FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2059253071> ?p ?o ?g. }

• W2059253071 endingPage "33420" @default.
• W2059253071 startingPage "33413" @default.
• W2059253071 abstract "Hematopoietic lineage cell-specific protein 1 (HS1) is an F-actin- and actin-related proteins 2 and 3 (Arp2/3)-binding protein that undergoes a rapid tyrosine phosphorylation upon B cell antigen receptor (BCR) activation. Density gradient centrifugation of Triton X-100 lysates from B lymphocytes demonstrated that HS1 was translocated in response to BCR cross-linking into lipid raft microdomain along with Arp2/3 complex and Wiskott-Aldrich syndrome protein. HS1-green fluorescent protein was localized in membrane patches enriched with GM1 gangliosides and BCR in the cells treated with anti-IgM antibody. Colocalization of HS1-green fluorescent protein with BCR was also correlated with tyrosine phosphorylation of HS1. Interestingly a murine HS1 mutant at the tyrosine residues Tyr388 and Tyr405 targeted by Syk failed to respond to BCR cross-linking for either translocation into lipid rafts or colocalization with BCR within cells. Furthermore HS1 was unable to translocate into lipid rafts in a chicken B cell line deficient in Syk. Reintroducing a Syk construct into the Syk knock-out cells recovered effectively both tyrosine phosphorylation and translocation of HS1 into lipid rafts. In contrast, translocation of HS1 into rafts was normal in a Lyn knock-out B cell line, and an HS1 mutant at the tyrosine residue Tyr222 targeted by Lyn maintained the ability to partition into rafts upon BCR cross-linking. These data indicate that Syk plays an important role in the translocation of HS1 into lipid rafts and may be responsible for actin assembly recruitment to rafts and subsequent antigen presentations. Hematopoietic lineage cell-specific protein 1 (HS1) is an F-actin- and actin-related proteins 2 and 3 (Arp2/3)-binding protein that undergoes a rapid tyrosine phosphorylation upon B cell antigen receptor (BCR) activation. Density gradient centrifugation of Triton X-100 lysates from B lymphocytes demonstrated that HS1 was translocated in response to BCR cross-linking into lipid raft microdomain along with Arp2/3 complex and Wiskott-Aldrich syndrome protein. HS1-green fluorescent protein was localized in membrane patches enriched with GM1 gangliosides and BCR in the cells treated with anti-IgM antibody. Colocalization of HS1-green fluorescent protein with BCR was also correlated with tyrosine phosphorylation of HS1. Interestingly a murine HS1 mutant at the tyrosine residues Tyr388 and Tyr405 targeted by Syk failed to respond to BCR cross-linking for either translocation into lipid rafts or colocalization with BCR within cells. Furthermore HS1 was unable to translocate into lipid rafts in a chicken B cell line deficient in Syk. Reintroducing a Syk construct into the Syk knock-out cells recovered effectively both tyrosine phosphorylation and translocation of HS1 into lipid rafts. In contrast, translocation of HS1 into rafts was normal in a Lyn knock-out B cell line, and an HS1 mutant at the tyrosine residue Tyr222 targeted by Lyn maintained the ability to partition into rafts upon BCR cross-linking. These data indicate that Syk plays an important role in the translocation of HS1 into lipid rafts and may be responsible for actin assembly recruitment to rafts and subsequent antigen presentations. Immune response in mammals is initiated by coordinated recognition of foreign antigens through cell surface receptors on lymphocytes. B cell antigen receptor (BCR), 1The abbreviations used are: BCR, B cell antigen receptor; Arp2/3, actin-related proteins 2 and 3; HS1, hematopoietic lineage cell-specific protein 1, GFP, green fluorescent protein; RFP, red fluorescent protein; WASP, Wiskott-Aldrich syndrome protein; SH, Src homology; GM1, Galβ1,3GalNAcβ1,4Gal(3,2αNeuAc)β1,4Glcβ1,1Cer; TRITC, tetramethylrhodamine isothiocyanate rhodamine; CTB, cholera toxin B; PBS, phosphate-buffered saline. the complex of membrane-bound IgM, Igα, and Igβ, is the primary machinery to recognize antigens and provoke signaling cascades for proliferation and maturation of B lymphocytes into specific memory cells (1Reth M. Wienands J. Annu. Rev. Immunol. 