FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2059044738> ?p ?o ?g. }

• W2059044738 endingPage "813" @default.
• W2059044738 startingPage "805" @default.
• W2059044738 abstract "Transitional cell carcinoma (TCC), a neoplasm of urinary bladder urothelial cells, generally appears in either of two forms, papillary non-invasive or invasive TCC, although intermediate forms can occur. Each has a distinctive morphology and clinical course. Altered expression of the p53 and pRb genes has been associated with the more serious invasive TCC, suggesting that the loss of activity of these tumor suppressor proteins may have a causal role in this disease. To test this hypothesis directly, transgenic mice were developed that expressed the simian virus 40 large T antigen (TAg) in urothelial cells under the control of the cytokeratin 19 gene (CK19) regulatory elements. In one CK19-TAg lineage, all transgenic mice developed highly invasive bladder neoplasms that resembled invasive human bladder TCCs. Stages of disease progression included development of carcinoma in situ, stromal invasion, muscle invasion, rapid growth, and, in 20% of affected mice, intravascular lung metastasis. Papillary lesions never were observed. Western blot analysis indicated that TAg was bound to both p53 and pRb, which has been shown to cause inactivation of these proteins. Our findings support suggestions that (i) inactivation of p53 and/or pRb constitutes a causal step in the etiology of invasive TCC, (ii) papillary and invasive TCC may have different molecular causes, and (iii) carcinoma in situ can represent an early stage in the progression to invasive TCC. Transitional cell carcinoma (TCC), a neoplasm of urinary bladder urothelial cells, generally appears in either of two forms, papillary non-invasive or invasive TCC, although intermediate forms can occur. Each has a distinctive morphology and clinical course. Altered expression of the p53 and pRb genes has been associated with the more serious invasive TCC, suggesting that the loss of activity of these tumor suppressor proteins may have a causal role in this disease. To test this hypothesis directly, transgenic mice were developed that expressed the simian virus 40 large T antigen (TAg) in urothelial cells under the control of the cytokeratin 19 gene (CK19) regulatory elements. In one CK19-TAg lineage, all transgenic mice developed highly invasive bladder neoplasms that resembled invasive human bladder TCCs. Stages of disease progression included development of carcinoma in situ, stromal invasion, muscle invasion, rapid growth, and, in 20% of affected mice, intravascular lung metastasis. Papillary lesions never were observed. Western blot analysis indicated that TAg was bound to both p53 and pRb, which has been shown to cause inactivation of these proteins. Our findings support suggestions that (i) inactivation of p53 and/or pRb constitutes a causal step in the etiology of invasive TCC, (ii) papillary and invasive TCC may have different molecular causes, and (iii) carcinoma in situ can represent an early stage in the progression to invasive TCC. Transitional cell carcinoma (TCC) is the most frequently diagnosed malignancy of the urinary bladder in humans, comprising more than 90% of all neoplasms identified at this site.1Oyasu R Epithelial tumours of the lower urinary tract in humans and rodents.Food Chem Toxicol. 1995; 33: 747-755Crossref PubMed Scopus (56) Google Scholar, 2Liebert M Seigne J Characteristics of invasive bladder cancers: histological and molecular markers.Semin Urol Oncol. 1996; 14: 62-72PubMed Google Scholar, 3Foresman WH Messing EM Bladder cancer: natural history, tumor markers, and early detection strategies.Semin Surg Oncol. 1997; 13: 299-306Crossref PubMed Scopus (62) Google Scholar, 4Lapham RL Ro JY Staerkel GA Ayala AG Pathology of transitional cell carcinoma of the bladder and its clinical implications.Semin Surg Oncol. 1997; 13: 307-318Crossref PubMed Scopus (23) Google Scholar, 5Cohen SM Urinary bladder carcinogenesis.Toxicol Pathol. 1998; 26: 121-127Crossref PubMed Scopus (141) Google Scholar, 6van der Meijden AP Bladder cancer.Br Med J. 1998; 317: 1366-1369Crossref PubMed Google Scholar Approximately 80% of TCC are papillary, and these generally are low grade and non-invasive. Most patients with papillary TCC respond well to resection and bacillus Calmette Guérin (BCG) treatment, although in 50 to 80% the low-grade papillary cancer will reoccur.4Lapham RL Ro JY Staerkel GA Ayala AG Pathology of transitional cell carcinoma of the bladder and its clinical implications.Semin Surg Oncol. 