FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2058012269> ?p ?o ?g. }

• W2058012269 endingPage "23553" @default.
• W2058012269 startingPage "23547" @default.
• W2058012269 abstract "In this study we examine for the first time the roles of the various domains of human RNase H1 by site-directed mutagenesis. The carboxyl terminus of human RNase H1 is highly conserved with Escherichia coli RNase H1 and contains the amino acid residues of the putative catalytic site and basic substrate-binding domain of the E. coli RNase enzyme. The amino terminus of human RNase H1 contains a structure consistent with a double-strand RNA (dsRNA) binding motif that is separated from the conserved E. coli RNase H1 region by a 62-amino acid sequence. These studies showed that although the conserved amino acid residues of the putative catalytic site and basic substrate-binding domain are required for RNase H activity, deletion of either the catalytic site or the basic substrate-binding domain did not ablate binding to the heteroduplex substrate. Deletion of the region between the dsRNA-binding domain and the conserved E. coli RNase H1 domain resulted in a significant loss in the RNase H activity. Furthermore, the binding affinity of this deletion mutant for the heteroduplex substrate was ∼2-fold tighter than the wild-type enzyme suggesting that this central 62-amino acid region does not contribute to the binding affinity of the enzyme for the substrate. The dsRNA-binding domain was not required for RNase H activity, as the dsRNA-deletion mutants exhibited catalytic rates ∼2-fold faster than the rate observed for wild-type enzyme. Comparison of the dissociation constant of human RNase H1 and the dsRNA-deletion mutant for the heteroduplex substrate indicates that the deletion of this region resulted in a 5-fold loss in binding affinity. Finally, comparison of the cleavage patterns exhibited by the mutant proteins with the cleavage pattern for the wild-type enzyme indicates that the dsRNA-binding domain is responsible for the observed strong positional preference for cleavage exhibited by human RNase H1. In this study we examine for the first time the roles of the various domains of human RNase H1 by site-directed mutagenesis. The carboxyl terminus of human RNase H1 is highly conserved with Escherichia coli RNase H1 and contains the amino acid residues of the putative catalytic site and basic substrate-binding domain of the E. coli RNase enzyme. The amino terminus of human RNase H1 contains a structure consistent with a double-strand RNA (dsRNA) binding motif that is separated from the conserved E. coli RNase H1 region by a 62-amino acid sequence. These studies showed that although the conserved amino acid residues of the putative catalytic site and basic substrate-binding domain are required for RNase H activity, deletion of either the catalytic site or the basic substrate-binding domain did not ablate binding to the heteroduplex substrate. Deletion of the region between the dsRNA-binding domain and the conserved E. coli RNase H1 domain resulted in a significant loss in the RNase H activity. Furthermore, the binding affinity of this deletion mutant for the heteroduplex substrate was ∼2-fold tighter than the wild-type enzyme suggesting that this central 62-amino acid region does not contribute to the binding affinity of the enzyme for the substrate. The dsRNA-binding domain was not required for RNase H activity, as the dsRNA-deletion mutants exhibited catalytic rates ∼2-fold faster than the rate observed for wild-type enzyme. Comparison of the dissociation constant of human RNase H1 and the dsRNA-deletion mutant for the heteroduplex substrate indicates that the deletion of this region resulted in a 5-fold loss in binding affinity. Finally, comparison of the cleavage patterns exhibited by the mutant proteins with the cleavage pattern for the wild-type enzyme indicates that the dsRNA-binding domain is responsible for the observed strong positional preference for cleavage exhibited by human RNase H1. double-strand RNA polymerase chain reaction RNase H hydrolyzes RNA in RNA-DNA hybrids (1Stein H. Hausen P. Science. 1969; 166: 393-395Crossref PubMed Scopus (183) Google Scholar). RNase H activity appears to be ubiquitous in eukaryotes and bacteria (2Itaya M. Kondo K. Nucleic Acids Res. 1991; 19: 4443-4449Crossref PubMed Scopus (63) Google Scholar, 3Itaya M. McKelvin D. Chatterjie S.K. Crouch R.J. Mol. Gen. Genet. 