FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2057486527> ?p ?o ?g. }

• W2057486527 endingPage "33844" @default.
• W2057486527 startingPage "33831" @default.
• W2057486527 abstract "The 70-kDa peroxisomal membrane protein (PMP70) is a major component of peroxisomal membranes. Human PMP70 consists of 659 amino acid residues and has six putative transmembrane domains (TMDs). PMP70 is synthesized on cytoplasmic ribosomes and targeted posttranslationally to peroxisomes by an unidentified peroxisomal membrane protein targeting signal (mPTS). In this study, to examine the mPTS within PMP70 precisely, we expressed various COOH-terminally or NH2-terminally deleted constructs of PMP70 fused with green fluorescent protein (GFP) in Chinese hamster ovary cells and determined their intracellular localization by immunofluorescence. In the COOH-terminally truncated PMP70, PMP70(AA.1-144)-GFP, including TMD1 and TMD2 of PMP70, was still localized to peroxisomes. However, by further removal of TMD2, PMP70(AA.1-124)-GFP lost the targeting ability, and PMP70(TMD2)-GFP did not target to peroxisomes by itself. The substitution of TMD2 in PMP70(AA.1-144)-GFP for TMD4 or TMD6 did not affect the peroxisomal localization, suggesting that PMP70(AA.1-124) contains the mPTS and an additional TMD is required for the insertion into the peroxisomal membrane. In the NH2-terminal 124-amino acid region, PMP70 possesses hydrophobic segments in the region adjacent to TMD1. By the disruption of these hydrophobic motifs by the mutation of L21Q/L22Q/L23Q or I70N/L71Q, PMP70(AA.1-144)-GFP lost targeting efficiency. The NH2-terminally truncated PMP70, GFP-PMP70(AA.263-375), including TMD5 and TMD6, exhibited the peroxisomal localization. PMP70(AA.263-375) also possesses hydrophobic residues (Ile307/Leu308) in the region adjacent to TMD5, which were important for targeting. These results suggest that PMP70 possesses two distinct targeting signals, and hydrophobic regions adjacent to the first TMD of each region are important for targeting. The 70-kDa peroxisomal membrane protein (PMP70) is a major component of peroxisomal membranes. Human PMP70 consists of 659 amino acid residues and has six putative transmembrane domains (TMDs). PMP70 is synthesized on cytoplasmic ribosomes and targeted posttranslationally to peroxisomes by an unidentified peroxisomal membrane protein targeting signal (mPTS). In this study, to examine the mPTS within PMP70 precisely, we expressed various COOH-terminally or NH2-terminally deleted constructs of PMP70 fused with green fluorescent protein (GFP) in Chinese hamster ovary cells and determined their intracellular localization by immunofluorescence. In the COOH-terminally truncated PMP70, PMP70(AA.1-144)-GFP, including TMD1 and TMD2 of PMP70, was still localized to peroxisomes. However, by further removal of TMD2, PMP70(AA.1-124)-GFP lost the targeting ability, and PMP70(TMD2)-GFP did not target to peroxisomes by itself. The substitution of TMD2 in PMP70(AA.1-144)-GFP for TMD4 or TMD6 did not affect the peroxisomal localization, suggesting that PMP70(AA.1-124) contains the mPTS and an additional TMD is required for the insertion into the peroxisomal membrane. In the NH2-terminal 124-amino acid region, PMP70 possesses hydrophobic segments in the region adjacent to TMD1. By the disruption of these hydrophobic motifs by the mutation of L21Q/L22Q/L23Q or I70N/L71Q, PMP70(AA.1-144)-GFP lost targeting efficiency. The NH2-terminally truncated PMP70, GFP-PMP70(AA.263-375), including TMD5 and TMD6, exhibited the peroxisomal localization. PMP70(AA.263-375) also possesses hydrophobic residues (Ile307/Leu308) in the region adjacent to TMD5, which were important for targeting. These results suggest that PMP70 possesses two distinct targeting signals, and hydrophobic regions adjacent to the first TMD of each region are important for targeting. Peroxisomes are organelles surrounded by a single membrane, and they are found in almost all eukaryotic cells. Peroxisomes have many important metabolic functions, including β-oxidation of fatty acids, especially very long-chain fatty acids, and synthesis of ether phospholipids (1Van den Bosch H. Schutgens R.B.H. Wanders R.J.A. Tager J.M. Annu. Rev. Biochem. 