FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2058363464> ?p ?o ?g. }

• W2058363464 endingPage "30078" @default.
• W2058363464 startingPage "30072" @default.
• W2058363464 abstract "Interferon stimulation results in tyrosine phosphorylation, dimerization, and nuclear import of STATs (signal transducers and activators of transcription). Proteins to be targeted into the nucleus usually contain nuclear localization signals (NLSs), which interact with importin α. Importin α binds to importin β, which docks the protein complex to nuclear pores, and the complex translocates into the nucleus. Here we show that baculovirus-produced and -activated STAT1 homodimers and STAT1-STAT2 heterodimers directly interacted with importin α5 (NPI-1). This interaction was very stable and was dependent on lysines 410 and 413 of STAT1. Only STAT dimers that had two intact NLS elements, one in each monomer, were able to bind to importin α5. STAT-importin α5 complexes apparently consisted of two STAT and two importin α molecules. STAT NLS-dependent colocalization of importin α5 with STAT1 or STAT2 was seen in the nucleus of transfected cells. γ-Activated sequence DNA elements efficiently inhibited STAT binding to importin α5 suggesting that the DNA and importin α binding sites are close to each other in STAT dimers. Our results demonstrate that specific NLSs in STATs mediate direct interactions of STAT dimers with importin α, which activates the nuclear import process. Interferon stimulation results in tyrosine phosphorylation, dimerization, and nuclear import of STATs (signal transducers and activators of transcription). Proteins to be targeted into the nucleus usually contain nuclear localization signals (NLSs), which interact with importin α. Importin α binds to importin β, which docks the protein complex to nuclear pores, and the complex translocates into the nucleus. Here we show that baculovirus-produced and -activated STAT1 homodimers and STAT1-STAT2 heterodimers directly interacted with importin α5 (NPI-1). This interaction was very stable and was dependent on lysines 410 and 413 of STAT1. Only STAT dimers that had two intact NLS elements, one in each monomer, were able to bind to importin α5. STAT-importin α5 complexes apparently consisted of two STAT and two importin α molecules. STAT NLS-dependent colocalization of importin α5 with STAT1 or STAT2 was seen in the nucleus of transfected cells. γ-Activated sequence DNA elements efficiently inhibited STAT binding to importin α5 suggesting that the DNA and importin α binding sites are close to each other in STAT dimers. Our results demonstrate that specific NLSs in STATs mediate direct interactions of STAT dimers with importin α, which activates the nuclear import process. signal transducers and activators of transcription interferon nuclear localization signal γ-activated sequence Janus tyrosine kinase importin β binding nucleoprotein glutathione S-transferase fluorescein isothiocyanate tetramethylrhodamine isothiocyanate wild type fast protein liquid chromatography armadillo immunoprecipitation Signal transducers and activators of transcription (STATs)1 are latent transcription factors that are activated by cytokines and certain growth factors. Presently seven mammalian STAT proteins have been described. Binding of cytokines to their specific cell surface receptors leads to the activation of the Janus tyrosine kinase (JAK)-STAT pathway (1Darnell J.E., Jr. Science. 1997; 277: 1630-1635Crossref PubMed Scopus (3383) Google Scholar, 2Stark G.R. Kerr I.M. William B.R. Silverman R.H. Schreiber R.D. Annu. Rev. Biochem. 1998; 67: 227-264Crossref PubMed Scopus (3380) Google Scholar). In response to type I IFN (IFN-α, -β, and -ω) stimulation, IFN-α/β receptor-associated JAK1 and Tyk2 are phosphorylated and activated (2Stark G.R. Kerr I.M. William B.R. Silverman R.H. Schreiber R.D. Annu. Rev. Biochem. 1998; 67: 227-264Crossref PubMed Scopus (3380) Google Scholar, 3Velazquez L. Fellous M. Stark G.R. Pellegrini S. Cell. 1992; 75: 313-322Abstract Full Text PDF Scopus (709) Google Scholar, 4Müller M. Briscoe J. Laxton C. Guschin D. Ziemiecki A. Silvennoinen O. Harpur A.G. Barbieri G. Witthuhn B.A. Schindler C. Pellegrini S. Wilks A. Ihle J.N. Stark G.R. Kerr I.A. Nature. 1993; 366: 129-135Crossref PubMed Scopus (644) Google Scholar). Activated JAKs in turn tyrosine-phosphorylate STAT1 and STAT2 at Tyr-701 and Tyr-690, respectively, which results in dimerization and nuclear translocation of STAT1-STAT2 heterodimers. In the nucleus STATs interact with IRF-9/p48 protein to form ISGF3 complexes, which bind to well conserved interferon-stimulated response elements in the promoter regions of IFN-α/β-responsive genes and activate transcription (5Fu X.-Y. Kessler D.S. Veals S.A. Levy D.E. Darnell J.E., Jr. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 8555-8559Crossref PubMed Scopus (343) Google Scholar, 6Fu X.-Y. Schindler C. Improta T. Aebersold R. Darnell J.E., Jr Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7840-7843Crossref PubMed Scopus (452) Google Scholar, 7Veals S.A. Schindler C. Leonard D., Fu, X.-Y. Aebersold R. Darnell J.E., Jr. Levy D.E. Mol. Cell. Biol. 1992; 12: 3315-3324Crossref PubMed Scopus (347) Google Scholar, 8Schindler C., Fu, X.