1997; 13: 307-318Crossref PubMed Scopus (23) Google Scholar, 6van der Meijden AP Bladder cancer.Br Med J. 1998; 317: 1366-1369Crossref PubMed Google Scholar, 7Stein JP Grossfeld GD Ginsberg DA Esrig D Freeman JA Figueroa AJ Skinner DG Cote RJ Prognostic markers in bladder cancer: a contemporary review of the literature.J Urol. 1998; 160: 645-659Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar Despite this fact, the overall prognosis is good. The more serious form of TCC is nonpapillary, and up to 90% display local to distant invasion at the time of diagnosis. For this reason the prognosis is poor and the 5-year survival rate is less than 50%.6van der Meijden AP Bladder cancer.Br Med J. 1998; 317: 1366-1369Crossref PubMed Google Scholar Due primarily to the severity of invasive TCCs, bladder cancer represents the twelfth leading cause of cancer mortality in humans.8Arak R American Cancer Society: Cancer Facts and Figures. 6. American Cancer Society, Atlanta, GA1998: 12-14Google Scholar Because of their markedly different presentation and course, papillary and nonpapillary TCC have been suggested to be the products of different molecular pathways of neoplastic progression, in effect representing different diseases.5Cohen SM Urinary bladder carcinogenesis.Toxicol Pathol. 1998; 26: 121-127Crossref PubMed Scopus (141) Google Scholar, 9Spruck 3rd, CH Ohneseit PF Gonzalez-Zulueta M Esrig D Miyao N Tsai YC Lerner SP Schmutte C Yang AS Cote R Dubeau L Nichols PW Hermann GG Steven K Horn T Skinner DG Jones PA Two molecular pathways to transitional cell carcinoma of the bladder.Cancer Res. 1994; 54: 784-788PubMed Google Scholar, 10Reznikoff CA Belair CD Yeager TR Savelieva E Blelloch RH Puthenveettil JA Cuthill S A molecular genetic model of human bladder cancer pathogenesis.Semin Oncol. 1996; 23: 571-584PubMed Google Scholar, 11Knowles MA Molecular genetics of bladder cancer: pathways of development and progression.Cancer Surv. 1998; 31: 49-76PubMed Google Scholar Several molecular alterations have been associated with TCC.2Liebert M Seigne J Characteristics of invasive bladder cancers: histological and molecular markers.Semin Urol Oncol. 1996; 14: 62-72PubMed Google Scholar, 3Foresman WH Messing EM Bladder cancer: natural history, tumor markers, and early detection strategies.Semin Surg Oncol. 1997; 13: 299-306Crossref PubMed Scopus (62) Google Scholar, 11Knowles MA Molecular genetics of bladder cancer: pathways of development and progression.Cancer Surv. 1998; 31: 49-76PubMed Google Scholar, 12Cordon-Cardo C Sheinfeld J Dalbagni G Genetic studies and molecular markers of bladder cancer.Semin Surg Oncol. 1997; 13: 319-327Crossref PubMed Scopus (53) Google Scholar, 13Orntoft TF Wolf H Molecular alterations in bladder cancer.Urol Res. 1998; 26: 223-233Crossref PubMed Scopus (95) Google Scholar, 14Qureshi KN Lunec J Neal DE Molecular biological changes in bladder cancer.Cancer Surv. 1998; 31: 77-97PubMed Google Scholar, 15Ozen H Bladder cancer.Curr Opin Oncol. 1998; 10: 273-278Crossref PubMed Scopus (16) Google Scholar These include mutation or reduced/lost expression of p53 or the retinoblastoma gene product pRb, mutation of H-ras, increased expression of c-myc and/or epidermal growth factor receptor family members, loss of certain cell-surface adhesion molecules, and deletion or duplication of specific chromosomal regions.16Hovey RM Chu L Balazs M DeVries S Moore D Sauter G Carroll PR Waldman FM Genetic alterations in primary bladder cancers and their metastases.Cancer Res. 1998; 58: 3555-3560PubMed Google Scholar, 17Richter J Beffa L Wagner U Schraml P Gasser TC Moch H Mihatsch MJ Sauter G Patterns of chromosomal imbalances in advanced urinary bladder cancer detected by comparative genomic hybridization.Am J Pathol. 