Scopus (1900) Google Scholar). These adaptor proteins are composed of a SH2 domain and of one or more SH3 domains (10Pawson T. Scott J.D. Science. 1997; 278: 2075-2080Crossref PubMed Scopus (1900) Google Scholar). Upon cell stimulation, the SH2 domains of Grb2, Crk, and Nck bind to tyrosine-phosphorylated docking proteins, such as Shc, IRS-1, Frs2, Gab-1, or p130Cas, or directly to protein receptor tyrosine kinases (4Schlessinger J. Trends Biochem. Sci. 1993; 18: 273-275Abstract Full Text PDF PubMed Scopus (343) Google Scholar, 10Pawson T. Scott J.D. Science. 1997; 278: 2075-2080Crossref PubMed Scopus (1900) Google Scholar). Thereby, the adaptor protein/GEF complex is translocated to the plasma membrane, where GEFs catalyze the GDP/GTP exchange and activate membrane-bound GTPases (4Schlessinger J. Trends Biochem. Sci. 1993; 18: 273-275Abstract Full Text PDF PubMed Scopus (343) Google Scholar, 10Pawson T. Scott J.D. Science. 1997; 278: 2075-2080Crossref PubMed Scopus (1900) Google Scholar). The proline-rich tyrosine kinase (Pyk2) and focal adhesion kinase (FAK) constitute a distinct family of nonreceptor protein tyrosine kinases that are regulated by a variety of extracellular stimuli (11Neet K. Hunter T. Genes Cells. 1996; 1: 147-169Crossref PubMed Scopus (125) Google Scholar). Pyk2 is predominantly expressed in the central nervous system and cells derived from hematopoietic lineages, whereas its alternatively spliced isoform (Pyk2-H) is specifically expressed in T and B lymphocytes, monocytes, and natural killer cells (12Lev S. Moreno H. Martinez R. Canoll P. Peles E. Musacchio J.M. Plowman G.D. Rudy B. Schlessinger J. Nature. 1995; 376: 737-745Crossref PubMed Scopus (1253) Google Scholar, 13Dikic I. Dikic I. Schlessinger J. J. Biol. Chem. 1998; 273: 14301-14308Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). Pyk2 was implicated in signaling by G protein-coupled receptors, nicotinic acetylcholine receptors, stress stimuli, and membrane depolarization in neuronal cells (12Lev S. Moreno H. Martinez R. Canoll P. Peles E. Musacchio J.M. Plowman G.D. Rudy B. Schlessinger J. Nature. 1995; 376: 737-745Crossref PubMed Scopus (1253) Google Scholar, 14Dikic I. Tokiwa G. Lev S. Courtneidge S.A. Schlessinger J. Nature. 1996; 383: 547-550Crossref PubMed Scopus (879) Google Scholar, 15Siciliano J.C. Toutant M. Derkinderen P. Sasaki T. Girault J.A. J. Biol. Chem. 1996; 271: 28942-28946Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar, 16Tokiwa G. Dikic I. Lev S. Schlessinger J. Science. 1996; 273: 792-794Crossref PubMed Scopus (285) Google Scholar). In hematopoietic cells, Pyk2 and Pyk2-H are activated by the inflammatory cytokine tumor necrosis factor α, stimulation of T and B lymphocyte antigen, integrin, interleukin-2, FcRI, and chemokine receptors (13Dikic I. Dikic I. Schlessinger J. J. Biol. Chem. 1998; 273: 14301-14308Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar,16Tokiwa G. Dikic I. Lev S. Schlessinger J. Science. 1996; 273: 792-794Crossref PubMed Scopus (285) Google Scholar, 17Avraham S. London R. Fu Y. Ota S. Hiregowdara D. Li Y. Jiang S. Pasztor L.M. White R.A. Groopman J.E. Avraham H. J. Biol. Chem. 1995; 270: 27742-27751Abstract Full Text Full Text PDF PubMed Scopus (325) Google Scholar, 18Ganju R.K. Hatch W.C. Avraham H. Ona M.A. Druker B. Avraham S. Groopman J.E. J. Exp. Med. 1997; 185: 1055-1064Crossref PubMed Scopus (94) Google Scholar, 19Qian D. Lev S. van Oers N.S.C. Dikic I. Schlessinger J. Weiss A. J. Exp. Med. 1997; 185: 1253-1259Crossref PubMed Scopus (151) Google Scholar, 20Gismondi A. Bisogno L. Mainiero F. Palmieri G. Piccoli M. Frati L. Santoni A. J. Immunol. 