-Y. Improta T. Aebersold R. Darnell J.E., Jr Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7836-7839Crossref PubMed Scopus (543) Google Scholar). Binding of type II IFN (IFN-γ) to its receptor leads to the activation of JAK1 and JAK2 and tyrosine phosphorylation of STAT1 (also at Tyr-701). Activated STAT1 forms homodimers, which translocate into the nucleus and bind to GAS elements and activate transcription of IFN-γ-inducible genes (1Darnell J.E., Jr. Science. 1997; 277: 1630-1635Crossref PubMed Scopus (3383) Google Scholar, 2Stark G.R. Kerr I.M. William B.R. Silverman R.H. Schreiber R.D. Annu. Rev. Biochem. 1998; 67: 227-264Crossref PubMed Scopus (3380) Google Scholar). Although the structure-function relationships of STATs have been carefully analyzed, the mechanisms of nuclear import of this important group of transcription factors have remained less well characterized. Recently we and others have shown that STAT1 and STAT2 have an arginine/lysine-rich nuclear localization signal (NLS) that mediates their nuclear translocation in dimeric complexes (9Melén K. Kinnunen L. Julkunen I. J. Biol. Chem. 2001; 276: 16447-16455Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 10Meyer T. Begitt A. Lodige I. van Rossum M. Vinkemeier U. EMBO J. 2002; 21: 344-354Crossref PubMed Scopus (144) Google Scholar). Active nuclear transport of large macromolecules occurs via the nuclear pore complex (11Görlich D. Mattaj I.W. Science. 1996; 271: 1513-1518Crossref PubMed Scopus (1066) Google Scholar). Proteins to be imported into the nucleus usually contain a mono- or bipartite basic-type NLS, which binds to a specific NLS receptor, importin α (12Adam E.J.H. Adam S.A. J. Cell Biol. 1994; 125: 547-555Crossref PubMed Scopus (257) Google Scholar, 13Görlich D. Prehn S. Laskey R.A. Hartmann E. Cell. 1994; 79: 767-778Abstract Full Text PDF PubMed Scopus (601) Google Scholar, 14Macara I.G. Microbiol. Mol. Biol. Rev. 2001; 65: 570-594Crossref PubMed Scopus (741) Google Scholar). The N-terminal importin β binding (IBB) domain of importin α interacts with importin β (15Cingolani G. Petosa C. Weis K. Muller C.W. Nature. 1999; 399: 221-229Crossref PubMed Scopus (452) Google Scholar), which mediates the docking of NLS-containing cargo-importin α/β complex to the cytoplasmic side of the nuclear pore, and the complex translocates into the nucleus (16Görlich D. Henklein P. Laskey R.A. Hartmann E. EMBO J. 1996; 15: 1810-1817Crossref PubMed Scopus (362) Google Scholar, 17Weiss K. Ryder U. Lamond A.I. EMBO J. 1996; 15: 1818-1825Crossref PubMed Scopus (224) Google Scholar). Inside the nucleus RanGTPase is involved in the disassembly of the cargo-importin complex (14Macara I.G. Microbiol. Mol. Biol. Rev. 2001; 65: 570-594Crossref PubMed Scopus (741) Google Scholar, 18Englmeier L. Olivo J.C. Mattaj I.W. Curr. Biol. 1999; 9: 30-41Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar, 19Nakielny S. Dreyfuss G. Cell. 1999; 99: 677-690Abstract Full Text Full Text PDF PubMed Scopus (651) Google Scholar). IFN-γ-induced nuclear import of STAT1 has been suggested to be dependent on one importin α subtype, importin α5 (20Sekimoto T. Imamoto N. Nakajima K. Hirano T. Yoneda Y. EMBO J. 1997; 16: 7067-7077Crossref PubMed Scopus (306) Google Scholar), and the RanGTPase (21Sekimoto T. Nakajima K. Tachibana T. Hirano T. Yoneda Y. J. Biol. Chem. 1996; 271: 31017-31020Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). However, the elements that regulate STAT-importin α5 interactions have remained elusive. In the present work we show, by using a baculovirus-reconstituted STAT activation system, that homodimeric STAT1 or heterodimeric STAT1-STAT2 complexes directly interact with importin α5. The interaction of STAT dimers with importin α is very stable and is dependent on NLS situated in the DNA binding domain of STATs. The STAT-importin α5 complex consists of two importin α and two STAT molecules. STAT-binding GAS oligonucleotides efficiently prevent the binding of dimeric STATs with importin α. We also demonstrate by confocal microscopy that wild type STATs colocalize with importin α, whereas NLS-mutated STATs do not. Monolayers and suspension cultures ofSpodoptera frugiperda Sf9 cells that were used for baculovirus expression were maintained in TNM-FH medium as described previously (22Summers M.D. Smith G.E. Tex. Agric. Exp. Stn. Bull. 1986; 1555: 1-57Google Scholar). Human hepatocellular carcinoma HuH7 (23Nakabayashi H. Taketa K. Miyano K. Yamane T. Sato J. Cancer Res. 1982; 42: 3858-3863PubMed Google Scholar) cells were maintained in minimal essential medium supplemented with 0.6 mg/ml penicillin, 60 mg/ml streptomycin, 2 mm glutamine, 20 mm HEPES buffer, pH 7.4, and 10% fetal calf serum (Integro, Zaandam, the Netherlands). In transfection experiments the cells were cultured in the growth medium supplemented with 2% fetal calf serum. In Western blot analysis rabbit anti-Tyk2 (H-135, 1:1000 dilution; Santa Cruz Biotechnology, Santa Cruz, CA), rabbit anti-STAT1 (c-24, 1:20,000; Santa Cruz Biotechnology), rabbit anti-STAT2 (c-20, 1:2000; Santa Cruz Biotechnology), rabbit anti-phosphotyrosine (PY99, 1:200; Santa Cruz Biotechnology), and mouse monoclonal anti-phospho(tyrosine)-STAT1 (A-2, 1:200; Santa Cruz Biotechnology) or rabbit anti-phospho(tyrosine)-STAT1 (1:500; Cell Signaling Technology) antibodies were used as suggested by the manufacturer. Anti-influenza A nucleoprotein (NP) antibodies (24Ronni T. Sareneva T. Pirhonen J. Julkunen I. J. Immunol. 