1997; 15: 453-479Crossref PubMed Scopus (372) Google Scholar). Recent studies indicate that BCR-mediated signaling events often occur in membrane microdomains or lipid rafts that are rich in glycosphingolipid and cholesterol (2Pierce S.K. Nat. Rev. Immunol. 2002; 2: 96-105Crossref PubMed Scopus (283) Google Scholar, 3Cheng P.C. Dykstra M.L. Mitchell R.N. Pierce S.K. J. Exp. Med. 1999; 190: 1549-1560Crossref PubMed Scopus (412) Google Scholar, 4Simons K. Toomre D. Nat. Rev. Mol. Cell. Biol. 2000; 1: 31-39Crossref PubMed Scopus (5187) Google Scholar). Lipid rafts tend to select certain types of proteins and exclude others (4Simons K. Toomre D. Nat. Rev. Mol. Cell. Biol. 2000; 1: 31-39Crossref PubMed Scopus (5187) Google Scholar), thereby creating a specific environment wherein a protein can be phosphorylated by local tyrosine kinases and may become prone to interact with other local proteins in the same local environment. In lymphocytes lipid rafts undergo frequent clustering and form membrane patches upon receptor cross-linking. Consequently the lipid raft-associated molecules often display asymmetric distribution. Many processes of membrane clustering appear to be dependent on reorganization of the actin cytoskeleton meshwork, which is associated with lipid rafts on the inner side of the plasma membrane (5Rodgers W. Zavzavadjian J. Exp. Cell Res. 2001; 267: 173-183Crossref PubMed Scopus (59) Google Scholar). The actin assembly is also necessary for the maintenance of the integrity of lipid raft (6Gomez-Mouton C. Abad J.L. Mira E. Lacalle R.A. Gallardo E. Jimenez-Baranda S. Illa I. Bernad A. Manes S. Martinez A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 9642-9647Crossref PubMed Scopus (434) Google Scholar), the antigen transportation into endosomes following BCR cross-linking (7Brown B.K. Song W. Traffic. 2001; 2: 414-427Crossref PubMed Scopus (76) Google Scholar), and the formation of immunological synapses (8Jordan S. Rodgers W. J. Immunol. 2003; 171: 78-87Crossref PubMed Scopus (43) Google Scholar). However, the mechanism for the recruitment of actin assembly to lipid rafts is unclear. Upon receptor cross-linking, actin assembly is rapidly initiated in lipid rafts in a tyrosine phosphorylation-dependent manner (9Harder T. Simons K. Eur. J. Immunol. 1999; 29: 556-562Crossref PubMed Scopus (305) Google Scholar). Interestingly BCR cross-linking also provokes translocation of BCR itself into lipid rafts in an actin-independent manner (2Pierce S.K. Nat. Rev. Immunol. 2002; 2: 96-105Crossref PubMed Scopus (283) Google Scholar), suggesting that BCR in the rafts may trigger a signal transduction that ultimately leads to actin assembly. It is known that an early phase of the BCR-mediated signal transduction involves activation of several non-receptor protein-tyrosine kinases including Lyn and Syk, thereby resulting in tyrosine phosphorylation of multiple intracellular proteins (10Kurosaki T. Int. J. Mol. Med. 1998; 1: 515-527PubMed Google Scholar). One of the prominent phosphorylated proteins upon BCR cross-linking is HS1, which is expressed exclusively in cells of hematopoietic and lymphoid origins (11Kitamura D. Kaneko H. Miyagoe Y. Ariyasu T. Watanabe T. Nucleic Acids Res. 1989; 17: 9367-9379PubMed Google Scholar). HS1 is structurally related to cortactin, a cortical actin-associated protein that is expressed in most adherent cells and implicated in the actin assembly mediated by Arp2/3 complex (12Uruno T. Liu J. Li Y. Smith N. Zhan X. J. Biol. Chem. 2003; 278: 26086-26093Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Like cortactin, HS1 contains a characteristic repeated domain comprised of three and one-half 37-amino acid repeat units, a Src homology 3 (SH3) domain at the C terminus, and an Arp2/3 binding domain at the N terminus (Fig. 1A). Our recent study has demonstrated that HS1 promotes actin assembly and branching by binding to both Arp2/3 complex and F-actin (13Uruno T. Zhang P. Liu J. Hao J.J. Zhan X. Biochem. J. 2003; 371: 485-493Crossref PubMed Scopus (65) Google Scholar). A pathological significance of HS1 binding to F-actin has been indicated in a recent report that aberrant expression of an HS1 mutant lacking a functional domain for F-actin binding is genetically associated with systemic lupus erythematosus, an autoimmune disease characterized by the activation of autoreactive B lymphocytes (14Sawabe T. Horiuchi T. Koga R. Tsukamoto H. Kojima T. Harashima S. Kikuchi Y. Otsuka J. Mitoma H. Yoshizawa S. Niho Y. Watanabe T. Genes Immun. 