1997; 159: 3364-3372PubMed Google Scholar, 21Raja S. Avraham S. Avraham H. J. Biol. Chem. 1997; 272: 10941-10947Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar, 22Davis C. Dikic I. Unutmaz D. Hill C.M. Arthos J. Siani M. Thompson D.A. Schlessinger J. Littman D.R. J. Exp. Med. 1997; 186: 1793-1798Crossref PubMed Scopus (344) Google Scholar, 23Miyazaki T. Takaoka A. Noqueira L. Dikic I. Fujii H. Tsujino S. Mitani Y. Maeda M. Schlessinger J. Taniguchi T. Genes Dev. 1998; 12: 770-775Crossref PubMed Scopus (67) Google Scholar, 24Astier A. Manie S.N. Avraham H. Hirai H. Law S.F. Zhang Y. Golemis E.A. Fu Y. Druker B.J. Haghayeghi N. Freedman A.S. Avraham S. J. Biol. Chem. 1997; 272: 19719-19724Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar, 25Li X. Hunter D. Morris J. Haskill J.S. Earp H.S. J. Biol. Chem. 1998; 273: 9361-9364Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar, 26Okazaki H. Zhang J. Hamawy M.M. Siraganian R.P. J. Biol. Chem. 1997; 272: 32443-32447Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Interactions of Pyk2 with Src family kinases, the Grb2/Sos complex, p130Cas, paxillin, Hic-5, and Graf were reported to regulate intracellular signaling as well as cytoskeletal and morphological changes of cells (12Lev S. Moreno H. Martinez R. Canoll P. Peles E. Musacchio J.M. Plowman G.D. Rudy B. Schlessinger J. Nature. 1995; 376: 737-745Crossref PubMed Scopus (1253) Google Scholar, 14Dikic I. Tokiwa G. Lev S. Courtneidge S.A. Schlessinger J. Nature. 1996; 383: 547-550Crossref PubMed Scopus (879) Google Scholar, 18Ganju R.K. Hatch W.C. Avraham H. Ona M.A. Druker B. Avraham S. Groopman J.E. J. Exp. Med. 1997; 185: 1055-1064Crossref PubMed Scopus (94) Google Scholar, 19Qian D. Lev S. van Oers N.S.C. Dikic I. Schlessinger J. Weiss A. J. Exp. Med. 1997; 185: 1253-1259Crossref PubMed Scopus (151) Google Scholar, 20Gismondi A. Bisogno L. Mainiero F. Palmieri G. Piccoli M. Frati L. Santoni A. J. Immunol. 1997; 159: 3364-3372PubMed Google Scholar, 27Salgia R. Avraham S. Pisick E. Li J.-L. Raja S. Greenfield E.A. Sattler M. Avraham H. Griffin J.D. J. Biol. Chem. 1996; 271: 31222-31226Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar, 28Ohba T. Ishino M. Aoto H. Sasaki T. Biochem. J. 1998; 330: 1249-1254Crossref PubMed Scopus (62) Google Scholar, 29Matsuya M. Sasaki H. Aoto H. Mitaka T. Nagura K. Ohba T. Ishino M. Takahashi S. Suzuki R. Sasaki T. J. Biol. Chem. 1998; 273: 1003-1014Abstract Full Text Full Text PDF PubMed Scopus (116) Google Scholar). In addition, several reports have shown that activation of Pyk2 is necessary for the activation of ERK and/or JNK in different cell lines and in response to diverse stimuli (12Lev S. Moreno H. Martinez R. Canoll P. Peles E. Musacchio J.M. Plowman G.D. Rudy B. Schlessinger J. Nature. 1995; 376: 737-745Crossref PubMed Scopus (1253) Google Scholar, 14Dikic I. Tokiwa G. Lev S. Courtneidge S.A. Schlessinger J. Nature. 1996; 383: 547-550Crossref PubMed Scopus (879) Google Scholar, 16Tokiwa G. Dikic I. Lev S. Schlessinger J. Science. 1996; 273: 792-794Crossref PubMed Scopus (285) Google Scholar, 30Hatch W.C. Ganju R.K. Hiregowdara D. Avraham S. Groopman J.E. Blood. 