1992; 61: 157-197Crossref PubMed Scopus (732) Google Scholar). Therefore, a defect in the biogenesis and function of the organelle causes severe metabolic disease, such as Zellweger syndrome (2Lazarow P.B. Moser H.W. The Metabolic Basis of Inherited Disease. McGraw-Hill Inc, New York1994: 2287-2324Google Scholar, 3Brosius U. Gärtner J. Cell. Mol. Life Sci. 2002; 59: 1058-1069Crossref PubMed Scopus (46) Google Scholar, 4Fujiki Y. FEBS Lett. 2000; 476: 42-46Crossref PubMed Scopus (90) Google Scholar). Peroxisomes are thought to be formed by the division of pre-existing peroxisomes after the import of newly synthesized proteins (5Lazarow P.B. Fujiki Y. Annu. Rev. Cell Biol. 1985; 1: 489-530Crossref PubMed Scopus (876) Google Scholar). Peroxisomal proteins are encoded by nuclear genes, synthesized on cytosolic polysomes, and posttranslationally targeted to the peroxisomes (5Lazarow P.B. Fujiki Y. Annu. Rev. Cell Biol. 1985; 1: 489-530Crossref PubMed Scopus (876) Google Scholar). The import of peroxisomal matrix proteins is gradually becoming well understood. Most matrix proteins are targeted to the peroxisomes by one of two types of a peroxisome targeting signal (PTS). 2The abbreviations used are: PTS, peroxisome targeting signal; ABC, ATP-binding cassette; GFP, green fluorescence protein; mPTS, peroxisomal membrane protein targeting signal; PMP, peroxisomal membrane protein; PMP70, 70-kDa peroxisomal membrane protein; TMD, transmembrane domain; PCC, Peasonʼns correlation coefficient; CHO, Chinese hamster ovary. 2The abbreviations used are: PTS, peroxisome targeting signal; ABC, ATP-binding cassette; GFP, green fluorescence protein; mPTS, peroxisomal membrane protein targeting signal; PMP, peroxisomal membrane protein; PMP70, 70-kDa peroxisomal membrane protein; TMD, transmembrane domain; PCC, Peasonʼns correlation coefficient; CHO, Chinese hamster ovary. PTS1 is a COOH-terminal tripeptide composed of SKL or a conserved sequence and is found in the majority of matrix proteins (6Gould S.J. Keller G.-A. Hosken N. Wilkinson J. Subramani S. J. Cell Biol. 1989; 108: 1657-1664Crossref PubMed Scopus (872) Google Scholar). PTS2 is a cleavable NH2-terminal nonapeptide with the consensus motif (R/K)(L/V/I)X5(H/Q)(L/A) and is found in a few matrix proteins (7Osumi T. Tsukamoto T. Hata S. Yokota S. Miura S. Fujiki Y. Hijikata M. Miyazawa S. Hashimoto T. Biochem. Biophys. Res. Commun. 1991; 181: 947-954Crossref PubMed Scopus (229) Google Scholar, 8Swinkels B.W. Gould S.J. Bodnar A.G. Rachubinski R.A. Subramani S. EMBO J. 1991; 10: 3255-3262Crossref PubMed Scopus (513) Google Scholar). PTS1 and PTS2 are recognized by the specific receptors, Pex5p and Pex7p, respectively (9McCollum D. Monosov E. Subramani S. J. Cell Biol. 1993; 121: 761-774Crossref PubMed Scopus (207) Google Scholar, 10Marzioch M. Erdmann R. Veenhuis M. Kunau W.-H. EMBO J. 1994; 13: 4908-4918Crossref PubMed Scopus (256) Google Scholar). These receptors target the cargo proteins from the cytosol to the docking complex on the peroxisomal membrane (11Albertini M. Rehling P. Erdmann R. Girzalsky W. Kiel J.A.K.W. Veenhuis M. Kunau W.-H. Cell. 1997; 89: 83-92Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar, 12Erdmann R. Blobel G. J. Cell Biol. 1996; 135: 111-121Crossref PubMed Scopus (184) Google Scholar, 13Elgersma Y. Kwast L. Klein A. Voorn-Brouwer T. van den Berg M. Metzig B. America T. Tabak H.F. Distel B. J. Cell Biol. 1996; 135: 97-109Crossref PubMed Scopus (183) Google Scholar, 14Gould S.J. Kalish J.E. Morrell J.C. Bjorkman J. Urquhart A.J. Crane D.I. J. Cell Biol. 1996; 135: 85-95Crossref PubMed Scopus (209) Google Scholar). However, the pathway for proteins to target to the peroxisomal membrane is less well defined. Peroxisomal membrane proteins (PMPs) do not contain a recognizable PTS1 or PTS2 sequence, and they are still imported even in the mutants that are defective for the import of matrix proteins, indicating that the targeting process of PMPs is not dependent on the components of the pathway for matrix protein targeting (15Subramani S. Annu. Rev. Cell Biol. 1993; 9: 445-478Crossref PubMed Scopus (357) Google Scholar, 16Chang C.C. South S. Warren D. Jones J. Moser A.B. Moser H.W. Gould S.J. J. Cell Sci. 1999; 112: 1579-1590Crossref PubMed Google Scholar, 17Hettema E.H. Girzalsky W. van Den Berg M. Erdmann R. Distel B. EMBO J. 2000; 19: 223-233Crossref PubMed Scopus (222) Google Scholar). Recently, Pex3p, Pex16p, and Pex19p have been proposed to be essential for the proper localization and stability of PMPs (18Shimozawa N. Suzuki Y. Zhang Z. Imamura A. Ghaedi K. Fujiki Y. Kondo N. Hum. Mol. Genet. 