1995; 154: 2764-2774PubMed Google Scholar) were used at a 1:500 dilution. GST-specific antibodies were prepared by immunizing rabbits subcutaneously with Escherichia coli-produced, preparative SDS-PAGE-purified GST (100 μg/rabbit/immunization) for four times at 4-week intervals. The rabbits were bled at 1 week after the last immunization. Anti-GST antibodies were used at a 1:500 dilution. In Western blotting secondary biotin-SP-conjugated goat anti-rabbit or anti-mouse antibodies (1:10,000 dilution; Jackson ImmunoResearch Laboratories) and horseradish peroxidase-conjugated streptavidin (1:2000 dilution; Jackson ImmunoResearch Laboratories) were used. For confocal laser microscopy mouse anti-phospho(tyrosine)-STAT1 (A-2, 1:50; Santa Cruz Biotechnology), rabbit anti-STAT2 (1:200; Santa Cruz Biotechnology), rabbit anti-NPI-1/importin α5 (1:100; kindly provided by Dr. P. Palese), and anti-FLAG M5 (1:500; Sigma) antibodies were used. FITC- and TRITC-labeled goat anti-mouse and anti-rabbit immunoglobulins were used as secondary antibodies (1:100 dilution; Cappel, Organon Teknika Co., West Chester, PA and Jackson ImmunoResearch Laboratories, respectively). The wild type and mutant STAT gene constructs in FLAG-tagged (25Melén K. Julkunen I. J. Biol. Chem. 1997; 272: 32353-32359Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar) pCDNA 3.1(+) expression vector (Invitrogen) were as described previously (9Melén K. Kinnunen L. Julkunen I. J. Biol. Chem. 2001; 276: 16447-16455Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Human importin α5 gene (Ref. 26O'Neil R.E. Palese P. Virology. 1995; 206: 116-125Crossref PubMed Scopus (133) Google Scholar, GenBankTM accession number NM_002264) was PCR-modified with oligonucleotides AAAAAAGGATCCACCATGACCACCCCAGGAAAAGAGAACTTT (5′ oligonucleotide) TTTTTTGGATCCTCAAAGCTGGAAACCTTCCATAGGAGC (3′ oligonucleotide) to create BamHI cloning sites (in bold) on both sides of the gene coding region. After BamHI digestion the insert was cloned into FLAG-tagged pCDNA 3.1(+) vector (25Melén K. Julkunen I. J. Biol. Chem. 1997; 272: 32353-32359Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar). All DNA manipulations were performed according to standard protocols, and the newly created gene constructs were partially sequenced. Point mutations to genes were done directly in FLAG-tagged expression vectors using the QuikChangeTMsite-directed mutagenesis kit (Stratagene, La Jolla, CA). Human Tyk2 cDNA in baculovirus expression plasmid pVL1392 was kindly provided by Dr. Sandra Pellegrini (Institute Pasteur, Paris, France). Recombinant Tyk2 baculovirus was obtained by cotransfection of Sf9 cells (22Summers M.D. Smith G.E. Tex. Agric. Exp. Stn. Bull. 1986; 1555: 1-57Google Scholar) with the expression plasmid and BaculoGold DNA reagent (BD PharMingen). wt STAT1, wt STAT2, and mutants STAT1 K410A,K413A and STAT1 Y701A baculovirus constructs were as described previously (9Melén K. Kinnunen L. Julkunen I. J. Biol. Chem. 2001; 276: 16447-16455Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Influenza A (PR8) virus NP gene was inserted into the BamHI site of pAcYM1 expression plasmid, and recombinant viruses were obtained by plaque purification as described previously (22Summers M.D. Smith G.E. Tex. Agric. Exp. Stn. Bull. 1986; 1555: 1-57Google Scholar). For protein production Sf9 cells were coinfected with Tyk2 and STAT protein-expressing baculoviruses for 42 h. Influenza A virus NP was produced similarly. Virus-infected Sf9 cells were collected, and whole cell extracts were prepared by disrupting the cells in 50 mm Tris-HCl buffer, pH 7.4, 150 mm NaCl, 5 mm EDTA, and 1% Triton X-100 (immunoprecipitation (IP) buffer) on ice for 30 min. The cells were disrupted by passing them through a syringe. Cell extracts were clarified by Eppendorf centrifugation (13,000 rpm, 10 min). Human importin α5 and human importin β were expressed in E. coli as GST fusion proteins in BL21 cells under isopropyl-1-thio-β-d-galactopyranoside induction. Bacteria were lysed in IP buffer with 5 mg/ml lysozyme (Sigma) for 30 min at room temperature, briefly sonicated, and clarified by Eppendorf centrifugation (13,000 rpm, 5 min). Bacterial cell extracts containing GST-importin proteins were allowed to bind to glutathione-Sepharose for 60 min at +4 °C in IP buffer followed by washing two times. Baculovirus cell extracts containing STATs or influenza A NP were allowed to bind to Sepharose-immobilized GST-importin α5 or GST-importin β for 2 h at +4 °C in IP buffer followed by washing three times with IP buffer. To study the stability of STAT-importin α5 complexes high NaCl or urea concentrations were used in the washing buffers. Sepharose beads were dissolved in Laemmli sample buffer, and the proteins were separated by 8% SDS-PAGE (27Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207233) Google Scholar). Gels were either stained with Coomassie Brilliant Blue or transferred onto Immobilon-P membranes (polyvinylidene difluoride; Millipore, Bedford, MA) followed by staining with primary and secondary antibodies (9Melén K. Kinnunen L. Julkunen I. J. Biol. Chem. 2001; 276: 16447-16455Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar) and visualization of the proteins with the enhanced chemiluminescence system (ECL) (Amersham Biosciences) as recommended by the manufacturer. To study whether the GAS DNA element was able to inhibit STAT binding to importin α, increasing amounts (from 40 ng to 5 μg) of IRF-1 GAS (5′-GATCTCAGCCTGATTTCCCCGAAATGACGGCA) or NF-κB consensus (5′-GATCCCTGGGAAAGTCCCCTCAACT) oligonucleotides were preincubated (30 min