1998; 91: 3967-3973Crossref PubMed Google Scholar, 31Yu H. Li X. Marchetto G.S. Dy R. Hunter D. Calvo B. Dawson T.L. Wilm M. Anderegg R.J. Graves L.M. Earp H.S. J. Biol. Chem. 1996; 271: 29993-29998Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar, 32Della Rocca G.J. van Biesen T. Daaka Y. Luttrell D.K. Luttrell L.M. Lefkowitz R.J. J. Biol. Chem. 1997; 272: 19125-19132Abstract Full Text Full Text PDF PubMed Scopus (414) Google Scholar, 33Ganju R.K. Dutt P. Wu L. Newman W. Avraham H. Avraham S. Groopman J.E. Blood. 1998; 91: 791-797Crossref PubMed Google Scholar). For example, Pyk2 is required for activation of the JNK pathway but not for ERK in response to angiotensin II or chemokine receptors (31Yu H. Li X. Marchetto G.S. Dy R. Hunter D. Calvo B. Dawson T.L. Wilm M. Anderegg R.J. Graves L.M. Earp H.S. J. Biol. Chem. 1996; 271: 29993-29998Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar, 33Ganju R.K. Dutt P. Wu L. Newman W. Avraham H. Avraham S. Groopman J.E. Blood. 1998; 91: 791-797Crossref PubMed Google Scholar). In PC12 cells, Pyk2 appears to link bradykinin and lysophosphatidic acid receptors with ERK (12Lev S. Moreno H. Martinez R. Canoll P. Peles E. Musacchio J.M. Plowman G.D. Rudy B. Schlessinger J. Nature. 1995; 376: 737-745Crossref PubMed Scopus (1253) Google Scholar, 14Dikic I. Tokiwa G. Lev S. Courtneidge S.A. Schlessinger J. Nature. 1996; 383: 547-550Crossref PubMed Scopus (879) Google Scholar) and stress stimuli with the activation of JNK (16Tokiwa G. Dikic I. Lev S. Schlessinger J. Science. 1996; 273: 792-794Crossref PubMed Scopus (285) Google Scholar). However, the molecular mechanisms by which Pyk2 transmits extracellular signals to specific MAP kinase signaling networks that control diverse cell responses are only partially understood. In this report, we show that Src acts in concert with Grb2/Sos and p130Cas/Crk complexes to mediate Pyk2-induced activation of specific MAP kinase cascades. All tissue culture media and antibiotics were obtained from Life Technologies and Sigma. LipofectAMINE was purchased from Life Technologies. Poly(Glu-Tyr) 4:1 and all other chemicals were from Sigma. Aprotinin, leupeptin, and BM chemiluminescence blotting substrate (POD) were obtained from Roche Molecular Biochemicals. Pefabloc SC was obtained from Fluka. Rainbow protein marker, horseradish peroxidase coupled anti-mouse IgG and [32P]ATP were from Amersham, whereas horseradish peroxidase-labeled protein A was from Kirkegaard & Perry Laboratories. NitroBind nitrocellulose transfer membrane were from Micron Separations, and protein A-Sepharose 4B was from Zymed Laboratories Inc. Human embryonic kidney 293T cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, penicillin (50 units/ml), and streptomycin (50 μg/ml). Expression vectors for hemagglutinin antigen (HA) epitope-tagged ERK2 and JNK1 were kindly provided by C. Marshall (Institute of Cancer Research, London, United Kingdom) and M. Karin, (University of California, San Diego, CA), respectively. Expression vector containing Src kinase inactive mutant (pSGTcSrcK−) was kindly provided by S. Courtneidge (SUGEN, Inc.). The carboxyl-terminal tail of Sos (Sos-CT), Grb2-ΔNSH3 (deletion of N-SH3 mutant) and Grb2-ΔCSH3 (deletion of C-SH3 mutant) cloned in pCGN were kindly provided by M. Gischitzky (SUGEN Inc., San Francisco, CA), pSSRα-Crk-SH2 m (Crk SH2 R38V mutant), and pSSRα-p130CasΔSD (a deletion of 213–514 amino acids) are described elsewhere (34Dolfi F. Garzia-Guzman M. Ojaniemi M. Nakamura H. Matsuda M. Vuori K. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 15394-15399Crossref PubMed Scopus (158) Google Scholar, 35Klemke R.L. Leng J. Molander R. Brooks P.C. Vuori K. Cheresh D.A. J. Cell Biol. 1998; 140: 961-972Crossref PubMed Scopus (591) Google Scholar, 36Matsuda M. Tanaka S. Nagata S. Kojima A. Kurata T. Shibuya M. Mol. Cell. Biol. 1992; 12: 3482-3489Crossref PubMed Scopus (247) Google Scholar, 37Nakamoto T. Sakai R. Ozawa K. Yazaki Y. Hirai H. J. Biol. Chem. 1996; 271: 8959-8965Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar). Expression vectors containing FLAG-tagged paxillin (pCMV-Paxillin) and a paxillin triple mutant Y31F/Y118F/Y187F, which is unable to bind to Crk (pCMV-Pax Y31F/Y118F/Y187F), were provided by F. Giancotti (Memorial Sloan-Kettering Cancer Center). Wild type Pyk2, Y402F mutant, and kinase inactive mutant (PKM) of human Pyk2 cloned in pRK5 have been described previously (14Dikic I. Tokiwa G. Lev S. Courtneidge S.A. Schlessinger J. Nature. 1996; 383: 547-550Crossref PubMed Scopus (879) Google Scholar). The mutagenic oligonucleotide (GAGTCAGACATTCTTCGCAGAGATTCC) and the transoligonucleotide (GAATTCGATATCACGCGTTGGCCGCCATGGC) were used to convert tyrosine 881 to phenylalanine in pRK5-Pyk2 or pRK5-Pyk2-Y402F using the in vitro mutagenesis kit from CLONTECH. The mutation was confirmed by DNA sequencing. For transient transfections, 293T cells were grown on 6-well tissue culture plates in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. When the cells had reached 50% confluence, the medium was changed to serum-free Dulbecco's modified Eagle's medium, and the cells were incubated with expression vectors containing indicated cDNAs. After 6 h, an equal volume of 20% fetal calf serum/Dulbecco's modified Eagle's medium was added and cells were grown for an additional 40 h. Empty expression vector was added when necessary to equalize the total amount of DNA transfected to 2 μg per well. Cells were lysed in Triton lysis buffer (50 mm Hepes, pH 7.5, 150 mm NaCl, 1% Triton X-100, 10% glycerol, 1.5 mm MgCl2, 1 mm EDTA, 0.2 mm EGTA, 1 mm sodium orthovanadate, 20 mm NaF, 1 mm Pefabloc SC, 10 μg/ml aprotinin, and 5 μg/ml leupeptin). Cell lysates were cleared by centrifugation at 13,000 × g for 15 min at 4 °C, and total protein concentrations were determined by use of the Bradford protein assay (Bio-Rad). Equal amounts of lysates were subjected to immunoprecipitation with the indicated antibodies. Anti-Pyk2 (number 600) and anti-Grb2 (50Wu X. Knudsen B. Feller S. Zheng J. Sali A. Cowburn D. Hanafusa H. Kuriyan J. Structure. 1995; 3: 215-226Abstract Full Text Full Text PDF PubMed Scopus (218) Google Scholar) antibodies were cross-linked to protein A beads (Zymed Laboratories Inc.) with dimethylpimelimidate (Pierce) as described (13Dikic I. Dikic I. Schlessinger J. J. Biol. Chem. 1998; 273: 14301-14308Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). After 2 h, the beads were pelleted and washed three times with lysis buffer and once with phosphate-buffered saline. SDS gel loading buffer was added, the mixture was heated to 98 °C for 2 min, and proteins were resolved by SDS-PAGE. For immunoblot analysis, proteins were transferred to nitrocellulose transfer membrane using a wet transfer unit from Bio-Rad. After blocking in Tris-buffered saline (150 mmNaCl, 20 mm