2000; 9: 1995-1999Crossref PubMed Scopus (59) Google Scholar, 19Muntau A.C. Mayerhofer P.U. Paton B.C. Kammerer S. Roscher A.A. Am. J. Hum. Genet. 2000; 67: 967-975Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 20Matsuzono Y. Kinoshita N. Tamura S. Shimozawa N. Hamasaki M. Ghadi K. Wanders R.J.A. Suzuki Y. Kondo N. Fujiki Y. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 2116-2121Crossref PubMed Scopus (186) Google Scholar, 21Honsho M. Tamura S. Shimozawa N. Suzuki Y. Kondo N. Fujiki Y. Am. J. Hum. Genet. 1998; 63: 1622-1630Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar). Pex19p is localized mostly in the cytosol and binds a broad spectrum of PMPs (22Sacksteder K.A. Jones J.M. South S.T. Li X. Liu Y. Gould S.J. J. Cell Biol. 2000; 148: 931-944Crossref PubMed Scopus (234) Google Scholar, 23Snyder W.B. Koller A. Choy A.J. Subramani S. J. Cell Biol. 2000; 149: 1171-1178Crossref PubMed Scopus (83) Google Scholar, 24Fransen M. Wylin T. Brees C. Mannaerts G.P. Van Veldhoven P.P. Mol. Cell. Biol. 2001; 21: 4413-4424Crossref PubMed Scopus (109) Google Scholar, 25Gloeckner C.J. Mayerhofer P.U. Landgraf P. Muntau A.C. Holzinger A. Gerber J.-K. Kammerer S. Adamski J. Roscher A.A. Biochem. Biophys. Res. Commun. 2000; 271: 144-150Crossref PubMed Scopus (49) Google Scholar, 26Shibata H. Kashiwayama Y. Imanaka T. Kato H. J. Biol. Chem. 2004; 279: 38486-38494Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 27Kashiwayama Y. Asahina K. Shibata H. Morita M. Muntau A.C. Roscher A.A. Wanders R.J.A. Shimozawa N. Sakaguchi M. Kato H. Imanaka T. Biochim. Biophys. Acta. 2005; 1746: 116-128Crossref PubMed Scopus (39) Google Scholar). These observations led us to the hypothesis that Pex19p functions as a recycling targeting signal receptor for PMPs. Indeed, Pex19p-binding regions of multiple PMPs were found to be an integral part of their targeting elements (22Sacksteder K.A. Jones J.M. South S.T. Li X. Liu Y. Gould S.J. J. Cell Biol. 2000; 148: 931-944Crossref PubMed Scopus (234) Google Scholar, 25Gloeckner C.J. Mayerhofer P.U. Landgraf P. Muntau A.C. Holzinger A. Gerber J.-K. Kammerer S. Adamski J. Roscher A.A. Biochem. Biophys. Res. Commun. 2000; 271: 144-150Crossref PubMed Scopus (49) Google Scholar, 28Jones J.M. Morrell J.C. Gould S.J. J. Cell Biol. 2004; 164: 57-67Crossref PubMed Scopus (189) Google Scholar, 29Rottensteiner H. Kramer A. Lorenzen S. Stein K. Landgraf C. Volkmer-Engert R. Erdmann R. Mol. Biol. Cell. 2004; 15: 3406-3417Crossref PubMed Scopus (145) Google Scholar, 30Halbach A. Lorenzen S. Landgraf C. Volkmer-Engert R. Erdmann R. Rottensteiner H. J. Biol. Chem. 2005; 280: 21176-21182Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar, 31Girzalsky W. Hoffmann L.S. Schemenewitz A. Nolte A. Kunau W.H. Erdmann R. J. Biol. Chem. 2006; 281: 19417-19425Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar, 32Halbach A. Landgraf C. Lorenzen S. Rosenkranz K. Volkmer-Engert R. Erdmann R. Rottensteiner H. J. Cell Sci. 2006; 119: 2508-2517Crossref PubMed Scopus (88) Google Scholar). However, other reports have claimed that Pex19p-binding sites of some PMPs were spatially or functionally separated from their peroxisomal sorting regions (23Snyder W.B. Koller A. Choy A.J. Subramani S. J. Cell Biol. 2000; 149: 1171-1178Crossref PubMed Scopus (83) Google Scholar, 24Fransen M. Wylin T. Brees C. Mannaerts G.P. Van Veldhoven P.P. Mol. Cell. Biol. 2001; 21: 4413-4424Crossref PubMed Scopus (109) Google Scholar, 27Kashiwayama Y. Asahina K. Shibata H. Morita M. Muntau A.C. Roscher A.A. Wanders R.J.A. Shimozawa N. Sakaguchi M. Kato H. Imanaka T. Biochim. Biophys. Acta. 2005; 1746: 116-128Crossref PubMed Scopus (39) Google Scholar, 33Vizeacoumar F.J. Vreden W.N. Aitchison J.D. Rachubinski R.A. J. Biol. Chem. 2006; 281: 14805-14812Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar). These results argue against the role of