1998; 153: 1615-1621Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar Of these, the status of p53 and pRb are considered to provide the best prognostic information.18Grossman HB Liebert M Antelo M Dinney CP Hu SX Palmer JL Benedict WF p53 and RB expression predict progression in T1 bladder cancer.Clin Cancer Res. 1998; 4: 829-834PubMed Google Scholar, 19Cordon-Cardo C Zhang ZF Dalbagni G Drobnjak M Charytonowicz E Hu SX Xu HJ Reuter VE Benedict WF Cooperative effects of p53 and pRB alterations in primary superficial bladder tumors.Cancer Res. 1997; 57: 1217-1221PubMed Google Scholar, 20Keegan PE Lunec J Neal DE p53 and p53-regulated genes in bladder cancer.Br J Urol. 1998; 82: 710-720Crossref PubMed Scopus (39) Google Scholar, 21Cote RJ Dunn MD Chatterjee SJ Stein JP Shi SR Tran QC Hu SX Xu HJ Groshen S Taylor CR Skinner DG Benedict WF Elevated and absent pRb expression is associated with bladder cancer progression and has cooperative effects with p53.Cancer Res. 1998; 58: 1090-1094PubMed Google Scholar In most reports, altered expression of either gene has been identified more frequently in high-grade compared to low-grade neoplasms, and has been associated with reduced patient survival. Altered expression of both has the worst prognosis. Based on these observations, numerous investigators have proposed that loss of activity of the tumor suppressor genes p53 and/or pRb represent important steps in the etiology of bladder cancer, and specifically invasive TCC, with other molecular alterations variably contributing to the development of the disease. Several animal models have been developed to study bladder carcinogenesis, most involving administration of carcinogens to rats or mice.1Oyasu R Epithelial tumours of the lower urinary tract in humans and rodents.Food Chem Toxicol. 1995; 33: 747-755Crossref PubMed Scopus (56) Google Scholar, 5Cohen SM Urinary bladder carcinogenesis.Toxicol Pathol. 1998; 26: 121-127Crossref PubMed Scopus (141) Google Scholar Resulting lesions identified in rats tend to progress from simple hyperplasia to papilloma to low-grade papillary carcinoma, and these can progress further to high-grade, invasive papillary carcinoma. Similar lesions appear in certain mouse strains. This sequence of changes resembles the pathogenesis of the most common form of TCC in humans, although as noted above human papillary neoplasms typically remain non-invasive. In contrast, administration of N-butyl-N-(4-hydroxybutyl)-nitrosamine (BHBN) to B6D2F1 hybrid mice induces focal dysplasia, carcinoma in situ (CIS), and high-grade, invasive TCC with occasional metastasis.22Becci PJ Thompson HJ Strum JM Brown CC Sporn MB Moon RC N-butyl-N-(4-hydroxybutyl)nitrosamine-induced urinary bladder cancer in C57BL/6 X DBA/2 F1 mice as a useful model for study of chemoprevention of cancer with retinoids.Cancer Res. 1981; 41: 927-932PubMed Google Scholar, 23Ohtani M Kakizoe T Nishio Y Sato S Sugimura T Fukushima S Niijima T Sequential changes of mouse bladder epithelium during induction of invasive carcinomas by N-butyl-N-(4-hydroxybutyl)nitrosamine.Cancer Res. 1986; 46: 2001-2004PubMed Google Scholar These lesions mimic those observed in the more serious invasive TCC in humans, although mouse neoplasms typically display squamous changes or a transition to squamous cell carcinoma, only rarely observed in humans. Interestingly, recent studies have reported identification of (i) a high frequency of p53 mutations in BHBN-induced TCC24Ogawa K Uzvolgyi E St John MK de Oliveira ML Arnold L Cohen SM Frequent p53 mutations and occasional loss of chromosome 4 in invasive bladder carcinoma induced by N-butyl-N-(4-hydroxybutyl)nitrosamine in B6D2F1 mice.Mol Carcinog. 1998; 21: 70-79Crossref PubMed Scopus (23) Google Scholar and (ii) increased susceptibility of heterozygous (+/−) p53 knockout mice to BHBN-induced bladder carcinogenesis, although without frequent mutation of the normal allele.25Ozaki K Sukata T Yamamoto S Uwagawa S Seki T Kawasaki H Yoshitake A Wanibuchi H Koide A Mori Y Fukushima S High susceptibility of p53(+/−) knockout mice in N-butyl-N-(4-hydroxybutyl)nitrosamine urinary bladder carcinogenesis and lack of frequent mutation in residual allele.Cancer Res. 1998; 58: 3806-3811PubMed Google Scholar These findings reproduce the association between p53 alterations and TCC observed in humans, and reinforce the suggestion that altered tumor suppressor protein function may be linked functionally to the development of urinary bladder neoplasia. To test the hypothesis that altering function of p53 and pRb in urothelial cells can have a causative role in urinary bladder carcinogenesis, we generated transgenic mice expressing the simian virus 40 (SV40) T-antigen (TAg) in urothelium under control of the cytokeratin 19 (CK19) gene regulatory elements. The TAg protein binds to and inactivates both p53 and pRb,26Ludlow JW Interactions between SV40 large-tumor antigen and the growth suppressor proteins pRB and p53.FASEB J. 1993; 7: 866-871Crossref PubMed Scopus (164) Google Scholar and is a potent transforming agent when targeted to cultured human urothelial cells27Kao C Huang J Wu SQ Hauser P Reznikoff CA Role of SV40 T antigen binding to pRB and p53 in multistep transformation in vitro of human uroepithelial cells.Carcinogenesis. 