at room temperature) with cell extracts containing activated STAT1 proteins followed by STAT1 binding to Sepharose-immobilized GST-importin α5. Sepharose-importin α5-bound proteins were boiled in Laemmli sample buffer, separated by SDS-PAGE, and analyzed by Western blotting as described above. Baculovirus-infected Sf9 cells or E. coli lysates were gel filtrated in the above lysis buffer using a 24-ml Superose 12 fast protein liquid chromatography (FPLC) (AmershamBiosciences) gel filtration column. To study STAT-importin α5 complex formation STAT protein-containing baculovirus cell extracts were mixed with E. coli cell extracts containing GST-importin α5. Proteins in gel filtration fractions were separated by 8% SDS-PAGE and transferred to nitrocellulose filters followed by staining with anti-GST, anti-STAT1, anti-phospho-STAT1, and anti-phosphotyrosine antibodies as described above. To estimate the relative amounts of STAT and importin α5 proteins in STAT1/STAT2-importin α5 complexes, the proteins in gel filtration fractions were separated by SDS-PAGE followed by Coomassie Blue staining. Quantitation of Coomassie Blue-stained protein bands was carried out with the Kodak electrophoresis documentation and analysis system 120. The MW-GF-200 kit for molecular weights (Sigma) was used as gel filtration markers. HuH7 cells were grown on glass coverslips or transfected with importin α and wt or mutant FLAG-STAT1- or FLAG-STAT2 pCDNA 3.1(+) gene constructs (9Melén K. Kinnunen L. Julkunen I. J. Biol. Chem. 2001; 276: 16447-16455Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar) using FuGENETM 6 transfection reagent (Roche Molecular Biochemicals). At 48 h after the transfection the cells were treated with human leukocyte IFN-α (1000 IU/ml; Ref. 28Cantell K. Hirvonen S. Kauppinen H.-L. Myllylä G. Methods Enzymol. 1981; 78: 29-38Crossref PubMed Scopus (158) Google Scholar) for 30 min. Cells were fixed and stained as described previously (29Melén K. Keskinen P. Ronni T. Sareneva T. Lounatmaa K. Julkunen I. J. Biol. Chem. 1996; 271: 23478-23486Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar) using monoclonal anti-phospho(tyrosine)-STAT1, anti-STAT2 (monoclonal anti-FLAG), and rabbit anti-importin α5 antibodies and FITC- and TRITC-conjugated secondary antibodies. The cells positive for STAT or importin α5 protein were visualized on a Leica TCS NT confocal microscope. To study possible interactions of wild type or NLS-mutated STATs with importins we used a baculovirus expression system to reconstitute the STAT activation system. We created a Tyk2 baculovirus construct that was found to express Tyk2 protein in relatively high levels. Coinfection of Sf9 cells with recombinant Tyk2 baculovirus and STAT1, STAT2, or NLS mutant STAT1 protein-expressing baculoviruses resulted in efficient expression and tyrosine phosphorylation of wt STAT1, wt STAT2, and STAT1 K410A,K413A proteins, whereas the STAT1 Y701A mutant protein completely lacked tyrosine phosphorylation (Fig. 1). Tyrosine-phosphorylated wt STAT1 or STAT1 K410A,K413A formed dimers (result not shown and Ref. 9Melén K. Kinnunen L. Julkunen I. J. Biol. Chem. 2001; 276: 16447-16455Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar), which enabled us to analyze potential interactions of dimeric STAT complexes with importins. IFN-induced nuclear import of STAT1 has been suggested to be mediated by importin α5 (20Sekimoto T. Imamoto N. Nakajima K. Hirano T. Yoneda Y. EMBO J. 1997; 16: 7067-7077Crossref PubMed Scopus (306) Google Scholar). We recently proposed that STAT proteins have a well conserved arginine/lysine-rich NLS in their DNA binding domain that regulates their nuclear import (9Melén K. Kinnunen L. Julkunen I. J. Biol. Chem. 2001; 276: 16447-16455Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). To study whether this element is involved in direct binding of STATs to importins in vitro we carried out binding experiments with E. coli-produced GST-importin fusion proteins and baculovirus-expressed STAT proteins. Wt or mutant STAT baculovirus constructs were expressed alone or together with Tyk2 baculovirus construct, cell extracts were prepared, and STATs were allowed to bind to glutathione-Sepharose-bound GST-importin α5 followed by identification of importin α5-bound STATs by SDS-PAGE and Western blotting. wt STAT1 homodimers or STAT1/STAT2 heterodimers bound strongly to importin α5 (Fig.2). STAT1 Y701A protein (monomeric), STAT1 NLS-mutated homodimeric STAT1 K410A,K413A, or heterodimeric STAT1 K410A,K413A-STAT2 complexes completely failed to bind to importin α5 (Fig. 2). Tyrosine-phosphorylated STAT2 was also devoid of importin α5 binding activity suggesting that STAT2 can only dimerize with STAT1. No binding of STATs to importin β was seen (see Fig. 7 and results not shown).FIG. 7Inhibition of STAT1 dimer binding to importin α5 by IRF-1 GAS oligonucleotides.Sf9 cell extracts containing activated STAT1 dimers were preincubated with different amounts of IRF-1 GAS oligonucleotide (from 40 ng to 5 μg) for 30 min followed by binding to Sepharose-immobilized GST-importin α5 (GST-imp-α5) in the presence of the same amount of IRF-1 GAS DNA. Consensus NF-κB oligonucleotide was used as control DNA. Plain Sepharose (S) and Sepharose-importin β (GST-imp-β) beads were used as control beads. Sepharose-bound proteins were boiled in Laemmli sample buffer, subjected to 8% SDS-PAGE, and stained in Western blotting with anti-phospho(tyrosine)-STAT1 antibodies.View Large Image Figure ViewerDownload (PPT) To study the stability of STAT-importin α5 complex we washed Sepharose-bound importin α-STAT complexes with buffers containing high concentrations of NaCl or urea. Some reduction in the amounts of importin α5-bound STAT1 or STAT1/STAT2 dimers was seen after washing with 1 or 2 m NaCl, whereas 2 m urea was not able to disrupt the STAT-importin α complex (Fig.3). In higher urea concentrations Sepharose-bound STATs were released, but apparently this was due to the release of GST-importin α fusion protein from the resin (Fig. 3). Influenza A virus NP that is known to bind to importin α5 (26O'Neil R.E. Palese P. Virology. 