Pex19p as an import receptor for PMPs and assign an alternative, chaperone function for Pex19p that stabilizes newly synthesized PMPs in the targeting process. These discrepancies remain to be resolved, and the precise function of Pex19p is still a matter of debate. The PTS of PMPs, termed mPTS, has yet to be identified. The mPTS was first defined in Candida boidinii PMP47 (34McCammon M.T. McNew J.A. Willy P.J. Goodman J.M. J. Cell Biol. 1994; 124: 915-925Crossref PubMed Scopus (72) Google Scholar). Dyer et al. (35Dyer J.M. McNew J.A. Goodman J.M. J. Cell Biol. 1996; 133: 269-280Crossref PubMed Scopus (145) Google Scholar) reported that the targeting information of PMP47 resides on the matrix-oriented loop between transmembrane domain 4 (TMD4) and TMD5, which is enriched in positively charged amino acids. mPTSs have been determined for several PMPs, including Pex3p, PMP22, and PMP34 (36Baerends R.J.S. Faber K.N. Kram A.M. Kiel J.A.K.W. van der Klei I.J. Veenhuis M. J. Biol. Chem. 2000; 275: 9986-9995Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar, 37Pause B. Saffrich R. Hunziker A. Ansorge W. Just W.W. FEBS Lett. 2000; 471: 23-28Crossref PubMed Scopus (38) Google Scholar, 38Brosius U. Dehmel T. Gärtner J. J. Biol. Chem. 2002; 277: 774-784Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 39Honsho M. Fujiki Y. J. Biol. Chem. 2001; 276: 9375-9382Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar, 40Jones J.M. Morrell J.C. Gould S.J. J. Cell Biol. 2001; 153: 1141-1149Crossref PubMed Scopus (90) Google Scholar). Although no consensus primary amino acid sequences or common structural properties have been delineated, nearly all PMP fragments that can target to peroxisomes contain a cluster of basic amino acids in conjugation with at least one TMD. Interestingly, several PMPs have been shown to contain multiple nonoverlapping mPTSs (38Brosius U. Dehmel T. Gärtner J. J. Biol. Chem. 2002; 277: 774-784Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 40Jones J.M. Morrell J.C. Gould S.J. J. Cell Biol. 2001; 153: 1141-1149Crossref PubMed Scopus (90) Google Scholar, 41Wang X. Unruh M.J. Goodman J.M. J. Biol. Chem. 2001; 276: 10897-10905Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). However, it is still unclear whether these multiple mPTSs reflect the specific properties of PMP targeting. To better understand the molecular mechanisms of peroxisome membrane synthesis and especially the import of human PMPs, we characterized the regions responsible for the targeting of PMP70. PMP70 is one of the major components of mam-malian peroxisomal membranes and belongs to the ATP-binding cassette (ABC) protein superfamily (42Kamijo K. Taketani S. Yokota S. Osumi T. Hashimoto T. J. Biol. Chem. 1990; 265: 4534-4540Abstract Full Text PDF PubMed Google Scholar, 43Imanaka T. Aihara K. Takano T. Yamashita A. Sato R. Suzuki Y. Yokota S. Osumi T. J. Biol. Chem. 1999; 274: 11968-11976Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). It consists of 659 amino acid residues, and the putative topology of PMP70 predicts six transmembrane segments with the NH2 and COOH termini facing the cytoplasm (44Shani N. Valle D. Methods Enzymol. 1998; 292: 753-755Crossref PubMed Scopus (31) Google Scholar). We describe that PMP70 possesses two distinct nonoverlapping targeting signals; one is in PMP70(AA.1-124), and the other is in PMP70(AA.264-375). Furthermore, we found that the hydrophobic segments not containing the positively charged cluster, residing just adjacent to the first TMD of both targeting elements, were important for targeting but not for the binding of Pex19p. Materials—pEGFP-N1 and pEGFP-C3 were purchased from Clontech (Palo Alto, CA). pQE30 and pEU3-NII were from Qiagen (Valencia, CA) and TOYOBO (Osaka, Japan), respectively. PRO-MIX™ l-[35S] in vitro cell labeling mix (70% l-[35S]methionine and 30% l-[35S]cysteine, >37 TBq/mmol) was purchased from Amersham Biosciences. PROTEIOS™, a wheat germ cell-free protein synthesis core kit, was obtained from TOYOBO (Osaka, Japan). Nucleotides, such as ATP, CTP, UTP, and GTP, for mRNA synthesis were obtained from Promega (Madison, WI). The protein G-agarose was from Sigma. Rabbit anti-Living Colors A. v. peptide antibody was obtained from Clontech. Mouse anti-His G antibody was from Invitrogen. Preparation of the antibody against the COOH-terminal 15 amino acids of rat PMP70 is described in Ref. 45Imanaka T. Shiina Y. Takano T. Hashimoto T. Osumi T. J. Biol. Chem. 1996; 271: 3706-3713Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar. The anti-rat liver catalase antibodies were raised in a rabbit (46Yokota S. Fahimi H.D. J. Histochem. Cytochem. 