Tris-HCl, pH 7.7) supplemented with 5% bovine serum albumin, the filters were incubated with the appropriate antibodies for 1–2 h, washed several times with Tris-buffered saline containing 0.05% Triton X-100, and incubated with horseradish peroxidase-coupled anti-mouse IgG or protein A. The antibody-antigen complexes were visualized by a chemiluminescence detection system (Roche Molecular Biochemicals). To reprobe blots, they were incubated in stripping buffer (62.5 mm Tris-HCl, pH 6.7, 2% SDS, and 100 mm 2-mercaptoethanol) at 58 °C for 25 min, washed extensively with Tris-buffered saline, reblocked as described above, and reblotted with the appropriate antibodies. To determine Src activity lysates of transfected 293T cells were subjected to immunoprecipitation with anti-Src (Ab-1) antibodies and analyzed by immunoblotting with anti-Tyr(P)-416Src antibodies that recognize activated Src. Src kinase activity was quantified as an increase in Tyr(P)-416Src phosphorylation as described previously (14Dikic I. Tokiwa G. Lev S. Courtneidge S.A. Schlessinger J. Nature. 1996; 383: 547-550Crossref PubMed Scopus (879) Google Scholar). Polyclonal rabbit anti-Pyk2 antisera (600) and (623) were described previously (13Dikic I. Dikic I. Schlessinger J. J. Biol. Chem. 1998; 273: 14301-14308Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). Polyclonal antibodies against p130Cas (N-17) and ERK2 (C-14) were obtained from Santa Cruz Biotechnology, and mouse monoclonal anti-p130Cas (P27820) and anti-Crk (C12620) antibodies were from Transduction Laboratories. Rabbit polyclonal anti-Crk antibodies (336) were generated against a carboxyl-terminal peptide of Crk. Anti-HA tag antibodies (12CA5) were purchased from Roche Molecular Biochemicals, anti-FLAG tag antibodies (M2) were purchased from Kodak, anti-Src (Ab-1) antibodies were purchased from Oncogene Sciences and affinity purified anti-Tyr(P)-416Src antibodies were kindly provided by A. Laudano (University of New Hampshire). Mouse monoclonal anti-phosphotyrosine antibodies (4G10) were obtained from C. Davis (New York University) and rabbit polyclonal anti-phosphotyrosine antibodies (72) were used as described previously (13Dikic I. Dikic I. Schlessinger J. J. Biol. Chem. 1998; 273: 14301-14308Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). Affinity-purified antibodies against activated ERK were kindly provided by L. Rönnstrand (Ludwig Institute for Cancer Research, Uppsala, Sweden). The use of polyclonal antisera to Grb2 (50, 86 and 327) and Shc (410) was described previously (38Dikic I. Batzer A.G. Blaikie P. Obermeier A. Ullrich A. Schlessinger J. Margolis B. J. Biol. Chem. 1995; 270: 15125-15129Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). For exogenous substrate phosphorylation, equal amounts of lysates from transfected 293T cells were subjected to immunoprecipitations with antisera against Pyk2 (600). Immunoprecipitates were washed three times with lysis buffer and once with kinase buffer (50 mm Tris-HCl, pH 7.5, 5 mm MnCl2, 5 mm MgCl2). One-half of the immunoprecipitates was analyzed by SDS-PAGE and immunoblotting with anti-Pyk2 antibodies (623), whereas the other half was incubated with 50 μl of kinase buffer supplemented with 20 μg of poly(Glu-Tyr) (4:1), 20 μm of ATP including 5 μCi of [32P]ATP for 10 min at room temperature. The reaction was stopped by addition of 25 μl of SDS sample buffer, boiled for 2 min, and