1991; 227: 438-445Crossref PubMed Scopus (55) Google Scholar, 4Kanaya S. Itaya M. J. Biol. Chem. 1992; 267: 10184-10192Abstract Full Text PDF PubMed Google Scholar, 5Busen W. J. Biol. Chem. 1980; 255: 9434-9443Abstract Full Text PDF PubMed Google Scholar, 6Rong Y.W. Carl P.L. Biochemistry. 1990; 29: 383-389Crossref PubMed Scopus (34) Google Scholar, 7Eder P.S. Walder R.T. Walder J.A. Biochimie ( Paris ). 1993; 75: 123-126Crossref PubMed Scopus (104) Google Scholar). Although RNase Hs constitute a family of proteins of varying molecular weight, the nucleolytic activity and substrate requirements appear to be similar for the various isotypes. For example, all RNase Hs studied to date function as endonucleases exhibiting limited sequence specificity and requiring divalent cations (e.g. Mg2+ and Mn2+) to produce cleavage products with 5′-phosphate and 3′-hydroxyl termini (8Crouch R.J. Dirksen M.L. Linn S.M. Roberts R.J. Nucleases. Cold Spring Harbor Laboratory Press, Plainview, NY1982: 211-241Google Scholar). Two classes of RNase H enzymes have been identified in mammalian cells (5Busen W. J. Biol. Chem. 1980; 255: 9434-9443Abstract Full Text PDF PubMed Google Scholar, 9Eder P.S. Walder J.A. J. Biol. Chem. 1991; 266: 6472-6479Abstract Full Text PDF PubMed Google Scholar, 10Frank P. Albert S. Cazenave C. Toulme J.J. Nucleic Acids Res. 1994; 22: 5247-5254Crossref PubMed Scopus (40) Google Scholar). These enzymes were shown to differ with respect to cofactor requirements and were shown to be inhibited by sulfhydryl reagents (10Frank P. Albert S. Cazenave C. Toulme J.J. Nucleic Acids Res. 1994; 22: 5247-5254Crossref PubMed Scopus (40) Google Scholar,11Wu H. Lima W.F. Crooke S.T. Antisense Nucleic Acid Drug Dev. 1998; 8: 53-61Crossref PubMed Scopus (55) Google Scholar). Although the biological roles of the mammalian enzymes are not fully understood, it has been suggested that mammalian RNase H1 may be involved in replication and that the RNase H2 enzyme may be involved in transcription (12Busen W. Peters J.H. Hausen P. Eur. J. Biochem. 1977; 74: 203-208Crossref PubMed Scopus (49) Google Scholar, 13Turchi J.J. Huang L. Murante R.S. Kim Y. Bambara R.A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9803-9807Crossref PubMed Scopus (169) Google Scholar). Recently, both human RNase H genes have been cloned and expressed (11Wu H. Lima W.F. Crooke S.T. Antisense Nucleic Acid Drug Dev. 1998; 8: 53-61Crossref PubMed Scopus (55) Google Scholar,14Frank P. Braunshofer-Reiter C. Wintersberger U. Grimm R. Busen W. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12872-12877Crossref PubMed Scopus (68) Google Scholar, 15Cerritelli S.M. Crouch R.J. Genomics. 1998; 53: 307-311Crossref Scopus (48) Google Scholar). RNase H1 is a 286-amino acid protein with a calculated mass of 32 kDa (11Wu H. Lima W.F. Crooke S.T. Antisense Nucleic Acid Drug Dev. 1998; 8: 53-61Crossref PubMed Scopus (55) Google Scholar). The enzyme is encoded by a single gene that is at least 10 kilobase pairs in length and is expressed ubiquitously in human cells and tissues. The amino acid sequence of human RNase H1 displays strong homology with RNase H1 from yeast, chicken, Escherichia coli, and mouse (11Wu H. Lima W.F. Crooke S.T. Antisense Nucleic Acid Drug Dev. 1998; 8: 53-61Crossref PubMed Scopus (55) Google Scholar). The human RNase H2 enzyme is a 299-amino acid protein with a calculated mass of 33.4 kDa and has also been shown to be ubiquitously expressed in human cells and tissues (14Frank P. Braunshofer-Reiter C. Wintersberger U. Grimm R. Busen W. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12872-12877Crossref PubMed Scopus (68) Google Scholar). 1H. Wu, unpublished data. Human RNase H2 shares strong amino acid sequence homology with RNase H2 fromCaenorhabditis elegans, yeast, and E. coli(14Frank P. Braunshofer-Reiter C. Wintersberger U. Grimm R. Busen W. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12872-12877Crossref PubMed Scopus (68) Google Scholar). The properties of the cloned and expressed human RNase H1 have been characterized recently (16Wu H. Lima W.L. Crooke S.T. J. Biol. Chem. 1999; 274: 28270-28278Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). The activity of RNase H1 is Mg2+-dependent and inhibited by both Mn2+ and the sulfhydryl-blocking agentN-ethylmaleimide. Human RNase H1 was also inhibited by increasing ionic strength with optimal activity for both KCl and NaCl observed at 10–20 mm. The enzyme exhibited a bell-shaped response to divalent cations and pH, with the optimum conditions for catalysis observed to be 1 mm Mg2+ and pH 7–8. The protein was shown to be reversibly denatured under the influence of temperature and destabilizing agents such as urea. Renaturation of human RNase H1 was observed to be highly cooperative and did not require divalent cations. Furthermore, RNase H1 displayed no tendency to form intermolecular disulfides or to form homo-multimers. Human RNase H1 was shown to bind selectively to “A-form” duplexes with 10–20-fold greater affinity than that observed for E. coliRNase H1 (16Wu H. Lima W.L. Crooke S.T. J. Biol. Chem. 1999; 274: 28270-28278Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar, 17Lima W.F. Crooke S.T. Biochemistry. 1997; 36: 390-398Crossref PubMed Scopus (115) Google Scholar). Finally, human RNase H1 displays a strong positional preference for cleavage, i.e. the enzyme cleaves between 8 and 12 nucleotides from the 5′-RNA–3′-DNA terminus of the duplex. Many of the properties observed for Human RNase H1 are consistent with the E. coli RNase H1 isotype (e.g. the cofactor requirements, substrate specificity, and binding specificity) (16Wu H. Lima W.L. Crooke S.T. J. Biol. Chem. 1999; 274: 28270-28278Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar, 17Lima W.F. Crooke S.T. Biochemistry. 1997; 36: 390-398Crossref PubMed Scopus (115) Google Scholar). In fact, the carboxyl-terminal portion of human RNase H1 is highly conserved with the amino acid sequence of the E. coli enzyme (Fig. 1, Region III). The glutamic acid and two aspartic acid residues of the catalytic site as well as the histidine and aspartic acid residues of the proposed second divalent cation-binding site of the E. coli enzyme are conserved in human RNase H1 (18Kanaya S. Katsuda-Kakai C. Ikehara M. J. Biol. Chem. 1991; 266: 11621-11627Abstract Full Text PDF PubMed Google Scholar, 19Nakamura H. Oda Y. Iwai S. Inoue H. Ohtsuka E. Kanaya S. Kimura S. Katsuda C. Katayanagi K. Morikawa K. Miyashiro H. Ikehara M. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 11535-11539Crossref PubMed Scopus (196) Google Scholar, 20Katayanagi K. Miyagawa M. Matsushima M. Ishkiawa M. Kanaya S. Ikehara M. Matsuzaki T. Morikawa K. Nature. 1990; 347: 306-309Crossref PubMed Scopus (308) Google Scholar, 21Yang W. Hendrickson W.A. Crouch R.J. Satow Y. Science. 1990; 249: 1398-1405Crossref PubMed Scopus (453) Google Scholar). In addition, the lysine residues within the highly basic α-helical substrate-binding region of E. coli RNase H1 are also conserved in the human enzyme. Despite these similarities, the structures of the two enzymes differ in several important ways. For example, the amino acid sequence of the human enzyme is ∼2-fold longer than the E. coli enzyme. The additional amino acid sequence of the human enzyme extends from the amino terminus of the conserved E. coli RNase H1 region and contains a 73-amino acid region homologous with a double-strand RNA (dsRNA)2-binding motif (Fig.1, region I). The conserved E. coli RNase H1 region at the carboxyl terminus is separated from the dsRNA-binding domain of the human enzyme by a 62-amino acid region (Fig. 1,region II). Although the role of both regions I and II remain unclear, the dsRNA-binding domain of human RNase H1 may account for the observed positional preference for cleavage displayed by the enzyme as well as the enhanced binding affinity of the enzyme for various polynucleotides (16Wu H. Lima W.L. Crooke S.T. J. Biol. Chem. 1999; 274: 28270-28278Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). Finally, the human enzyme is a significantly more basic protein than E. coli RNase H1 with a net positive charge of +15 for human RNase H1 compared with +2 for the E. coli enzyme. In this study we have explored the roles of the conserved amino acids of the catalytic site and the basic substrate-binding domain (region III), the roles of the dsRNA-binding domain (region I), and the 62-amino acid center region of human RNase H1 (region II) (Fig. 1). We have performed site-directed mutagenesis on the three conserved amino acids of the proposed catalytic site of human RNase H1 ((D145N), (E186Q), and (D210N)). In addition, the net positive charge of the basic substrate-binding domain was progressively reduced through alanine substitution of two (RNase H1(K226A,K227A)) and four (RNase H1(K226A,K227A,K231A,K236A)) of the lysines within this region. Deletion mutants were also prepared in which either the dsRNA-binding domain of region I (RNase H1(ΔI)) or the central region II (RNase H1(ΔII)) was deleted. Finally, a mutant protein representing the conserved E. coli RNase H1 region was prepared by deleting both regions I and II (RNase H1(ΔI–II)). The mutagenesis of human RNase H1 was performed using a PCR-based technique derived from Landtet al. (22Landt O. Grunert H. Hahn U. Gene ( Amst. ). 