1993; 14: 2297-2302Crossref PubMed Scopus (31) Google Scholar and to multiple cell types in vivo in mice and rats.28Furth PA SV40 rodent tumour models as paradigms of human disease: transgenic mouse models.Devel Biol Standardiz. 1998; 94: 281-287PubMed Google Scholar Our findings support a primary role for decreased function of one or both of these tumor suppressor genes in the etiology of invasive TCC. Gene regulatory elements from the human cytokeratin 19 (CK19) gene were combined with coding sequences from either human placental alkaline phosphatase (hPAP) or SV40 large TAg (Figure 1). The CK19 gene is expressed primarily in simple epithelia, but also in urothelial cells.29Moll R Franke WW Schiller DL Geiger B Krepler R The catalog of human cytokeratins: patterns of expression in normal epithelia, tumors and cultured cells.Cell. 1982; 31: 11-24Abstract Full Text PDF PubMed Scopus (4544) Google Scholar The 5.5-kb CK19 promoter element, flanked by Cla I and Xho I restriction endonuclease sites, was received from Dr. Bernhard Bader30Bader BL Franke WW Cell type-specific and efficient synthesis of human cytokeratin 19 in transgenic mice.Differentiation. 1990; 45: 109-118Crossref PubMed Scopus (31) Google Scholar (Max Planck Institute, Martinsried, Germany) in pBLCAT3. It included 2.2 kb of DNA from −9 to −6.8 kb and 3.6 kb of DNA immediately upstream relative to the first exon. The Xho I site was converted to Cla I, and the resulting Cla I-flanked CK19 promoter fragment was cloned into the Cla I site of pBluescript (creating pBSK19p). To generate the CK19-hPAP transgene, the hPAP coding sequence together with an attached SV40 polyadenylation signal site (provided by Dr. Richard Palmiter, University of Washington, Seattle, WA) was subcloned into Eco RI and Xba I sites of the pSp72 plasmid vector. A Hin dIII site in the polylinker was converted to Bgl II, and Bgl II-flanked hPAP was cloned into the Bam HI site of pBSK19p (generating pBSK19p-hPAP). A 2.2-kb CK19 3′ enhancer element in pBLCAT3, shown to be necessary for cell-appropriate CK19 transgene expression,30Bader BL Franke WW Cell type-specific and efficient synthesis of human cytokeratin 19 in transgenic mice.Differentiation. 1990; 45: 109-118Crossref PubMed Scopus (31) Google Scholar, 31Hu L Gudas LJ Activation of keratin 19 gene expression by a 3′ enhancer containing an AP1 site.J Biol Chem. 1994; 269: 183-191Abstract Full Text PDF PubMed Google Scholar was received from Dr. Loraine Gudas (Cornell University, Ithaca, NY).31Hu L Gudas LJ Activation of keratin 19 gene expression by a 3′ enhancer containing an AP1 site.J Biol Chem. 1994; 269: 183-191Abstract Full Text PDF PubMed Google Scholar The Kpn I site in this plasmid was converted to Spe I, and the Spe I-flanked enhancer element was cloned into the Spe I site downstream of hPAP in pBSK19p-hPAP (generating pBSK19p-hPAP-K19e). To generate the CK19-TAg transgene, the TAg coding sequence together with its polyadenylation signal sequence was removed from the vector pBXΔ (provided by Dr. Richard Palmiter) via a Bam HI digest. This sequence was cloned into the Bam HI site of pBSK19p (generating pBSK19p-TAg). The Spe I-flanked 3′ enhancer element was cloned into the Spe I site of pBSK19p-TAg downstream of the TAg coding sequence (generating pBSK19p-TAg-K19e). Both transgenes were isolated from plasmid DNA by digesting with Sal I, followed by electrophoretic separation on 1% agarose gels, electro-elution from the gel fragment, phenol/chloroform extraction, alcohol precipitation, and resuspension in distilled water. Transgenic mice were generated by microinjection of transgene DNA into pronuclei of fertilized FVB-strain mouse eggs.32Brinster RL Chen HY Trumbauer ME Yagle MK Palmiter RD Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs.Proc