products were resolved by 7% SDS-PAGE. The increase in phosphorylation of poly(Glu-Tyr) was determined by quantitation with a bioimaging analyzer (Fuji BAS2000). To measure ERK2 kinase activity, polyclonal anti-ERK2 antibodies or anti-HA tag antibodies were used to precipitate ERK2 or HA-ERK2 from total cell lysates. Precipitates were washed three times with lysis buffer and twice with reaction buffer (10 mm Tris-HCl, pH 7.4, 10 mm MgCl2). Myelin basic protein (MBP) (10 μg) was added to each immunoprecipitate as a substrate and kinase reactions (total volume, ∼30 μl) were initiated by addition of an ATP mix (final concentration, 200 μm ATP, including 1 μCi of [32P]ATP), incubated at room temperature for 20 min, and stopped by the addition of 20 μl of SDS sample buffer. The phosphorylated MBP was resolved by 12% SDS-PAGE, and gels were cut at the 30-kDa marker band. To assess equal kinase loads the upper part of gels was analyzed by immunoblotting with anti-ERK2 or anti-HA antibodies, and the lower part containing the phosphorylated substrate was visualized by autoradiography. The amount of 32P incorporated into MBP was quantified using a PhosphoImager. JNK activities were determined by in vitro kinase reactions using glutathione S-transferase (GST) c-Jun (1–79) fusion proteins as described previously (16Tokiwa G. Dikic I. Lev S. Schlessinger J. Science. 1996; 273: 792-794Crossref PubMed Scopus (285) Google Scholar, 34Dolfi F. Garzia-Guzman M. Ojaniemi M. Nakamura H. Matsuda M. Vuori K. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 15394-15399Crossref PubMed Scopus (158) Google Scholar). Briefly, lysates of cells transfected with HA-tagged JNK expression vector were incubated for 2 h on ice with polyclonal anti-HA antibodies. Immune complexes were collected on 30 μl of protein A-Sepharose beads for 30 min. The beads were washed three times with lysis buffer and twice with reaction buffer (40 mm HEPES, pH 7.5, 10 mmMgCl2, 1 mm dithiothreitol) and assayed for phosphorylation of GST-c-Jun (1–79) in a final volume of 30 μl with 100 μm ATP and 2.5 μCi of [32P]ATP. After 20 min at 30 °C the reaction was stopped by the addition of SDS sample buffer. Following SDS-PAGE, the amount of 32P incorporated in GST-c-Jun (1–79) was determined by PhosphoImager analysis. HA-JNK expression levels were checked by anti-HA Western blotting of immune complexes, and the level of GST-c-Jun (1–79) substrate in each lane was visualized by Coomassie Blue staining. To investigate the signaling pathways responsible for Pyk2-induced activation of MAP kinases, we generated a series of expression vectors encoding for Pyk2 mutants (Fig. 1A). We first compared abilities of Pyk2, Pyk2-Y402F (tyrosine 402, the major autophosphorylation site and direct binding site for the Src SH2 domain, was mutated to phenylalanine), Pyk2-Y881F (tyrosine 881, a putative Grb2 binding site, was changed to phenylalanine), double mutant Pyk2-Y402F/Y881F and PKM to induce Src activation and tyrosine phosphorylation of proteins in human embryonic kidney 293T cells. Expression of Pyk2 or Pyk2-Y881F increased the phosphotyrosine content of cellular proteins and strongly activated endogenous Src proteins, whereas Pyk2-Y402F and Pyk2-Y402F/Y881F were severely impaired (to more than 90%) in their ability to undergo autophosphorylation, activate Src, and phosphorylate other cellular proteins (Fig. 1, Band C). PKM was completely