1982; 29: 805-812Crossref Scopus (41) Google Scholar). Construction of PMP70 Expression Plasmids for Subcellular Localization and Immunoprecipitation—pEU3-NII/PMP70(AA.1-659) and expression constructs encoding PMP70(AA.1-659)-GFP and PMP70(AA.1-144)-GFP were prepared as described in Ref. 27Kashiwayama Y. Asahina K. Shibata H. Morita M. Muntau A.C. Roscher A.A. Wanders R.J.A. Shimozawa N. Sakaguchi M. Kato H. Imanaka T. Biochim. Biophys. Acta. 2005; 1746: 116-128Crossref PubMed Scopus (39) Google Scholar. Different NH2- or COOH-terminal truncation mutants of PMP70 were generated by PCR using a full-length human PMP70 cDNA (47Kamijo K. Kamijo N. Ueno I. Osumi T. Hashimoto T. Biochim. Biophys. Acta. 1992; 1129: 323-327Crossref PubMed Scopus (74) Google Scholar) as a template. The oligonucleotide primers used are listed in Table 1. PCR-generated fragments with XhoI or PstI and BamHI restriction sites were subcloned in frame into a pEGFP-N1 expression vector. To construct NH2-terminal GFP fusion proteins, NH2- or COOH-terminally truncated cDNA fragments of PMP70 were amplified from each PMP70-GFP expression vector encoding the corresponding truncated cDNA fragment of PMP70 using the forward primer 5′-AAATGGGCGGTAGGCGTGT-3′, which annealed to a site upstream of the unique PstI site in pEGFP-N1, or 5′-CTCGAGATGGCGGCCTTCAGCAAG-3′, which introduced an XhoI site at the amino terminus, and the reverse primer 5′-CGCTGAACTTGTGGCCGTTTA-3′, which annealed to a site downstream of the unique BamHI site in pEGFP-N1. PCR-generated fragments with PstI or XhoI and BamHI restriction sites were subcloned in frame into a pEGFP-C3 expression vector. To construct PMP70(AA.1-124/TMD4)-GFP and PMP70(AA.1-124/TMD6)-GFP, in which TMD4 or TMD6 of PMP70 was inserted just downstream of PMP70(AA.1-124), the PMP70(AA.1-124) cDNA fragment was generated by PCR using the forward primer 5′-CTCGAGCCGCCATGGCGGCCTT-3′ and the reverse primer 5′-CTGCAGTCTCTTGAAATCTTTCCTGCTACG-3′. PCR-generated fragments with XhoI and PstI restriction sites were subcloned in frame into PMP70(TMD4)-GFP and PMP70(TMD6)-GFP expression vectors. The identity of all subclones was confirmed by semi-automated sequencing on an ABI 310 DNA sequencer (PerkinElmer Life Sciences).TABLE 1Oligonucleotide primer sequences used for the generation of PMP70 deletion mutantsConstruct nameOligonucleotide primer (5′ → 3′)PMP70(AA.1-375)-GFPCTCGAGCCGCCATGGCGGCCTTGGATCCACTATTCGACCCAGAGCTTGAGPMP70(AA.1-324)-GFPCTCGAGCCGCCATGGCGGCCTTGGATCCAGGTATTTGGCAATAATACTATCAATGAAGCCPMP70(AA.1-276)-GFPCTCGAGCCGCCATGGCGGCCTTGGATCCCTGTTTGTGATGAGCCGAGPMP70(AA.1-228)-GFPCTCGAGCCGCCATGGCGGCCTTGGATCCTGAGCTCCAATTGCACTCPMP70(AA.1-124)-GFPCTCGAGCCGCCATGGCGGCCTTGGATCCCTCTTGAAATCTTTCCTGCTACGAPMP70(AA.113-144)-GFPCTGCAGGCCATGGGTATCATTGGTCGTAGCAGGGGATCCTTCAAGAAGTTATTAACCAGAGAGPMP70(AA.224-259)-GFPCTGCAGGCCATGGCAATTGGAGCTCAGGGGGATCCTGCTCAGTTATTGTCATCTTACCAATGPMP70(AA.314-347)-GFPCTGCAGGCCATGGGCTTCATTGATAGTATTATTGCCGGATCCTTGAGATGTCGAGGATGAGACPMP70(AA.113-375)-GFPCTGCAGGCCATGGGTATCATTGGTCGTAGCAGGGGATCCACTATTCGACCCAGAGCTTGAGPMP70(AA.176-375)-GFPCTGCAGGCCATGGGGAATCTGGACAACAGAATAGCGGATCCACTATTCGACCCAGAGCTTGAGPMP70(AA.224-375)-GFPCTGCAGGCCATGGCAATTGGAGCTCAGGGGGATCCACTATTCGACCCAGAGCTTGAGPMP70(AA.263-375)-GFPCTGCAGGCCATGGGAGAATATAGATATGTTAATTCTCGGGGATCCACTATTCGACCCAGAGCTTGAGPMP70(AA.314-375)-GFPCTGCAGGCCATGGGCTTCATTGATAGTATTATTGCCGGATCCACTATTCGACCCAGAGCTTGAGPMP70(AA.113-228)-GFPCTGCAGGCCATGGGTATCATTGGTCGTAGCAGGGGATCCTGAGCTCCAATTGCACTC Open table in a new tab Site-directed Mutagenesis of Conserved Amino Acids and Hydrophobic Amino Acids in the Targeting Elements of PMP70—Site-directed mutagenesis was performed on pEGFP-N1/PMP70(AA.1-659), pEGFP-N1/PMP70(AA.1-144), pEGFP-C3/PMP70(AA.263-375), and pEU3-NII/PMP70(AA.1-659) using a QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturerʼns instructions. Two sets