Natl Acad Sci USA. 1985; 82: 4438-4442Crossref PubMed Scopus (784) Google Scholar Founder mice and their offspring were identified via polymerase chain reaction (PCR) analysis of tail DNA. A 2-mm piece of tail was digested with 500 μl of a 200 μg/ml proteinase K (Fisher Scientific, Pittsburgh, PA) solution in GNT-K buffer (50 mmol/L KCl, 1.5 mmol/L MgCl2, 10 mmol/L Tris-HCl, pH 8.5, 0.01% gelatin, 0.45% Nonidet P-40, 0.45% Tween) at 56°C, while shaken at 250 rpm for 4 to 18 hours. The proteinase K was heat-inactivated at 95°C for 15 minutes, and the digest was centrifuged at 14,000 rpm for 5 minutes. Two microliters of the supernatant were used in a PCR reaction mix with the primers 5′ CCATTGTTTGCAGTACATTGCATC 3′ and 5′ GGACCTTCTAGGTCTTGAAAGGAG 3′ (specific for the TAg coding region). hPAP primers were as described.33Kisseberth W Brettingen N Lohse J Sandgren E Ubiquitous expression of marker transgenes in mice and rats.Devel Biol. 1999; 214: 128-138Crossref PubMed Scopus (172) Google Scholar Thermocycler conditions were 1 cycle of 5 minutes at 92°C; 25–35 cycles of 45 seconds at 92°C, 1 minute at 60°C, and 1 minute at 72°C; then 1 cycle of 5 minutes at 72°C. A 10-μl aliquot was electrophoresed through a 2% agarose gel. Samples yielding a 258-bp product were considered positive for the transgene. For some studies, blood was collected from deeply anesthetized mice by cardiac puncture. Clinical chemistry analysis was performed on serum samples using a Vitros 250 Blood Chemistry Analyzer (Ortho Clinical Diagnostics, Raritan, NJ). Mice were housed in an AAALAC-approved facility under conditions that conformed to the Guide for the Care and Use of Laboratory Animals. All procedures were approved by the University of Wisconsin-Madison School of Veterinary Medicine Animal Care and Use Committee. Certain mice used in these studies have been assigned the following genetic designations: CK19-hPAP line 1281–4, TgN(Ck19ALPP)6Eps; and CK19-TAg line 1244–3, TgN(Ck19SV)7Eps. To label cells undergoing DNA synthesis, mice were injected with 200 mg/kg BrdU (Sigma, St. Louis, MO), a nucleotide analogue that is incorporated into DNA, and sacrificed 1 to 2 hours later. Following euthanasia, mice were examined grossly for the presence of lesions. Selected tissues were fixed in 10% neutral buffered formalin at room temperature overnight, in 4% paraformaldehyde in 0.1 mol/L NaP buffer at 4°C for 1 to 4 hours, or in Carnoy’s fixative at room temperature for 15 to 60 minutes. Tissues were transferred to 70% EtOH, paraffin-embedded, sectioned at 5 μ, mounted on a slide, and stained with hematoxylin and eosin. For immunohistochemistry, unstained sections were hydrated, blocked with 0.5% H2O2 in methanol, then exposed to 4N HCl for 20 minutes (BrdU only) or boiled in 0.1 Mol/L Tris pH 9.0 for 7–10 minutes in a microwave. Samples were incubated for 2 to 18 hours in a hydrated chamber with primary antibody diluted in PBS containing 0.5% nonfat dry milk. The anti-BrdU rat monoclonal (Accurate Scientific, Westbury, NY) was applied at a dilution of 1:40. The anti-TAg mouse monoclonal (Pab101, Santa Cruz Biotechnology, Santa Cruz, CA) was applied at a dilution of 1:200. The anti-cytokeratin 19 rat monoclonal TROMA 3 (kindly provided by Dr. Rolf Kemler, Max Planck Institute, Freiburg, Germany) was applied at a dilution of 1:100. The anti-uroplakin rabbit polyclonal antiserum (kindly provided by Dr. Tung-Tien Sun, New York Univ. Medical Center, New York, NY) was applied at a dilution of 1:500. Sections were rinsed and exposed for 30 minutes to the appropriate species-specific link antibody (BioGenex, San Ramon, CA), rinsed again, then exposed for 30 minutes to peroxidase- or alkaline phosphatase-conjugated streptavidin (BioGenex). After a final rinse, tissues were incubated for 5–10 minutes with diaminobenzidine (DAB, Sigma) or 10 to 30 minutes with New Fuchsin (BioGenex). Sections then were counterstained with hematoxylin (Polysciences, Inc, Warrington, PA) or nuclear fast red (PolyScientific, Bay Shore, NY), dehydrated through graded alcohols and xylene, and coverslipped. Paraformaldehyde-fixed tissues collected from CK19-hPAP and nontransgenic control mice were incubated in preheated AP buffer (0.1 mol/L NaCl, 5 mmol/L MgCl2, 0.1 mol/L Tris-HCl, pH 9.5) at 65°C for 45 minutes. Tissues then were incubated 18 to 40 hours in 0.17 