2003; 4: 122-131Crossref PubMed Scopus (13) Google Scholar). Studies with HS1 knock-out mice, which displayed a defect in antigen-induced clonal expansion and lymphocyte deletion (15Taniuchi I. Kitamura D. Maekawa Y. Fukuda T. Kishi H. Watanabe T. EMBO J. 1995; 14: 3664-3678Crossref PubMed Scopus (108) Google Scholar), demonstrated that HS1 is intimately implicated in BCR and T cell receptor signalings. There is also evidence showing that HS1 is required for the apoptotic response to BCR cross-linking because B cells with low levels of HS1 expression are apparently resistant to apoptosis (16Fukuda T. Kitamura D. Taniuchi I. Maekawa Y. Benhamou L.E. Sarthou P. Watanabe T. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7302-7306Crossref PubMed Scopus (64) Google Scholar). However, the molecular mechanism for the function of HS1 in BCR signaling remains to be established. Biochemical studies have established HS1 as a prominent substrate of protein-tyrosine kinases Syk and Src family proteins including Lyn, Fgr, Fyn, and Lck (17Yamanashi Y. Okada M. Semba T. Yamori T. Umemori H. Tsunasawa S. Toyoshima K. Kitamura D. Watanabe T. Yamamoto T. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 3631-3635Crossref PubMed Scopus (142) Google Scholar, 18Winding P. Berchtold M.W. J. Immunol. Methods. 2001; 249: 1-16Crossref PubMed Scopus (109) Google Scholar, 19Brunati A.M. Donella-Deana A. James P. Quadroni M. Contri A. Marin O. Pinna L.A. J. Biol. Chem. 1999; 274: 7557-7564Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar, 20Ruzzene M. Brunati A.M. Marin O. Donella-Deana A. Pinna L.A. Biochemistry. 1996; 35: 5327-5332Crossref PubMed Scopus (43) Google Scholar). Direct association of HS1 with Lyn or Lck is evident in T and B lymphocytes and erythroid cells during the differentiation mediated by erythropoietin (21Takemoto Y. Sato M. Furuta M. Hashimoto Y. Int. Immunol. 1996; 8: 1699-1705Crossref PubMed Scopus (34) Google Scholar, 22Takemoto Y. Furuta M. Li X.K. Strong-Sparks W.J. Hashimoto Y. EMBO J. 1995; 14: 3403-3414Crossref PubMed Scopus (78) Google Scholar, 23Ingley E. Sarna M.K. Beaumont J.G. Tilbrook P.A. Tsai S. Takemoto Y. Williams J.H. Klinken S.P. J. Biol. Chem. 2000; 275: 7887-7893Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). A complex of HS1 and Lck with human immunodeficiency virus type-1 virions was also reported (24Ott D.E. Coren L.V. Johnson D.G. Kane B.P. Sowder R.C. Kim Y.D. Fisher R.J. Zhou X.Z. Lu K.P. Henderson L.E. Virology. 2000; 266: 42-51Crossref PubMed Scopus (113) Google Scholar). Although HS1 can be targeted by multiple tyrosine kinases, phosphorylation of HS1 at a full level requires a sequential and coordinated process involving Syk and Src. Phosphorylation is first initiated by Syk at Tyr388/Tyr405 in murine HS1 or Tyr378/Tyr397 in human HS1 and subsequently by Src-related kinases at Tyr222, presumably due to an enhanced interaction between phosphorylated HS1 and the SH2 domain of Src kinases (20Ruzzene M. Brunati A.M. Marin O. Donella-Deana A. Pinna L.A. Biochemistry. 1996; 35: 5327-5332Crossref PubMed Scopus (43) Google Scholar, 21Takemoto Y. Sato M. Furuta M. Hashimoto Y. Int. Immunol. 