1995; 206: 116-125Crossref PubMed Scopus (133) Google Scholar) was used as a positive control in binding stability experiments. Biochemical evidence suggested that STAT1 binding to importin α5 takes place via lysine residues at positions 410 and 413 of the STAT1 protein. To study whether the arginine/lysine-rich NLS of STAT1 or STAT2 regulates STAT interactions with importin α5 also in cultured cells we carried out colocalization experiments with transfected STAT and importin α5 gene constructs. We used confocal laser microscopy to analyze the colocalization of wt and NLS-mutated STATs in transfected human HuH7 hepatoma cells. In transiently transfected and IFN-α-treated (1000 IU/ml, 45 min) cells tyrosine-phosphorylated STAT1 clearly colocalized with STAT2 in the cell nucleus (Fig. 4). When nuclear import-defective STAT1 K410A,K413A or STAT2 R409A,K415A were cotransfected with heterologous wt STAT gene constructs no IFN-α-induced nuclear accumulation of STATs was seen. However, mutant and wt STAT forms colocalized in the cell cytoplasm (Fig. 4) suggesting that STAT1 and STAT2 directly interact with each other. The data indicates that NLS-defective STAT1 functions as a dominant negative for nuclear import of wt STAT2 and vice versa. Next we transfected HuH7 cells with importin α5 and wt or NLS-mutated STAT gene constructs. Transfected cells were treated with IFN-α for 45 min, and the cells were fixed and stained with STAT- and importin α5-specific antibodies. wt STAT1 or STAT2 was found to colocalize with importin α5 especially in the cell nucleus. Such a colocalization was not observed between importin α5 and NLS-mutated STAT1 K410A,K413A proteins (Fig. 5) suggesting that STAT1-importin α5 interaction is mediated by lysines 410 and 413 of STAT1 also in living cells. Similar results were observed with NLS-mutated STAT2 R409A,K415A protein. While in IFN-α-stimulated cells wt STAT2 was transported into the nucleus with intrinsic STAT1, the NLS-mutated STAT2 was not (Fig. 5). As shown above we have demonstrated that dimeric STATs bind to importin α5 in an NLS-dependent manner (Fig. 2). To estimate the molecular size and protein composition of importin α5-STAT complexes we carried out comigration experiments using gel filtration. We mixed Tyk2-activated STAT cell extracts with E. coli-produced importin α5 and analyzed the migration pattern of these complexes by FPLC using a Superose 12 gel filtration column. First GST-importin α5 (by itself) was subjected to gel filtration analysis, and it was found in fractions corresponding to 70–90-kDa proteins (Fig. 6A) indicating that importin α existed as a monomer. Unphosphorylated STAT1 and phosphorylated STAT1 dimers eluted in the range of 90 and 160–200 kDa, respectively (Fig. 6A). To estimate the size of importin α5-STAT1/STAT2 complex we allowed phosphorylated STAT1/STAT2 dimers to bind to Sepharose-immobilized GST-importin α5 followed by washing and elution of the proteins from the resin by glutathione. Purified importin α5-STAT1/STAT2 complex was analyzed by gel filtration, and it was found to elute in fractions corresponding to 300–350-kDa proteins. These fractions contained all three proteins (Fig. 6B). Based on gel filtration analysis it is difficult to precisely estimate the molecular size (and thus the composition) of importin α5-STAT1/STAT2 complexes. Therefore, we analyzed the protein composition of gel filtration fractions corresponding to the major peak (at 300–350 kDa) of importin α5-STAT1/STAT2 complex by SDS-PAGE and Coomassie Blue staining. Since the intensity of Coomassie Blue staining is in relation to the amount of the protein in gel we directly quantitated the STAT1, STAT2, and GST-importin α5 protein-specific bands. In the importin α5-STAT1/STAT2 complex the relative amounts of STAT1 and STAT2 proteins were equal, whereas the complex contained twice as much GST-importin α5 compared with each of the STAT proteins (Fig. 6C). This suggests that the complex is composed of two STAT molecules (STAT1 and STAT2) and two importin α5 molecules. Based on structural and experimental data the functional NLS of STAT1 is situated immediately adjacent to the STAT1 DNA binding site (9Melén K. Kinnunen L. Julkunen I. J. Biol. Chem. 2001; 276: 16447-16455Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 30Chen X. Vinkemeier U. Zhao Y. Jeruzalmi D. Darnell J.E., Jr. Kuriyan J. Cell. 1998; 93: 827-839Abstract Full Text Full Text PDF PubMed Scopus (552) Google Scholar). It is thus possible that STAT1-specific GAS DNA elements would compete with the binding of STAT complexes to importin α. Preincubation of activated STAT1 with different concentrations of GAS oligonucleotide clearly inhibited the binding of STAT1 dimers to Sepharose-immobilized