mg/ml 5-Bromo-4-chloro-3-indolyl phosphate (BCIP; Sigma) in AP buffer at 37°C with gentle agitation. This produced a blue precipitate over cells expressing hPAP. Similarly, paraffin-embedded tissue sections were heat-inactivated at 65°C for 30 to 40 minutes, then exposed to BCIP solution for 18 to 40 hours. Tissue sections were counterstained with nuclear fast red for 1 to 2 minutes, dehydrated, and coverslipped. CK19-TAg mouse tumors were resected and minced with scissors in sterile phosphate buffered saline at approximately 0.25 g/ml. Between 0.1 and 0.3 ml of the resulting suspension was injected under the interscapular skin of syngeneic FVB nontransgenic mice. Animals were monitored daily to identify transplant growth latency. At the time of recipient sacrifice, portions of each tumor were fixed, sectioned, and stained as described above. Kidney from a nontransgenic mouse, primary bladder tumors, and transplanted tumors from CK19-TAg transgenic mice were frozen in liquid nitrogen and stored at −80°C. Tissues were thawed at 4°C in 0.33 g of tissue per ml of lysis buffer (50 μl of phenylmethylsulfonyl fluoride (PMSF), 24 μl aprotinin, and 10 μl leupeptin added to 5 ml ECB buffer, which contains 100 mmol/L NaF, 0.5% NP-40, 120 mmol/L NaCl, 50 mmol/L Tris-HCl, pH 8.0, and 200 μmol/L Na3VO4). The tissues were gently dounce homogenized for 12 to 15 strokes and/or homogenized with a spinning dounce head for 1 to 2 minutes at ∼6000 rpm at 4°C. Then 30 μl of PMSF per gram of tissue were added to each homogenate, and samples were incubated at 4°C for at least 30 minutes. The homogenates were centrifuged in 1.5-ml aliquots at 10,000 rpm for 20 minutes, and the resulting protein concentration of each supernatant was determined using Bradford analysis and UV spectrophotometry. Approximately 1 mg total protein was incubated at 4°C for 1 hour with 2 μg of a relevant mouse monoclonal antibody (anti-pRb, PharMingen, San Diego, CA, #14001A; anti-TAg Pab101, Santa Cruz, Santa Cruz, CA, #SC-147; and anti-p53, CalBiochem, La Jolla, CA, #OP03). Fresh lysis buffer was added to bring the total volume to 150 to 200 μl, then 40 μl of Protein G-Agarose (Gibco BRL, Rockville, MD) were added to each sample. Samples were inverted continuously overnight at 4°C, then centrifuged at 5200 rpm for 5 minutes at 4°C to pellet the agarose beads. Beads were washed four times by centrifuging at 5200 rpm 5 minutes at 4°C, each time decanting and adding 100 to 150 μl fresh RIPA buffer (50 μl PMSF, 24 μl aprotinin, and 10 μl leupeptin added to 5 ml of 1× PBS, 1% NP-40, and 0.5% sodium deoxycholate). Following the last wash, the Protein G-Agarose from each sample was frozen at -−80°C until analyzed via Western Blot Analysis. To each protein G-agarose pellet, 80 μl 1× TGE (125 mmol/L Tris, 1.25 mol/L glycine, 0.5% sodium dodecyl sulfate) and 20 μl loading dye were added, then each sample was boiled for 5 to 10 minutes and placed on ice. Thirty microliters of each sample were loaded onto a 10% stacking/8–12% resolving gel and electrophoresed at 120V to 160V for several hours. Colored molecular weight standards (Novex, Frankfurt, Germany, #LC5725) were loaded in separate wells. In general, electrophoresis was continued until a 26- to 30-kd marker was near the bottom of the gel. Proteins were transferred to PDVF membranes (Millipore, Bedford, MA, #IPVH15150) via electro-transfer in transfer buffer (25 μmol/L Tris-base, pH 8.3, 192 μmol/L glycine, and 20% methanol) at 30V overnight or 100V for 1 hour. Membranes were rinsed in water, dipped in methanol, then dried for 30 minutes (or stored at room temperature) before exposure to 20% methanol to allow visualization of protein bands. Membranes then were dipped in methanol, washed in water, and blocked in 5% low-fat milk dissolved in PBS-T (1× PBS and 0.1% Tween-20) for 30–90 minutes. Membranes were incubated with the anti-TAg antibody (2 μg antibody in 10 ml of the blocking buffer) for 1 hour at room temperature, washed in PBS-T once for 15 minutes and twice for 5 minutes, then incubated with secondary antibody (2 μl anti-mouse IgG saturated with human serum proteins (Pierce, Rockford, IL) in 10 ml blocking buffer) for 1 hour at room temperature. Membranes were washed once in PBS-T for 15 minutes and four times for 5 minutes, then incubated with Supersignal Substrate (Pierce) for 5 minutes. Finally, membranes