1990; 96: 125-128Crossref PubMed Scopus (639) Google Scholar). Briefly, two separate PCRs were performed using a set of site-directed mutagenic primers and two vector-specific primers (11Wu H. Lima W.F. Crooke S.T. Antisense Nucleic Acid Drug Dev. 1998; 8: 53-61Crossref PubMed Scopus (55) Google Scholar). For the RNase H1(D145N) mutant the 5′-oligodeoxynucleotide used for PCR was TACACTAATGGCTGCTGCTCCAGTAAT and the 3′-oligodeoxynucleotide was GCAGCCATTAGTGTAGACGACGACGACGAA. The PCR primers for RNase H1(E186Q) were 5′-AGAGCGCAAATTCATGCAGCCTGCAAA and 3′-ATGAATTTGCGCTCTTTGGTTTGTCTG. The primers for RNase H1(D210N) were 5′-TATACAAACAGTATGTTTACGATAAAT and 3′-CATACTGTTTGTATACAGAACCAGTTT. The primers for RNase H1(K226A,K227A) were 5′-GGTTGGGCAGCAAATGGGTGGAAGACAAGT and 3′-CCCATTTGCTGCCCAACCTTGAACCCAGTT. The primers for RNase H1(K226A,K227A,K231A,K236A) were 5′-GCAGCAAATGGGTGGGCGACAAGTGCAGGCGCAGAGGTGATCAACAAAG and 3′-TGCCCCTGCACTTGTCGCCCACCCATTTGCTGCCCAACCTTGAACCCAG. The PCR primers for RNase H1(ΔI) were 5′-ATCTTAGGATCCTCTGCAAGCCCGGAAGTTTCA and 3′-ATCTTACTCGAGTCAGTCTTCCGATTGTTTAGCTCC. The primers for RNase H1(ΔII) were 5′-TTTGTCAGGAAAATGGGAGACTTCGTCGTC and 3′-GAAGTCTCCCATTTTCCTGACAAAGGCCCA. The PCR primers for RNase H1(ΔI–II) were 5′-ATCTTAGGATCCATGGGAGACTTCGTCGTCGTCTA and the same 3′- primer as the RNase H1(ΔI) mutant. Approximately 1 μg of human RNase H1 cDNA was used as the template for the first round of amplification of both the amino- and carboxyl-terminal portions of the cDNA corresponding to the mutant site. The fragments were purified by agarose gel extraction (Qiagen, Germany). PCR was performed in two rounds consisting of, respectively, 15 and 25 amplification cycles (94 °C, 30 s; 55 °C, 30 s; 72 °C, 180 s). The purified fragments were used as the template for the second round of PCR using the two vector-specific primers. The final PCR product was purified and cloned into the expression vector pET17b (Novagen) as described previously (11Wu H. Lima W.F. Crooke S.T. Antisense Nucleic Acid Drug Dev. 1998; 8: 53-61Crossref PubMed Scopus (55) Google Scholar). The incorporation of the desired mutations was confirmed by DNA sequencing. The plasmid was transfected into E. coli BL21(DE3) (Novagen). The bacteria were grown in M9ZB medium (23Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Smith J.A. Seidman J.G. Struhl K. Ausubel F.M. Seidman J.G. Current Protocols in Molecular Biology. 3rd Ed. Wiley and Sons, NY1988: 3.10.3Google Scholar) at 32 °C and harvested atA600 of 0.8. The cells were induced with 0.5 mm isopropyl-1-thio-β-d-galactopyranoside at 32 °C for 2 h. The cells were lysed in 8 m urea solution, and the recombinant protein was partially purified with nickel-nitrilotriacetic acid-agarose (Qiagen, Germany). The human RNase H1 was purified by C4 reverse-phase chromatography (Beckman Instruments, System Gold, Fullerton, CA) using a 0–80% gradient of acetonitrile in 0.1% trifluoroacetic acid/distilled water (% v/v) over 40 min (24Deutscher M.P. Methods Enzymol. 1990; 182: 392-421Crossref PubMed Scopus (35) Google Scholar). The recombinant protein was collected, lyophilized, and analyzed by 12% SDS-polyacrylamide gel electrophoresis (23Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Smith J.A. Seidman J.G. Struhl K. Ausubel F.M. Seidman J.G. Current Protocols in Molecular Biology. 3rd Ed. Wiley and Sons, NY1988: 3.10.3Google Scholar). The purified protein and control samples were resuspended in 6 m urea solution containing 20 mm Tris-HCl, pH 7.4, 400 mm NaCl, 20% glycerol, 0.2 mm phenylmethylsulfonyl fluoride, 5 mm dithiothreitol, 10 μg/ml each aprotinin and leupeptin (Sigma). The protein was refolded by dialysis with decreasing urea concentration from 6 to 0.5 m and dithiothreitol concentration from 5 to 0.5 mm (24Deutscher M.P. Methods Enzymol. 