importin α5. Consensus NF-κB oligonucleotide that was used as a control DNA did not inhibit STAT1 binding to importin α5 (Fig.7). In the present work we have demonstrated that activated STAT dimers are able to directly bind to two importin α5 (NPI-1) molecules with relatively high affinity. STAT1-importin α5 interaction was regulated by dimerization of STATs and by a lysine-rich element in the DNA binding domain of STAT1 since the mutation of lysines 410 and 413 to alanines completely abolished STAT1 binding to importin α5. By confocal laser microscopy we also found that in IFN-α-stimulated cells STAT1 and STAT2 colocalized with importin α5 in the cell nucleus. Consistent with biochemical analysis NLS-mutated STAT1 or STAT2 failed to show colocalization with importin α5. In addition, we observed that STAT1-specific GAS oligonucleotide was able to inhibit STAT1-importin α interaction suggesting that STAT1 binding sites to importin α5 or target DNA elements are very close to each other. It is well established that STATs have to undergo cytokine receptor-mediated tyrosine phosphorylation by JAKs and dimerization via phosphotyrosine residues and Src homology 2 domains of each of the monomers before nuclear translocation can take place (2Stark G.R. Kerr I.M. William B.R. Silverman R.H. Schreiber R.D. Annu. Rev. Biochem. 1998; 67: 227-264Crossref PubMed Scopus (3380) Google Scholar, 31Schindler C. Shuai K. Prezioso V.R. Darnell J.E., Jr. Science. 1992; 257: 809-813Crossref PubMed Scopus (723) Google Scholar). The key regulatory event controlling the nuclear import of STATs appears to be dimerization (32Mowen K. David M. J. Biol. Chem. 1998; 273: 30073-30076Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 33Milocco L. Haslam J. Rosen J. Seidel M. Mol. Cell. Biol. 1999; 19: 2913-2920Crossref PubMed Scopus (43) Google Scholar). Sekimoto and coworkers (20Sekimoto T. Imamoto N. Nakajima K. Hirano T. Yoneda Y. EMBO J. 1997; 16: 7067-7077Crossref PubMed Scopus (306) Google Scholar) demonstrated that importin α5 interacted with activated STATs, but in their work specific STAT NLSs were not identified. Now we know more of the details of the regulation of nuclear import and export of STATs. Mutational analyses revealed that lysines 410 and 413 of STAT1 and corresponding basic residues of STAT2 regulate IFN-induced nuclear import of STAT1 homodimers and STAT1/STAT2 heterodimers (9Melén K. Kinnunen L. Julkunen I. J. Biol. Chem. 2001; 276: 16447-16455Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 10Meyer T. Begitt A. Lodige I. van Rossum M. Vinkemeier U. EMBO J. 2002; 21: 344-354Crossref PubMed Scopus (144) Google Scholar). Several groups have also shown IFN-independent nuclear localization of STAT1, which appears to occur constitutively and by a different mechanism than that of IFN-induced import of STAT1 (9Melén K. Kinnunen L. Julkunen I. J. Biol. Chem. 2001; 276: 16447-16455Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 10Meyer T. Begitt A. Lodige I. van Rossum M. Vinkemeier U. EMBO J. 2002; 21: 344-354Crossref PubMed Scopus (144) Google Scholar, 34Chatterjee-Kishore M. Wright K.L. Ting J.P.-Y. Stark G.R. EMBO J. 2000; 19: 4111-4122Crossref PubMed Scopus (273) Google Scholar). Nuclear export of STAT1 is regulated by CMR1/exportin 1 protein, which binds to a DNA-free form of STAT1 via a leucine-rich consensus-like nuclear export signal situated at positions 400–409 of STAT1 (35McBride K.M. McDonald C. Reich N.C. EMBO J. 2000; 19: 6196-6206Crossref PubMed Google Scholar). It is of great interest that the STAT1 nuclear export signal is in the immediate vicinity of its NLS residing at positions 410–413 (9Melén K. Kinnunen L. Julkunen I. J. Biol. Chem. 2001; 276: 16447-16455Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 35McBride K.M. McDonald C. Reich N.C. EMBO J. 2000; 19: 6196-6206Crossref PubMed Google Scholar). Mutations in the STAT1 nuclear export signal may also interfere with STAT1-importin α5 interaction (36McBride K.M. Banninger G. McDonald C. Reich N.C. EMBO J. 2002; 21: 1754-1763Crossref PubMed Scopus (193) Google Scholar). In the present work previous cell biological observations (9Melén K. Kinnunen L. Julkunen I. J. Biol. Chem. 2001; 276: 16447-16455Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 10Meyer T. Begitt A. Lodige I. van Rossum M. Vinkemeier U. EMBO J. 2002; 21: 344-354Crossref PubMed Scopus (144) Google Scholar) were extended to a biochemical level. For these studies we chose to use the baculovirus expression system since it has been shown to efficiently produce biologically active components of the JAK-STAT pathway (9Melén K. Kinnunen L. Julkunen I. J. Biol. Chem. 2001; 276: 16447-16455Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 37Quelle F.W. Thierfelder W. Witthun B.A. Tang B. Cohen S. Ihle J.N. J. Biol. Chem. 1995; 270: 20775-20780Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar). Here we show that importin α5 can directly bind to STAT1 homodimers or STAT1/STAT2 heterodimers evidently with a relatively high affinity since even high molar concentrations of NaCl or urea are not able to disrupt the interaction of STAT dimers with importin α. We also show that no binding of monomeric STAT1 to importin α5 is taking place. In addition, neither monomeric nor dimeric STAT bind to importin β. This suggests that IFN-induced nuclear import of STAT1 homodimers or STAT1/STAT2 heterodimers is initiated by tyrosine phosphorylation-triggered