were exposed to Kodak X-OMAT AR film for 30 seconds to 4 minutes. To determine the organ- and cell-specific pattern of expression of transgenes containing CK19 gene regulatory elements, six founder mice were generated that carried the CK19-hPAP transgene. hPAP provides a good marker because it remains active after fixation in 4% paraformaldehyde and paraffin embedding.33Kisseberth W Brettingen N Lohse J Sandgren E Ubiquitous expression of marker transgenes in mice and rats.Devel Biol. 1999; 214: 128-138Crossref PubMed Scopus (172) Google Scholar Multiple tissues were collected from CK19-hPAP founder mice or their offspring, fixed, and stained as either whole tissue or paraffin-embedded tissue mounted on a slide. hPAP protein activity was observed in 3 lineages, and staining generally conformed to the pattern expected for CK19 (Table 1). In particular, strong staining was observed in both basal and suprabasal urothelial cells (Figure 2A). Staining was observed consistently in some unexpected sites, including arterial endothelium and stroma underlying urothelium (Figure 2A). In the highest-expressing line, 1281–4, staining also was observed in urinary bladder smooth muscle. CK19-hPAP mice reproduced normally and displayed no gross or microscopic lesions in any tissue examined.Table 1hPAP Staining in CK19-hPAP Transgenic MiceLineageOrganCell type1281-41282-51282-2Bladderurothelial; stromal++++*Relative staining intensity in the listed cell types, ranging from intense (++++) to faint (+). (0) represents no staining, and (+/0) represents variable staining within a cell type. ND, not determined.++NDSalivary glandductal and acinar epithelium++++++++Skinfollicular epithelium++++++++++++Kidneydistal tubules; collecting ducts+++++++++Mesotheliummesothelial cells++++++Lungairway epithelium++++/0NDPancreasductal epithelium++++++++Prostatesecretory epithelium; stromal+++++NDMammaryductal epithelium++++++++Adrenal glandmedullary epithelium++NDNDLiverbiliary epithelium++0++Intestineenterocytes; goblet cells+++/0+/0Spleenarterial endothelium++++Organs were embedded in paraffin, sectioned at 5 μm, incubated with BCIP, and examined microscopically. The predominant cell type displaying blue reaction product is noted. Most tissues also displayed staining of arterial endothelium.* Relative staining intensity in the listed cell types, ranging from intense (++++) to faint (+). (0) represents no staining, and (+/0) represents variable staining within a cell type. ND, not determined. Open table in a new tab Organs were embedded in paraffin, sectioned at 5 μm, incubated with BCIP, and examined microscopically. The predominant cell type displaying blue reaction product is noted. Most tissues also displayed staining of arterial endothelium. Five CK19-TAg transgenic founder mice were generated, but 3 were found dead shortly after birth. Of 2 surviving founder mice, one remained healthy for 16 months of age, did not develop lesions, and did not pass the transgene to any of 8 offspring. The other founder mouse (designated 1244–3) developed a large urinary bladder neoplasm and was sacrificed at 80 days of age. Transgenic offspring of this mouse displayed significantly reduced weight gains (transgenic mice weighed approximately 70% as much as nontransgenic mice at 9 weeks of age;P < 0.003). Beginning at 10 weeks of age, both male and female CK19-TAg mice developed ruffled coats and lethargy, and they required sacrifice at a median age of 12 weeks of age (range, 11–14 weeks; n = 35). Gross examination of diseased mice revealed the presence in all transgenic mice of a moderately firm, tan to red mass, 1 to 3 cm in diameter, in the pelvic region within and/or surrounding the urinary bladder (Figure 2B and" @default.
• W2059044738 created "2016-06-24" @default.
• W2059044738 creator A5017375931 @default.
• W2059044738 creator A5039963746 @default.
• W2059044738 date "2000-09-01" @default.
• W2059044738 modified "2023-10-03" @default.
• W2059044738 title "Highly Invasive Transitional Cell Carcinoma of the Bladder in a Simian Virus 40 T-Antigen Transgenic Mouse Model" @default.
• W2059044738 cites W1503409848 @default.
• W2059044738 cites W1508766551 @default.
• W2059044738 cites W1510677006 @default.
• W2059044738 cites W1530427417 @default.
• W2059044738 cites W1543659524 @default.
• W2059044738 cites W1593827242 @default.