1990; 182: 392-421Crossref PubMed Scopus (35) Google Scholar). The refolded protein was concentrated 10-fold using a Centricon apparatus (Amicon, MA). The oligoribonucleotides were synthesized on a PE-ABI 380B synthesizer using 5′-O-silyl-2′-O-bis(2-acetoxyethoxy)methylribonucleoside phosphoramidites and procedures described elsewhere (25Scaringe S.A. Wincott F.E. Caruthers M.H. J. Am. Chem. Soc. 1998; 120: 11820-11821Crossref Scopus (217) Google Scholar). The oligoribonucleotides were purified by reverse-phase HPLC. The oligodeoxyribonucleotides were synthesized on a PE-ABI 380B automated DNA synthesizer and standard phosphoramidite chemistry. The oligodeoxyribonucleotides were purified by precipitation 2 times out of 0.5 m NaCl with 2.5 volumes of ethyl alcohol. The concentration of the oligonucleotides was determined by UV adsorption at A260 and previously published extinction coefficients (26Wallace R.B. Miyada C.G. Methods Enzymol. 1987; 152: 432-442Crossref PubMed Scopus (134) Google Scholar). The oligoribonucleotide substrate was 5′-end-labeled with 32P using 20 units of T4 polynucleotide kinase (Promega, WI), 120 pmol (7000 Ci/mmol) of [γ-32P]ATP (ICN, CA), 40 pmol of oligoribonucleotide, 70 mm Tris, pH 7.6, 10 mmMgCl2, and 50 mm dithiothreitol. The kinase reaction was incubated at 37 °C for 30 min. The labeled oligoribonucleotide was purified by electrophoresis on a 12% denaturing polyacrylamide gel (27Sambrook J. Fritsch E.F. Maniatis T. Nolan C. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989: 11.23-11.28Google Scholar). The specific activity of the labeled oligoribonucleotide was ∼3000 to 8000 cpm/fmol. The heteroduplex substrate was prepared in 100 μl containing unlabeled oligoribonucleotide ranging from 1 to 1000 nm, 105 cpm of32P-labeled oligoribonucleotide, 2-fold excess complementary oligodeoxyribonucleotide and hybridization buffer (20 mm Tris, pH 7.5, 20 mm KCl). Reactions were heated at 90 °C for 5 min, cooled to 37 °C, and 60 units of Prime RNase Inhibitor (5 Prime → 3 Prime, Inc., Boulder, CO) and MgCl2 at a final concentration of 1 mm were added. Hybridization reactions were incubated 2–16 h at 37 °C, and β-mercaptoethanol was added at a final concentration of 20 mm. The heteroduplex substrate was digested with 1.5 ng of human RNase H1 at 37 °C. A 10-μl aliquot of the cleavage reaction was removed at time points ranging from 2 to 120 min and quenched by adding 5 μl of stop solution (8 murea and 120 mm EDTA). The aliquots were heated at 90 °C for 2 min and resolved in a 12% denaturing polyacrylamide gel, and the substrate and product bands were quantitated on a Molecular Dynamics PhosphorImager. The concentration of the converted product was plotted as a function of time. The initial cleavage rate was obtained from the slope (mol of RNA cleaved/min) of the best fit line for the linear portion of the plot, which consists, in general, <10% of the total reaction and data from at least five time points. The initial cleavage rates were plotted as a function of the substrate concentration (n ≥ 4), and the data were fit to the Michaelis-Menten equation using the program Ultrafit (Biosoft, NJ). TheKm value corresponds to the heteroduplex substrate concentration at half-maximum rate, and the kcat= Vmax/(total RNase H1), whereVmax corresponds to the horizontal asymptote of the hyperbolic curve. Competition experiments were performed as described for the determination of multiple turnover kinetics with the exception that 20 nm oligodeoxyribonucleotide, 10 nmoligoribonucleotide, and 60 ng of the mutant RNase H1 protein was used. Reactions were digested with 6 ng of wild-type human RNase H. The reactions were quenched, analyzed, and quantitated as described for multiple turnover kinetics. Binding affinities were determined by inhibition analysis (17Lima W.F. Crooke S.T. Biochemistry. 