of the oligonucleotide primers used were designed on the basis of their sequences (Table 2). The mutations in the constructions were confirmed by semiautomated sequencing on an ABI 310 DNA sequencer (PerkinElmer Life Sciences).TABLE 2Oligonucleotide primer sequences used for the generation of mutant PMP70 constructsConctruct nameForward primer (5′ → 3′)K28A/R29AGCTCTGCCTGCTCCACGCGGCGCGCCGCGCCCTCGR30A/R31ACCTGCTCCACGCGGCGGCCGCCGCCCTCGGCCTGCACGK38A/K39ACCTCGGCCTGCACGGTGCGGCAAGTGGAAAACCACCATTACP76A/R77ACAGATTCTGAAAATCATGGTCGCTGCAACATTTTGTAAAGAGACAGGK72AGGCTCATACAGATTCTGGCAATCATGGTCGCTGCAACR66AGGACAAGGTGTTTTTCTCAGCGCTCATACAGATTCTGGCK61ACGAGCTGTGGTGGACGCGGTGTTTTTCTCAGCK53A/K54A/R56ACAATGAGAAAGAGGGGGCAGCAGAGGCAGCTGTGGTGGACGCGGK123A/R124AGGTCGTAGCAGGAAAGATTTCGCGGCATACTTACTCAACTTCATCGR119A/K120AGGTATCATTGGTCGTAGCGCGGCAGATTTCGCGGCATACTTACTCR117AGTGGTATCATTGGTGCTAGCGCGGCAGATTTCGCGL21A/L22A/L23AGTGCCGCGTTCGCTGCTGCTTGCCTGCTCCACL21Q/L22Q/L23QGCTGGTGCCGCGTTCCAGCAGCAGTGCCTGCTCCACAAGCI70A/L71ACTCAAGGCTCATACAGGCTGCGAAAATCATGGTCCCTAGAACI70N/L71QCTCAAGGCTCATACAGAATCAGAAAATCATGGTCCCTAGAACI307N/L308QGGTGGAACACCTACATAATTTCAATCAGTTTCGGTTTTCAATGGGC Open table in a new tab Culturing Conditions and Transient Transfection—CHO-K1 cells were cultured in F12K medium (ICN, Aurora, OH) with 10% fetal bovine serum at 37 °C and 5% CO2. 48 h before transfection, 5 × 103 cells were seeded on a Lab-Tek™ Chamber Slide™ system with eight chambers on a glass slide (Nalge Nunc, Rochester, NY). All transfections were performed using an Effectene Transfection Reagent (Qiagen, Valencia, CA) according to the manufacturerʼns instructions. Two days after transfection, the cells were washed three times with phosphate-buffered saline and fixed for 10 min in 5% paraformaldehyde in phosphate-buffered saline for indirect immunofluorescence. Indirect Immunofluorescence—Immunostaining was performed by essentially the same procedure as described in Ref. 7Osumi T. Tsukamoto T. Hata S. Yokota S. Miura S. Fujiki Y. Hijikata M. Miyazawa S. Hashimoto T. Biochem. Biophys. Res. Commun. 1991; 181: 947-954Crossref PubMed Scopus (229) Google Scholar. The fixed cells were permeabilized in 0.1% (w/v) Triton X-100 in phosphate-buffered saline for 10 min, washed twice with phosphate-buffered saline, and incubated with the primary antibodies for 1 h at room temperature. The primary antibodies used in this study were a rabbit antibody against the COOH-terminal 15 amino acids of rat PMP70 (1:200) and a rabbit antibody against rat catalase (1:200). Cy3-conjugated goat anti-rabbit IgG antibody (Amersham Biosciences) was used to label the first antibody. The cells were mounted in 90% glycerol in 100 mm Tris-HCl (pH 8.0), and the samples were examined by confocal microscopy (LSM510; Carl Zeiss, Jene, Germany). To analyze the efficiency of peroxisomal localization, samples were examined by TCS-SP5 software (Leica, Wetzlar, Germany). The per pixel scatter diagrams were generated using the built in software of the Leica TCS-SP5. Peasonʼns correlation coefficient (PCC) and the peroxisome colocalization rate were employed to evaluate colocalization. PCC is one of the standard measures to assess the relationship between fluorescence intensities (48Graf S.A. Haigh S.E. Corson E.D. Shirihai O.S. J. Biol. Chem. 2004; 279: 42954-42963Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Its value ranges between -1.0 and 1.0, where -1.0 represents no overlap and 1.0 represents complete colocalization. The peroxisome colocalization rate was expressed as a ratio of colocalization area showing certain red pixel intensity of peroxisomal marker and certain green pixel intensity of each GFP fusion protein against the area foreground. In a typical experiment, 20 randomly chosen areas containing some of the cells expressing GFP fusion protein were examined for each culture, and each experiment was repeated at least three times. Purification of His-Pex19p—Purification of the NH2-terminal His6-tagged human Pex19p (His-Pex19p) was performed by essentially the same procedure as described in Ref. 27Kashiwayama Y. Asahina K. Shibata H. Morita M. Muntau A.C. Roscher A.A. Wanders R.J.A. Shimozawa N. Sakaguchi M. Kato H. Imanaka T. Biochim. Biophys. Acta. 2005; 1746: 116-128Crossref PubMed