1996; 8: 1699-1705Crossref PubMed Scopus (34) Google Scholar). However, the physiological role of HS1 phosphorylation has not yet been illustrated. In this study, we show that HS1 was recruited along with Arp2/3 complex and WASP into lipid rafts and associated with BCR upon BCR cross-linking in a tyrosine phosphorylation-dependent manner. We also show that the process of HS1 translocation into lipid rafts requires Syk and its mediated tyrosine phosphorylation. Thus, our data imply that tyrosine phosphorylation of HS1 mediated by Syk may be an important mechanism to induce actin assembly within lipid rafts in response to antigen stimulation. Cell Lines and Antibodies—Immature mouse B cell line WEHI-231 was obtained from American Type Culture Collection (ATCC, Manassas, VA) and maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 50 μm 2-mercaptoethanol, and penicillin-streptomycin (Invitrogen). Chicken DT40, DT40Syk-/-, and DT40Lyn-/- cells were provided by Dr. Tomohiro Kurosaki (Kansai Medical University, Moriguchi, Japan). Cells were cultured in RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum, 1% chicken serum, 50 μm 2-mercaptoethanol, and penicillin-streptomycin. Rabbit polyclonal antibody specific to mouse HS1 was raised against a peptide corresponding to amino acids 306-320. Mouse anti-HS1 monoclonal antibody was from StressGen Biotechnologies (Victoria, Canada). Lyn, CD71 (H-300), and histone H1 (AE-4) antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-WASP and phosphotyrosine monoclonal antibody (4G10) were from Upstate Biotechnology (Lake Placid, NY). TRITC-conjugated goat F(ab′)2 fragment anti-mouse IgM, fluorescein isothiocyanate-conjugated goat F(ab′)2 fragment anti-mouse IgM, and peroxidase-conjugated Affini-Pure F(ab′)2 fragment goat anti-mouse IgM were from Jackson Immunoresearch Laboratories (West Grove, PA). All anti-IgM antibodies are specifically against the μ chain. Goat anti-mouse IgM and IgG antibodies were from Sigma. Cholera toxin B (CTB) subunit conjugated with peroxidase was from Sigma, and TRITC-CTB conjugate was from List Biological Laboratories (Campbell, CA). Goat anti-chicken IgM antibodies were from Bethyl Laboratories (Montgomery, TX). Plasmid Constructions—Plasmid pHJ117, which encodes HS1-GFP, was prepared by PCR. Briefly a murine HS1 cDNA clone from ATCC was used as the template in PCR using CCGGAATTCATGTGGAAGTCTGTAGTGGGGC and CGCGGATCCAGGAGCTTGACATAGTTTG CAGG (EcoRI and BamHI sites are underlined) as primers. The resulting PCR product was inserted into the EcoRI and BamHI sites of pEGFP-N1 (Clontech). To prepare virus HS1-GFP, the EcoRI-NotI fragment of HS1-GFP from pHJ117 was inserted into the EcoRI and NotI sites of retroviral vector MGIN (a gift of Dr. Robert Hawley, Holland Laboratory), resulting in plasmid pHJ124. To prepare pHJ133 encoding HS1Y388F/Y405F-GFP, point mutations at Y388F and Y405F were generated using the Transformer site-directed mutagenesis kit (Clontech) based on pHJ117. The resulting DNA fragment was inserted into the EcoRI and NotI sites of MGIN. Plasmid pHJ172, which encodes human Syk tagged by red fluorescent protein (RFP) at its C terminus, was prepared by PCR using pCDNA3.1-Syk (a gift of Dr. Susette C. Mueller) as the template and CCGGAATTCATGGCCAGCAGCGGCATGGC and CGCGGATCCCGGTTCACCACGTCATAGTAGTA (EcoRI and BamHI sites are underlined) as primers. The resulting PCR product was inserted into the EcoRI and BamHI sites of pDsRed-Express-N1 (Clontech). The EcoRINotI fragment encoding Syk-RFP was isolated from pHJ172 and further inserted into the EcoRI and NotI sites of retroviral vector MGIN, resulting in plasmid pHJ179. Virus Preparation and Viral Infection—Retrovirus-packaging cells (293GPG) were the gift of Dr. Richard C. Mulligan, Harvard Medical School (Boston, MA) and were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 1 mm sodium pyruvate, 2 mml-glutamine, antibiotics, 2 μg/ml puromycin, and 1 μg/ml tetracycline. Packaging cells (1 × 106) were transfected with pHJ124 or pHJ133 using Superfect transfection reagent (Qiagen Inc., Valencia, CA). To harvest viruses, the transfectants were grown in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, 1 mm sodium pyruvate, and 2 mml-glutamine. The medium of the transfectants was collected at 48, 72, and 96 h after transfection and filtered through a 0.45-μm filter (Gelman Sciences, Ann Harbor, MI). The virus medium was stored at -70 °C. For viral infection, WEHI-231 cells or DT40 cells were plated at a density of 2 × 105 in 35-mm dishes. On the next day, the