dimerization of STATs followed by efficient and direct binding of STAT dimers to two importin α5 molecules. In our experiments the key residues regulating importin α5-STAT dimer interaction were lysines 410 and 413 of STAT1, which apparently mediate direct interaction between dimeric STAT complexes and importin α5. Some signaling proteins, such as Smads, can directly interact with importin β, which mediates their translocation into the nucleus (38Xiao Z. Liu X. Lodish H.F. J. Biol. Chem. 2000; 275: 23425-23428Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar,39Kurisaki A. Kose S. Yoneda Y. Heldin C.H. Moustakas A. Mol. Biol. Cell. 2001; 12: 1079-1091Crossref PubMed Scopus (152) Google Scholar). Importin β is a snail-like molecule that has a narrow canyon that functions as the binding pocket for the helical arginine/lysine-rich N-terminal domain (IBB) of importin α (15Cingolani G. Petosa C. Weis K. Muller C.W. Nature. 1999; 399: 221-229Crossref PubMed Scopus (452) Google Scholar). The NLS of STATs is situated on the surface of the DNA binding domain (9Melén K. Kinnunen L. Julkunen I. J. Biol. Chem. 2001; 276: 16447-16455Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar), and therefore it is hard to vision that this element could mediate direct binding of STATs to importin β. The three-dimensional structures of STAT3 and STAT4 are very similar to that of STAT1 (40Becker S. Groner B. Müller C.W. Nature. 1998; 394: 145-151Crossref PubMed Scopus (670) Google Scholar,41Vinkemeier U. Moarefi I. Darnell J.E., Jr. Kuriyan J. Science. 1998; 279: 1048-1052Crossref PubMed Scopus (213) Google Scholar), and it is thus likely that the other members of the STAT family use the same importin α-mediated nuclear import pathway. Gel filtration experiments show that the nuclear import complex of STATs is composed of two STAT molecules attached to two importin α5 molecules. Importin α5 alone was found to exist as a monomer (Fig.6), but in the presence of STAT dimers it formed complexes that migrated in the 300–350-kDa range in gel filtration analysis. Coomassie Blue staining and quantitation of the protein composition of these complexes indicated that STAT1/STAT2 dimers bound to two importin α5 molecules. Dimeric STAT binding to two importin α5 molecules may represent a previously uncharacterized type of interaction between nuclearly targeted molecules and importin α. Based on the three-dimensional structure of mouse importin α or karyopherin α, a yeast homolog of importin α, the molecule has two binding sites that bind classical NLS peptides (e.g. SV40 T-antigen NLS). The overall structure of importin α/karyopherin α includes well conserved armadillo (arm) repeats that mediate NLS binding (42Conti E., Uy, M. Leighton L. Blobel G. Kuriyan J. Cell. 1998; 94: 193-204Abstract Full Text Full Text PDF PubMed Scopus (658) Google Scholar, 43Fontes M.R.M. Teh T. Kobe B. J. Mol. Biol. 2000; 297: 1183-1194Crossref PubMed Scopus (313) Google Scholar). Arm repeats 2–4 form the major NLS binding site, whereas arm repeats 7 and 8 form the minor binding site. The major binding site (arm 2–4) also functions as the binding site for the autoinhibitory N-terminal IBB domain of importin α (44Kobe B. Nat. Struct. Biol. 1999; 6: 388-397Crossref PubMed Scopus (322) Google Scholar, 45Catimel B. Teh T. Fontes M.R. Jennings I.G. Jans D.A. Howlett G.J. Nice E.C. Kobe B. J. Biol. Chem. 2001; 276: 34189-34198Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). Sekimoto and coworkers (20Sekimoto T. Imamoto N. Nakajima K. Hirano T. Yoneda Y. EMBO J. 1997; 16: 7067-7077Crossref PubMed Scopus (306) Google Scholar) suggested, based on extensive deletion analysis, that neither of the NLS binding sites functions as the binding site for STAT1, but rather it is the C-terminal end of importin α5 that regulates STAT1-importin α5 interaction. To reveal the question of STAT binding site(s) in importin α5 a more fine-tuned mutational analysis should be carried out. Alternatively, a three-dimensional structural analysis of the STAT-importin α complex should be obtained. In our previous study we observed that the nuclear import-defective STAT1 K410A,K413A mutant was also defective in its DNA binding activity to GAS or interferon-stimulated response elements (9Melén K. Kinnunen L. Julkunen I. J. Biol. Chem. 2001; 276: 16447-16455Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). This prompted us to study whether GAS oligonucleotides would be able to interfere with STAT-importin α5 interaction. We observed that high concentrations of GAS DNA was able to almost completely inhibit STAT1 dimer binding to importin α5. This suggests that STAT1 binding to importin α5 or target DNA occurs at sites that are very close to each other. In the present work we have taken a clear step forward in understanding the mechanisms of nuclear import of STATs. We have evidence that dimeric STAT complexes interact with two importin α5 molecules via a lysine-rich conformation NLS within the STAT1 DNA binding domain. However, it still remains an open question why only STAT dimers are able to bind to importin α5 and which of the NLS binding sites of importin α5 are involved in this interaction. We thank Drs. S. Pellegrini, M. Malim, and P. Palese for Tyk2, GST-importin α5/NPI-1, and GST-importin β and -importin α5 (NPI-1) gene constructs, respectively. We thank M. Yliselä and T. Westerlund for excellent technical assistance." @default.