1997; 36: 390-398Crossref PubMed Scopus (115) Google Scholar). Here the cleavage rate is determined for the heteroduplex substrate at a variety of concentrations in both the presence and absence of a competing noncleavable substrate analog. The heteroduplex substrate was prepared as described above except in a final volume of 50 μl and with equimolar oligoribonucleotide and oligodeoxyribonucleotide ranging in concentration from 10 to 500 nm. The competing noncleavable substrate analog was prepared in 50 μl of hybridization buffer containing equimolar oligodeoxyribonucleotide and complementary 2′-fluoro-modified oligonucleotide. The concentration of the noncleavable substrate analog was in excess of the heteroduplex substrate and ranged from 1 to 5 μm. Reactions were heated at 90 °C for 5 min and cooled to 37 °C. Prime RNase inhibitor and MgCl2 were added to the reactions as described above. Reactions were incubated at 37 °C for 2–16 h, and the noncleavable substrate analog was added to the heteroduplex substrate. β-Mercaptoethanol was added at a final concentration of 20 nm, and the combined reaction digested with 1.5 ng of human RNase H1. The reactions were quenched, analyzed, and quantitated as described for multiple turnover kinetics. The mutant proteins of human RNase H1 prepared for this study are described in Fig. 1. Analysis of human RNase H1 and the mutant proteins by SDS-polyacrylamide gel electrophoresis is shown in Fig. 2. As expected, mutant proteins containing amino acid substitutions (e.g. D145N, E186Q, D210N, K226A,K227A, and K226A,K227A,K231A,K236A) exhibited molecular weights similar to the 32-kDa wild-type enzyme (Fig. 2, lanes 1–6). The RNase H1(ΔI) mutant in which the dsRNA-binding domain was deleted resulted in a 213-amino acid protein with an approximate molecular mass of 23 kDa (lane 7). The deletion of the 62-amino acid center portion of human RNase H1 (RNase H1(ΔII)) resulted in a 224-amino acid protein with an approximate molecular mass of 25 kDa (lane 8). Finally, the deletion of both the dsRNA-binding domain and the central region of the enzyme (RNase H1(ΔI–II)) resulted in a 151-amino acid protein containing the conserved E. coliRNase H1 sequence and with an approximate molecular mass of 17 kDa (lane 9). The enzymatic activities of the human RNase H1 enzyme and the mutant proteins were determined using a 17-nucleotide-long oligoribonucleotide/oligodeoxyribonucleotide heteroduplex (TableI). Substitution of any one the three amino acids comprising the proposed catalytic site of human RNase H1, (e.g. D145N, E186Q, and D210N) ablated the cleavage activity of the enzyme. In addition, alanine substitution of two (RNase H1(K226A,K227A)) or four (RNase H1(K226A,K227A,K231A,K236A)) lysine residues within the basic substrate-binding domain also ablated cleavage activity.Table IInitial cleavage rates for wild-type and mutant human RNase H1 proteinsRNase H1 proteinKm1-aND = cleavage rates below the detection limit of the assay (e.g. <1% of the heteroduplex substrate cleaved over 60 min).kcat1-aND = cleavage rates below the detection limit of the assay (e.g. <1% of the heteroduplex substrate cleaved over 60 min).nmmin−1Human wild-type383.0RNase H1(D145N)NDNDRNase H1(E186Q)NDNDRNase H1(D210N)NDNDRNase H1(K226A,K227A)NDNDRNase H1(K226A,K227A,K331A,K236A)NDNDRNase H1(ΔI)605.1RNase H1(ΔII)220.9RNase H1(ΔI–II)406.2E. coli RNase H11-bThe Michaelis-Menten kinetics forE. coli RNase H1 was determined as described under “Materials and Methods” with the exception that 500 pg of enzyme was used.38582.8The kcat and Km values were determined as described under “Materials and Methods.” Thekcat and Km values are an average of n ≥ 2 slopes of Lineweaver-Burk and/or Augustisson analysis with estimated errors of the coefficient of variation <10%.1-a ND = cleavage rates below the detection limit of the assay (e.g. <1% of the heteroduplex substrate cleaved over 60 min).1-b The Michaelis-Menten kinetics forE. coli RNase H1 was determined as described under “Materials and Methods” with the exception that 500 pg of enzyme was used. Open table in a new tab The kcat and Km values were determined as described under “Materials and Methods.” Thekcat and Km values are an average of n ≥ 2 slopes of Lineweaver-Burk and/or Augustisson analysis with estimated errors of the coefficient of variation <10%. The kinetic constants for the deletion mutants are shown in Table I. Deletion of the dsRNA-binding domain (RNase H1(ΔI)) resulted in a comparable increase in both kcat andKm values when compared with the wild-type enzyme. Conversely, deletion of region II of human RNase H1 resulted in a reduction in both kcat andKm. In this case, the Km andkcat observed for the wild-type enzyme was ∼2–3-fold greater than the kinetic constants observed for the RNase H1(ΔII) mutant. Finally, the