unable to activate Src or to induce any tyrosine phosphorylation of cellular proteins (Fig. 1,B and C). In order to further analyze the enzymatic properties of different Pyk2 mutants, we compared theirin vitro kinase activities, measured by phosphorylation of the substrate poly(Glu-Tyr). Pyk2 and Pyk2-Y881F exhibited similar catalytic activities, whereas Pyk2-Y402F and Pyk2-Y402F/Y881F had decreased activities (15–35%) as compared with the wild type enzyme (Fig. 1D). The observed decrease in catalytic activitiesin vitro of these mutants could not account for the major reduction in their ability to phosphorylate cellular proteins in vivo (compare Fig. 1D to Fig. 1B). The fact that Pyk2-Y402F and Pyk2-Y402F/Y881F are unable to activate Src (Fig. 1C) indicates that activation of Src kinases by binding to Tyr-402 of Pyk2 plays a critical role in mediating Pyk2-induced phosphorylation of cellular proteins. We were further interested to identify cellular proteins that link Pyk2 with the activation of MAP kinases. Pyk2 was suggested to activate ERK by directly binding the Grb2/Sos complex or indirectly via Grb2 binding to tyrosine-phosphorylated Shc proteins (12Lev S. Moreno H. Martinez R. Canoll P. Peles E. Musacchio J.M. Plowman G.D. Rudy B. Schlessinger J. Nature. 1995; 376: 737-745Crossref PubMed Scopus (1253) Google Scholar, 14Dikic I. Tokiwa G. Lev S. Courtneidge S.A. Schlessinger J. Nature. 1996; 383: 547-550Crossref PubMed Scopus (879) Google Scholar, 39Felsch J.S. Cachero T.G. Peralta E.G. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5051-5056Crossref PubMed Scopus (95) Google Scholar). We therefore analyzed the ability of different Pyk2 mutants expressed in 293T cells to interact with Grb2. Expression of wild type Pyk2 or Pyk2-Y881F mutant induced phosphorylation of Shc and its association with Grb2 (Fig. 2A), whereas expression of Pyk2-Y402F, Pyk2-Y402F/Y881F, or PKM did not lead to any significant increase in tyrosine phosphorylation of Shc or its association with Grb2 (Fig. 2A). In parallel, the same cell lysates were subjected to immunoprecipitation with anti-Pyk2 and anti-Grb2 antibodies and analyzed by immunoblotting with respective antibodies. Wild type Pyk2 was associated with Grb2, whereas mutation of Tyr-881 to phenylalanine in Pyk2 led to a complete loss of its ability to co-precipitate with Grb2 (Fig. 2B), confirming that Tyr-881 of Pyk2 serves as a direct binding site for Grb2. We also found that Pyk2-Y402F, Pyk2-Y402F/Y881F, and PKM were not able to bind and co-precipitate Grb2 (Fig. 2B). In addition, when Pyk2 was co-transfected with the increasing amounts of a Src kinase inactive mutant (SrcK−), the ability of Pyk2 to bind Grb2 was significantly reduced (Fig. 2C). These data, together with previous findin" @default.
W2056527670 created "2016-06-24" @default.
W2056527670 creator A5031944912 @default.
W2056527670 creator A5039053618 @default.
W2056527670 creator A5050558417 @default.
W2056527670 creator A5075162680 @default.
W2056527670 creator A5082730369 @default.
W2056527670 creator A5086979668 @default.
W2056527670 creator A5087573858 @default.
W2056527670 date "1999-05-01" @default.
W2056527670 modified "2023-10-18" @default.
W2056527670 title "Adaptor Proteins Grb2 and Crk Couple Pyk2 with Activation of Specific Mitogen-activated Protein Kinase Cascades" @default.
W2056527670 cites W1573713409 @default.
W2056527670 cites W1573821584 @default.