Scopus (39) Google Scholar. M15 pREP4 Escherichia coli cells (Qiagen, Valencia, CA) harboring pQE30/PEX19 were grown at 37 °C in LB medium containing 0.1 mg/ml ampicillin. At a cell density of 0.5 (A600), protein expression was induced with 1 mm isopropyl-1-thio-β-d-galactopyranoside for 5 h at 37 °C. The cells were harvested by centrifugation at 4,000 × g for 20 min, resuspended in 35 ml of the lysis buffer (50 mm Tris-HCl, pH 7.5, 0.3 m NaCl, 5 mm imidazole, 0.1 mm phenylmethylsulfonyl fluoride), and disrupted 20 times for 20 s in an ice bath by an Astrason XL-2020 ultrasonic processor (Misonix Inc., Farmingdale, NY). The lysate was centrifuged at 20,000 × g for 30 min and the His-Pex19p in the supernatant was immediately applied to 10 ml of TALON Metal affinity resin (Clontech) equilibrated with the lysis buffer. After extensive washing, the His-Pex19p was eluted with the lysis buffer containing 250 mm imidazole. The eluted fractions containing His-Pex19p were dialyzed against 50 mm Tris-HCl, pH 8.0, 50 mm NaCl, and 10 mm dithiothreitol and stored at -80 °C. In Vitro Transcription and Translation—The plasmids encoding wild type and mutant PMP70s were transcribed in vitro using T7 RNA polymerase, and the synthesized mRNAs were isolated by a MicroSpin G-25 column (Amersham Biosciences). Using the purified mRNA, cell-free translation was performed according to the bilayer method using PROTEIOS™, a wheat germ cell-free protein synthesis core kit, according to the manufacturerʼns procedure. In a typical experiment, the synthesized mRNAs were translated for 24 h at 26 °C in a 300-μl wheat germ cell-free protein synthesis system containing 50 μCi of [35S]methionine in the presence of 100 μg of His-Pex19p. After translation, the reaction mixture was centrifuged for 20 min at 17,000 × g, and the supernatant was used for co-immunoprecipitation. Co-immunoprecipitation—Translation products (50 μl) were pre-cleaned with an appropriate amount of protein G-agarose in 200 μl of the binding buffer (20 mm Hepes-KOH, pH 7.5, 110 mm potassium acetate, 5 mm sodium acetate, 2 mm magnesium acetate, 1 mm EDTA, 0.2% Triton X-100, 10 mm dithiothreitol). After this step, the supernatant was removed and incubated with protein G-agarose beads saturated with anti-His G antibody. After incubation of the suspensions for 2 h at 4 °C, the beads were collected by centrifugation and washed five times with 250 μl of the binding buffer. Immunoprecipitated proteins were analyzed on a 7-15% SDS-polyacrylamide gradient gel. The gels were dried, and the radio-activity of the band corresponding to PMP70 was quantified by a Fuji BAS 5000 imaging analyzer (Fuji Film, Tokyo, Japan). Other Methods—Protein was assayed as described previously (43Imanaka T. Aihara K. Takano T. Yamashita A. Sato R. Suzuki Y. Yokota S. Osumi T. J. Biol. Chem. 1999; 274: 11968-11976Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Western blot analysis was performed with primary antibodies and a second antibody, donkey anti-rabbit IgG antibody conjugated to horseradish peroxidase (Amersham Biosciences). Antigen-antibody complex was visualized with ECL+Plus Western blotting detection reagent (Amersham Biosciences). Subcellular Localization of COOH-terminal Truncated PMP70—To determine the mPTS of PMP70, we first expressed various COOH-terminal deletion constructs of PMP70 fused with GFP in CHO cells and examined their intracellular localization by immunofluorescence. We have recently shown that PMP70(AA.1-659)-GFP and PMP70(AA.1-375)-GFP, which possess whole NH2-terminal transmembrane segments, were localized to peroxisomes and that PMP70(AA.1-144)-GFP was still targeted to peroxisomes, indicating that PMP70 possesses an mPTS in the NH2-terminal 144-amino acid region (27Kashiwayama Y. Asahina K. Shibata H. Morita M. Muntau A.C. Roscher A.A. Wanders R.J.A. Shimozawa N. Sakaguchi M. Kato H. Imanaka T. Biochim. Biophys. Acta. 2005; 1746: 116-128Crossref PubMed Scopus (39) Google Scholar). It is suggested that the targeting characteristics are influenced by the position of GFP. Therefore, we expressed various COOH-terminal deletion constructs of PMP70 in fusion with the COOH terminus of GFP (Fig. 1A). As shown in Fig. 1B, GFP-PMP70(AA.1-375) exh" @default.