kcat for the mutant protein in which both regions I and II were deleted (RNase H1(ΔI–II)) was ∼2-fold faster than the kcatobserved for the wild-type enzyme, whereas the Kmfor both enzymes was comparable. The positions of the cleavage sites for the wild-type and mutants of human RNase H1 in the heteroduplex substrate are shown in Fig.3. As observed previously, human RNase H1 exhibited a strong positional preference, i.e. 8–12 nucleotides from the 5′-RNA/3′-DNA terminus of the duplex (Fig.3 A). A similar cleavage pattern was observed for the RNase H1(ΔII) deletion mutant. The RNase H1(ΔI) and H1(ΔI–II) deletion mutants exhibited broader cleavage patterns on the heteroduplex substrate, with cleavage sites ranging from 7 to 13 nucleotides from the 5′ terminus of the RNA (Fig. 3 B). Experiments were performed to determine whether the inactive mutants of human RNase H1 competitively inhibit the cleavage activity of the wild-type enzyme. These experiments were performed under single turnover kinetics with the enzyme concentration in excess of the substrate concentration and with the concentration of the mutant protein in excess of the wild-type enzyme concentration. To ensure that inhibition of human RNase H1 activity by the mutant proteins was competitive and not due to nonspecific protein-protein interactions, competition experiments were also performed under multiple turnover kinetics with the substrate concentration in excess of the wild-type and mutant RNase H1 concentrations. Under these conditions, no reduction in human RNase H1 activity was observed in the presence of 10-fold excess mutant RNase H1 protein (data not shown). In contrast, all three of the mutant proteins tested under single turnover kinetics were observed to inhibit competitively the cleavage activity of human RNase H1 (Fig. 4). For example, the initial cleavage rate of human RNase H1 alone was determined to be 6-fold faster than the initial cleavage rate for human RNase H1 in the presence of the RNase H1(D145N) mutant. The initial cleavage rate of human RNase H1 in the presence of the region II deletion mutant (RNase H1(ΔII)) was ∼50% slower than the rate observed for human RNase H1 alone. Finally, the initial cleavage rate for human RNase H1 in the presence of the RNase H1(K226A,K227A,K231A,K236A) mutant was ∼60% slower than the rate observed for human RNase H1 alone. The binding affinities of human RNase H1 and the RNase H1(ΔI–II) mutant were determined indirectly using a competition assay as described previously (17Lima W.F. Crooke S.T. Biochemistry. 1997; 36: 390-398Crossref PubMed Scopus (115) Google Scholar). Briefly, the cleavage rate of the oligodeoxyribonucleotide/oligoribonucleotide heteroduplex was determined at a variety of substrate concentrations in both the presence and absence of competing noncleavable oligodeoxyribonucleotide/2′-fluoro-modified oligonucleotide heteroduplex. Lineweaver-Burk and Augustinsson analysis of the data were used to determine the inhibitory constant (Ki) for the competing noncleavable heteroduplex. The Kiis equivalent to the dissociation constant (Kd) of the enzyme when a noncleavable heteroduplex is used. The dissociation constant (Kd) of human RNase H1 for the oligodeoxyribonucleotide/2′-fluoro-modified oligonucleotide heteroduplex was 75 nm (TableII). The RNase H1(ΔI), H1(ΔII), and H1(ΔI–II) mutants exhibited dissociation constants (Kd) for the noncleavable heteroduplex of, respectively, 410, 34, and 126 nm.Table IIBinding constants of RNase H1 proteinsRNase H1 proteinKdNet charge2-aThe net charge of the RNase H1 proteins was calculated by subtracting the number of" @default.
• W2058012269 created "2016-06-24" @default.
• W2058012269 creator A5027757155 @default.
• W2058012269 creator A5031607867 @default.
• W2058012269 creator A5077755519 @default.
• W2058012269 date "2001-06-01" @default.
• W2058012269 modified "2023-10-16" @default.
• W2058012269 title "Investigating the Structure of Human RNase H1 by Site-directed Mutagenesis" @default.
• W2058012269 cites W110457946 @default.
• W2058012269 cites W1489308221 @default.
• W2058012269 cites W1512880140 @default.
• W2058012269 cites W1534152353 @default.
• W2058012269 cites W1543197907 @default.
• W2058012269 cites W1561651859 @default.
• W2058012269 cites W1592224950 @default.
• W2058012269 cites W1966711452 @default.
• W2058012269 cites W1979442620 @default.