W2056527670 cites W1594427045 @default.
W2056527670 cites W1598998194 @default.
W2056527670 cites W161910285 @default.
W2056527670 cites W1849793110 @default.
W2056527670 cites W1900495018 @default.
W2056527670 cites W1966732663 @default.
W2056527670 cites W1972172786 @default.
W2056527670 cites W1978568961 @default.
W2056527670 cites W1988893103 @default.
W2056527670 cites W1994572080 @default.
W2056527670 cites W1994926193 @default.
W2056527670 cites W1995819749 @default.
W2056527670 cites W1999788892 @default.
W2056527670 cites W2007925179 @default.
W2056527670 cites W2008725579 @default.
W2056527670 cites W2014914858 @default.
W2056527670 cites W2021296418 @default.
W2056527670 cites W2022495919 @default.
W2056527670 cites W2022697474 @default.
W2056527670 cites W2029462030 @default.
W2056527670 cites W2034569034 @default.
W2056527670 cites W2034586348 @default.
W2056527670 cites W2034752841 @default.
W2056527670 cites W2042578530 @default.
W2056527670 cites W2047263793 @default.
W2056527670 cites W2054711697 @default.
W2056527670 cites W2055276390 @default.
W2056527670 cites W2058778918 @default.
W2056527670 cites W2060474677 @default.
W2056527670 cites W2066497238 @default.
W2056527670 cites W2072906264 @default.
W2056527670 cites W2075104267 @default.
W2056527670 cites W2076649773 @default.
W2056527670 cites W2076897294 @default.
W2056527670 cites W2079051863 @default.
W2056527670 cites W2079252365 @default.
W2056527670 cites W2085299854 @default.
W2056527670 cites W2088129765 @default.
W2056527670 cites W2089694131 @default.
W2056527670 cites W2090389412 @default.
W2056527670 cites W2095152292 @default.
W2056527670 cites W2100807457 @default.
W2056527670 cites W2104353597 @default.
W2056527670 cites W2104539756 @default.
W2056527670 cites W2105356859 @default.
W2056527670 cites W2105512558 @default.
W2056527670 cites W2107164894 @default.
W2056527670 cites W2108824104 @default.
W2056527670 cites W2113420540 @default.
W2056527670 cites W2118030635 @default.
W2056527670 cites W2118897660 @default.
W2056527670 cites W2119228709 @default.
W2056527670 cites W2125816390 @default.
W2056527670 cites W2135114842 @default.
W2056527670 cites W2140370407 @default.
W2056527670 cites W2143167773 @default.
W2056527670 cites W2152396103 @default.
W2056527670 cites W2153390050 @default.
W2056527670 cites W2159220993 @default.
W2056527670 cites W2162784878 @default.
W2056527670 cites W2164682544 @default.
W2056527670 cites W2329305567 @default.
W2056527670 cites W2403167169 @default.
W2056527670 cites W2410899564 @default.
W2056527670 cites W95879741 @default.
W2056527670 doi "https://doi.org/10.1074/jbc.274.21.14893" @default.
W2056527670 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10329689" @default.
W2056527670 hasPublicationYear "1999" @default.
W2056527670 type Work @default.
W2056527670 sameAs 2056527670 @default.
W2056527670 citedByCount "201" @default.
W2056527670 countsByYear W20565276702012 @default.
W2056527670 countsByYear W20565276702013 @default.
W2056527670 countsByYear W20565276702014 @default.
W2056527670 countsByYear W20565276702015 @default.
W2056527670 countsByYear W20565276702016 @default.
W2056527670 countsByYear W20565276702018 @default.
W2056527670 countsByYear W20565276702019 @default.
W2056527670 countsByYear W20565276702020 @default.
W2056527670 countsByYear W20565276702021 @default.
W2056527670 countsByYear W20565276702022 @default.
W2056527670 countsByYear W20565276702023 @default.
W2056527670 crossrefType "journal-article" @default.
W2056527670 hasAuthorship W2056527670A5031944912 @default.