• W2057486527 created "2016-06-24" @default.
• W2057486527 creator A5068707626 @default.
• W2057486527 creator A5071419314 @default.
• W2057486527 creator A5073334523 @default.
• W2057486527 creator A5073637803 @default.
• W2057486527 date "2007-11-01" @default.
• W2057486527 modified "2023-10-03" @default.
• W2057486527 title "Hydrophobic Regions Adjacent to Transmembrane Domains 1 and 5 Are Important for the Targeting of the 70-kDa Peroxisomal Membrane Protein" @default.
• W2057486527 cites W1579834701 @default.
• W2057486527 cites W1606277396 @default.
• W2057486527 cites W183828014 @default.
• W2057486527 cites W1913087900 @default.
• W2057486527 cites W1964954849 @default.
• W2057486527 cites W1972446643 @default.
• W2057486527 cites W1974759945 @default.
• W2057486527 cites W1976702924 @default.
• W2057486527 cites W1978368157 @default.
• W2057486527 cites W1988308906 @default.
• W2057486527 cites W1989765723 @default.
• W2057486527 cites W1990199254 @default.
• W2057486527 cites W1998394653 @default.
• W2057486527 cites W2000925552 @default.
• W2057486527 cites W2007919248 @default.
• W2057486527 cites W2014664955 @default.
• W2057486527 cites W2018360002 @default.
• W2057486527 cites W2019724237 @default.
• W2057486527 cites W2021593510 @default.
• W2057486527 cites W2023549144 @default.
• W2057486527 cites W2027647762 @default.
• W2057486527 cites W2028538636 @default.
• W2057486527 cites W2033047936 @default.
• W2057486527 cites W2038701351 @default.
• W2057486527 cites W2041146932 @default.
• W2057486527 cites W2044270028 @default.
• W2057486527 cites W2047654695 @default.
• W2057486527 cites W2063896117 @default.
• W2057486527 cites W2066861084 @default.
• W2057486527 cites W2069547574 @default.
• W2057486527 cites W2071214531 @default.
• W2057486527 cites W2076077839 @default.
• W2057486527 cites W2089981605 @default.
• W2057486527 cites W2090001579 @default.
• W2057486527 cites W2094164672 @default.
• W2057486527 cites W2101378834 @default.
• W2057486527 cites W2111781163 @default.
• W2057486527 cites W2111864062 @default.
• W2057486527 cites W2112606108 @default.
• W2057486527 cites W2115550376 @default.
• W2057486527 cites W2115681586 @default.
• W2057486527 cites W2117403951 @default.
• W2057486527 cites W2127006597 @default.
• W2057486527 cites W2129742786 @default.
• W2057486527 cites W2132762612 @default.
• W2057486527 cites W2132778321 @default.
• W2057486527 cites W2140095158 @default.
• W2057486527 cites W2141883291 @default.
• W2057486527 cites W2144902877 @default.
• W2057486527 cites W2152015543 @default.
• W2057486527 cites W2165338176 @default.
• W2057486527 cites W2167495254 @default.
• W2057486527 cites W2170566884 @default.
• W2057486527 cites W2171642486 @default.
• W2057486527 cites W2290606973 @default.
• W2057486527 cites W2413107236 @default.
• W2057486527 cites W29511357 @default.
• W2057486527 doi "https://doi.org/10.1074/jbc.m703369200" @default.
• W2057486527 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17761678" @default.
• W2057486527 hasPublicationYear "2007" @default.
• W2057486527 type Work @default.
• W2057486527 sameAs 2057486527 @default.
• W2057486527 citedByCount "22" @default.
• W2057486527 countsByYear W20574865272012 @default.
• W2057486527 countsByYear W20574865272013 @default.
• W2057486527 countsByYear W20574865272014 @default.
• W2057486527 countsByYear W20574865272015 @default.
• W2057486527 countsByYear W20574865272016 @default.
• W2057486527 countsByYear W20574865272017 @default.
• W2057486527 countsByYear W20574865272018 @default.
• W2057486527 countsByYear W20574865272019 @default.
• W2057486527 countsByYear W20574865272020 @default.
• W2057486527 countsByYear W20574865272021 @default.
• W2057486527 countsByYear W20574865272022 @default.
• W2057486527 crossrefType "journal-article" @default.
• W2057486527 hasAuthorship W2057486527A5068707626 @default.
• W2057486527 hasAuthorship W2057486527A5071419314 @default.
• W2057486527 hasAuthorship W2057486527A5073334523 @default.
• W2057486527 hasAuthorship W2057486527A5073637803 @default.
• W2057486527 hasBestOaLocation W20574865271 @default.
• W2057486527 hasConcept C118892022 @default.
• W2057486527 hasConcept C12554922 @default.
• W2057486527 hasConcept C127078168 @default.
• W2057486527 hasConcept C144647389 @default.
• W2057486527 hasConcept C170493617 @default.
• W2057486527 hasConcept C185592680 @default.
• W2057486527 hasConcept C24530287 @default.
• W2057486527 hasConcept C41625074 @default.
• W2057486527 hasConcept C55493867 @default.

• next