• W2058363464 created "2016-06-24" @default.
• W2058363464 creator A5007995979 @default.
• W2058363464 creator A5011996258 @default.
• W2058363464 creator A5022571708 @default.
• W2058363464 creator A5085541740 @default.
• W2058363464 date "2002-08-01" @default.
• W2058363464 modified "2023-10-09" @default.
• W2058363464 title "Arginine/Lysine-rich Nuclear Localization Signals Mediate Interactions between Dimeric STATs and Importin α5" @default.
• W2058363464 cites W1426432049 @default.
• W2058363464 cites W1521367633 @default.
• W2058363464 cites W1813196431 @default.
• W2058363464 cites W1870505444 @default.
• W2058363464 cites W1965398762 @default.
• W2058363464 cites W1969979508 @default.
• W2058363464 cites W1972527945 @default.
• W2058363464 cites W1973052124 @default.
• W2058363464 cites W1983630074 @default.
• W2058363464 cites W1995847246 @default.
• W2058363464 cites W2012588545 @default.
• W2058363464 cites W2021057156 @default.
• W2058363464 cites W2030277568 @default.
• W2058363464 cites W2044532151 @default.
• W2058363464 cites W2049132410 @default.
• W2058363464 cites W2052982889 @default.
• W2058363464 cites W2058186528 @default.
• W2058363464 cites W2062346435 @default.
• W2058363464 cites W2067390157 @default.
• W2058363464 cites W2069971894 @default.
• W2058363464 cites W2083802827 @default.
• W2058363464 cites W2083831481 @default.
• W2058363464 cites W2084988484 @default.
• W2058363464 cites W2085935547 @default.
• W2058363464 cites W2100837269 @default.
• W2058363464 cites W2103565638 @default.
• W2058363464 cites W2109389988 @default.
• W2058363464 cites W2115597041 @default.
• W2058363464 cites W2120226363 @default.
• W2058363464 cites W2120474497 @default.
• W2058363464 cites W2120966529 @default.
• W2058363464 cites W2134160801 @default.
• W2058363464 cites W2136160597 @default.
• W2058363464 cites W2146018121 @default.
• W2058363464 cites W2153496521 @default.
• W2058363464 cites W2156891333 @default.
• W2058363464 cites W2157711349 @default.
• W2058363464 cites W2158869723 @default.
• W2058363464 cites W231956376 @default.
• W2058363464 cites W2799941631 @default.
• W2058363464 cites W4211020343 @default.
• W2058363464 doi "https://doi.org/10.1074/jbc.m202943200" @default.
• W2058363464 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12048190" @default.
• W2058363464 hasPublicationYear "2002" @default.
• W2058363464 type Work @default.
• W2058363464 sameAs 2058363464 @default.
• W2058363464 citedByCount "169" @default.
• W2058363464 countsByYear W20583634642012 @default.
• W2058363464 countsByYear W20583634642013 @default.
• W2058363464 countsByYear W20583634642014 @default.
• W2058363464 countsByYear W20583634642015 @default.
• W2058363464 countsByYear W20583634642016 @default.
• W2058363464 countsByYear W20583634642017 @default.
• W2058363464 countsByYear W20583634642018 @default.
• W2058363464 countsByYear W20583634642019 @default.
• W2058363464 countsByYear W20583634642020 @default.
• W2058363464 countsByYear W20583634642021 @default.
• W2058363464 countsByYear W20583634642022 @default.
• W2058363464 countsByYear W20583634642023 @default.
• W2058363464 crossrefType "journal-article" @default.
• W2058363464 hasAuthorship W2058363464A5007995979 @default.
• W2058363464 hasAuthorship W2058363464A5011996258 @default.
• W2058363464 hasAuthorship W2058363464A5022571708 @default.
• W2058363464 hasAuthorship W2058363464A5085541740 @default.
• W2058363464 hasBestOaLocation W20583634641 @default.
• W2058363464 hasConcept C12554922 @default.
• W2058363464 hasConcept C133882971 @default.
• W2058363464 hasConcept C185592680 @default.
• W2058363464 hasConcept C2776016237 @default.
• W2058363464 hasConcept C2777468819 @default.
• W2058363464 hasConcept C2780114586 @default.
• W2058363464 hasConcept C2780723820 @default.
• W2058363464 hasConcept C49805395 @default.
• W2058363464 hasConcept C515207424 @default.
• W2058363464 hasConcept C55493867 @default.
• W2058363464 hasConcept C59157529 @default.
• W2058363464 hasConcept C70721500 @default.
• W2058363464 hasConcept C86803240 @default.
• W2058363464 hasConcept C95444343 @default.
• W2058363464 hasConceptScore W2058363464C12554922 @default.
• W2058363464 hasConceptScore W2058363464C133882971 @default.
• W2058363464 hasConceptScore W2058363464C185592680 @default.
• W2058363464 hasConceptScore W2058363464C2776016237 @default.
• W2058363464 hasConceptScore W2058363464C2777468819 @default.
• W2058363464 hasConceptScore W2058363464C2780114586 @default.
• W2058363464 hasConceptScore W2058363464C2780723820 @default.
• W2058363464 hasConceptScore W2058363464C49805395 @default.
• W2058363464 hasConceptScore W2058363464C515207424 @default.
• W2058363464 hasConceptScore W2058363464C55493867 @default.

• next