• W2058012269 cites W1991648720 @default.
• W2058012269 cites W1992783795 @default.
• W2058012269 cites W1994777317 @default.
• W2058012269 cites W1994860933 @default.
• W2058012269 cites W2003329456 @default.
• W2058012269 cites W2004648009 @default.
• W2058012269 cites W2004925323 @default.
• W2058012269 cites W2023642213 @default.
• W2058012269 cites W2028094900 @default.
• W2058012269 cites W2028767896 @default.
• W2058012269 cites W2048117183 @default.
• W2058012269 cites W2048688037 @default.
• W2058012269 cites W2053712479 @default.
• W2058012269 cites W2057648499 @default.
• W2058012269 cites W2061086000 @default.
• W2058012269 cites W2069883782 @default.
• W2058012269 cites W2079967105 @default.
• W2058012269 cites W2080332253 @default.
• W2058012269 cites W2084426324 @default.
• W2058012269 cites W2090110799 @default.
• W2058012269 cites W2328348387 @default.
• W2058012269 doi "https://doi.org/10.1074/jbc.m009676200" @default.
• W2058012269 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11319219" @default.
• W2058012269 hasPublicationYear "2001" @default.
• W2058012269 type Work @default.
• W2058012269 sameAs 2058012269 @default.
• W2058012269 citedByCount "71" @default.
• W2058012269 countsByYear W20580122692012 @default.
• W2058012269 countsByYear W20580122692013 @default.
• W2058012269 countsByYear W20580122692014 @default.
• W2058012269 countsByYear W20580122692015 @default.
• W2058012269 countsByYear W20580122692016 @default.
• W2058012269 countsByYear W20580122692017 @default.
• W2058012269 countsByYear W20580122692018 @default.
• W2058012269 countsByYear W20580122692019 @default.
• W2058012269 countsByYear W20580122692020 @default.
• W2058012269 countsByYear W20580122692021 @default.
• W2058012269 countsByYear W20580122692022 @default.
• W2058012269 countsByYear W20580122692023 @default.
• W2058012269 crossrefType "journal-article" @default.
• W2058012269 hasAuthorship W2058012269A5027757155 @default.
• W2058012269 hasAuthorship W2058012269A5031607867 @default.
• W2058012269 hasAuthorship W2058012269A5077755519 @default.
• W2058012269 hasBestOaLocation W20580122691 @default.
• W2058012269 hasConcept C103408237 @default.
• W2058012269 hasConcept C104317684 @default.
• W2058012269 hasConcept C10879258 @default.
• W2058012269 hasConcept C143065580 @default.
• W2058012269 hasConcept C16318435 @default.
• W2058012269 hasConcept C185592680 @default.
• W2058012269 hasConcept C501734568 @default.
• W2058012269 hasConcept C54355233 @default.
• W2058012269 hasConcept C67705224 @default.
• W2058012269 hasConcept C69034178 @default.
• W2058012269 hasConcept C69766542 @default.
• W2058012269 hasConcept C70721500 @default.
• W2058012269 hasConcept C86803240 @default.
• W2058012269 hasConceptScore W2058012269C103408237 @default.
• W2058012269 hasConceptScore W2058012269C104317684 @default.
• W2058012269 hasConceptScore W2058012269C10879258 @default.
• W2058012269 hasConceptScore W2058012269C143065580 @default.
• W2058012269 hasConceptScore W2058012269C16318435 @default.
• W2058012269 hasConceptScore W2058012269C185592680 @default.
• W2058012269 hasConceptScore W2058012269C501734568 @default.
• W2058012269 hasConceptScore W2058012269C54355233 @default.
• W2058012269 hasConceptScore W2058012269C67705224 @default.
• W2058012269 hasConceptScore W2058012269C69034178 @default.
• W2058012269 hasConceptScore W2058012269C69766542 @default.
• W2058012269 hasConceptScore W2058012269C70721500 @default.
• W2058012269 hasConceptScore W2058012269C86803240 @default.
• W2058012269 hasIssue "26" @default.
• W2058012269 hasLocation W20580122691 @default.
• W2058012269 hasOpenAccess W2058012269 @default.
• W2058012269 hasPrimaryLocation W20580122691 @default.
• W2058012269 hasRelatedWork W1487644672 @default.
• W2058012269 hasRelatedWork W2009632547 @default.
• W2058012269 hasRelatedWork W2058012269 @default.
• W2058012269 hasRelatedWork W2358175167 @default.
• W2058012269 hasRelatedWork W2528777594 @default.
• W2058012269 hasRelatedWork W2565847177 @default.
• W2058012269 hasRelatedWork W3037532843 @default.

• next