• W2059044738 cites W1599295812 @default.
• W2059044738 cites W1874413914 @default.
• W2059044738 cites W1968458490 @default.
• W2059044738 cites W1998595021 @default.
• W2059044738 cites W1999039175 @default.
• W2059044738 cites W2009495823 @default.
• W2059044738 cites W2016693266 @default.
• W2059044738 cites W2028869586 @default.
• W2059044738 cites W2034000112 @default.
• W2059044738 cites W2037179040 @default.
• W2059044738 cites W2075903015 @default.
• W2059044738 cites W2076249181 @default.
• W2059044738 cites W2084684861 @default.
• W2059044738 cites W2100413302 @default.
• W2059044738 cites W2102917490 @default.
• W2059044738 cites W2111600528 @default.
• W2059044738 cites W2117511031 @default.
• W2059044738 cites W2127804916 @default.
• W2059044738 cites W2132019133 @default.
• W2059044738 cites W2135401506 @default.
• W2059044738 cites W2146640069 @default.
• W2059044738 cites W2163006583 @default.
• W2059044738 cites W2163130545 @default.
• W2059044738 cites W2171983002 @default.
• W2059044738 cites W2405092215 @default.
• W2059044738 cites W2415523711 @default.
• W2059044738 cites W2439295556 @default.
• W2059044738 cites W2471372127 @default.
• W2059044738 cites W37569660 @default.
• W2059044738 cites W4248719549 @default.
• W2059044738 cites W4298263931 @default.
• W2059044738 cites W68785682 @default.
• W2059044738 cites W87885556 @default.
• W2059044738 cites W96160172 @default.
• W2059044738 cites W2024674417 @default.
• W2059044738 doi "https://doi.org/10.1016/s0002-9440(10)64594-4" @default.
• W2059044738 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1885716" @default.
• W2059044738 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10980120" @default.
• W2059044738 hasPublicationYear "2000" @default.
• W2059044738 type Work @default.
• W2059044738 sameAs 2059044738 @default.
• W2059044738 citedByCount "71" @default.
• W2059044738 countsByYear W20590447382012 @default.
• W2059044738 countsByYear W20590447382013 @default.
• W2059044738 countsByYear W20590447382014 @default.
• W2059044738 countsByYear W20590447382015 @default.
• W2059044738 countsByYear W20590447382016 @default.
• W2059044738 countsByYear W20590447382017 @default.
• W2059044738 countsByYear W20590447382018 @default.
• W2059044738 countsByYear W20590447382019 @default.
• W2059044738 countsByYear W20590447382020 @default.
• W2059044738 countsByYear W20590447382021 @default.
• W2059044738 countsByYear W20590447382023 @default.
• W2059044738 crossrefType "journal-article" @default.
• W2059044738 hasAuthorship W2059044738A5017375931 @default.
• W2059044738 hasAuthorship W2059044738A5039963746 @default.
• W2059044738 hasBestOaLocation W20590447381 @default.
• W2059044738 hasConcept C102230213 @default.
• W2059044738 hasConcept C104317684 @default.
• W2059044738 hasConcept C121608353 @default.
• W2059044738 hasConcept C141035611 @default.
• W2059044738 hasConcept C142724271 @default.
• W2059044738 hasConcept C147483822 @default.
• W2059044738 hasConcept C159047783 @default.
• W2059044738 hasConcept C203014093 @default.
• W2059044738 hasConcept C2522874641 @default.
• W2059044738 hasConcept C2776488936 @default.
• W2059044738 hasConcept C2778065480 @default.
• W2059044738 hasConcept C2780352672 @default.
• W2059044738 hasConcept C502942594 @default.
• W2059044738 hasConcept C54355233 @default.
• W2059044738 hasConcept C71924100 @default.
• W2059044738 hasConcept C86803240 @default.
• W2059044738 hasConceptScore W2059044738C102230213 @default.
• W2059044738 hasConceptScore W2059044738C104317684 @default.
• W2059044738 hasConceptScore W2059044738C121608353 @default.
• W2059044738 hasConceptScore W2059044738C141035611 @default.
• W2059044738 hasConceptScore W2059044738C142724271 @default.
• W2059044738 hasConceptScore W2059044738C147483822 @default.
• W2059044738 hasConceptScore W2059044738C159047783 @default.
• W2059044738 hasConceptScore W2059044738C203014093 @default.
• W2059044738 hasConceptScore W2059044738C2522874641 @default.
• W2059044738 hasConceptScore W2059044738C2776488936 @default.
• W2059044738 hasConceptScore W2059044738C2778065480 @default.
• W2059044738 hasConceptScore W2059044738C2780352672 @default.

• next