medium was replaced with 1 ml of fresh medium containing 8 μg/ml Polybrene and 1 ml of viral supernatant. After 24 h of incubation, the culture medium was changed to the same fresh medium containing 1 mg/ml G418 for WEHI-231 cells or 2 mg/ml G418 for DT40 cells. Expression of GFP proteins was verified by fluorescence microscopy. To increase the efficiency of infection, the cells were infected with the same viruses for two or three times. After 2 weeks of selection in the medium containing G418, the cells were sorted in a fluorescence-activated cell sorting system (BD Biosciences) according to light scatter and fluorescence intensity. To express human Syk into DT40Syk-/- cells bearing HS1-GFP, the cells were reinfected with the virus pHJ179. Expression of Syk-RFP was verified by fluorescence microscopy and Western blot. Immunoprecipitation and Immunoblotting—Cells (1 × 107) to be analyzed were washed once with phosphate-buffered saline (PBS), suspended in 1 ml of a serum-free medium, and treated with 20 μg/ml anti-IgM antibodies at 37 °C. After incubation for the times as indicated, the cells were mixed with 6 ml of ice-cold PBS. Following one wash with cold PBS, cells were lysed in 500 μl of TNE buffer (1% Triton X-100, 10 mm Tris-HCl, pH 7.5, 150 mm NaCl, 2 mm Na3VO4, and 5 mm EDTA) containing protease inhibitor mixture (Roche Applied Science) and centrifuged briefly to remove insoluble materials. The supernatants were immunoprecipitated with protein G-Sepharose coupled with HS1 monoclonal antibody or GFP monoclonal antibody. In some experiments, immunoprecipitation was performed with protein A-Sepharose coupled with appropriate polyclonal antibodies. The immunoprecipitates and aliquots of cell lysates were resolved by 10% (v/v) SDS-PAGE, transferred to Millipore Immobilon polyvinylidene difluoride membrane, and immunoblotted using appropriate primary antibodies followed by secondary peroxidase-conjugated antibodies (Bio-Rad). Blots were visualized with enhanced chemiluminescence (ECL, Amersham Biosciences) and autoradiography. Gel quantification was performed based on analysis of scanned blot images using Scion Image software. Lipid Raft Isolation—Lipid rafts were isolated by lysis of cells in Triton X-100 followed by sucrose density gradient centrifugation as described previously (3Cheng P.C. Dykstra M.L. Mitchell R.N. Pierce S.K. J. Exp. Med. 1999; 190: 1549-1560Crossref PubMed Scopus (412) Google Scholar). In brief, WEHI-231 or DT40 cells (1 × 108) in 10 ml of growth medium were stimulated with goat anti-IgM antibody (20 μg/ml) at 37 °C for 5 or 15 min. The treated cells were collected and lysed for 30 min on ice in TNE buffer containing protease inhibitor mixture. The lysates were homogenized with a Dounce homogenizer and centrifuged at 900 × g for 10 min to remove nuclei and cellular debris. All procedures were performed on ice. The clarified supernatants were diluted 1:1 with 85% sucrose in TNE buffer, and 2 ml of the solution was layered at the bottom of a Beckman 14 × 89-mm centrifuge tube. The lysate was then overlaid with 6 ml of 35% sucrose and 4 ml of 5% sucrose in TNE buffer. The samples were centrifuged at 38,500 rpm in an SW41 rotor for 18-20hat4 °C. Twelve fractions of 1 ml each were collected from the top of the gradient after centrifugation. Aliquots of each fraction with the same volume were resolved by 10% (v/v) SDS-PAGE and immunoblotted with appropriate antibodies. In some experiments, the blot membrane was stripped and reblotted with antibodies as indicated. Immunofluorescence Microscopy—To analyze colocalization of HS1-GFP or HS1Y388F/Y405F-GFP with GM1, cells grown at log phase were stained with 25 μg/ml TRITC-CTB for 20 min on ice and centrifuged briefly to remove unbound reagents. The pellets were resuspended in a serum-free medium and then incubated with 20 μg/ml anti-IgM antibodies at 37 °C for 5 min. The stimulated cells was washed once with cold PBS, resuspended in 50 μl of cold PBS, and placed on ice. Before microscopic inspection, 5 μl of the cell samples was transferred to a glass slide, covered with a glass coverslip, and inspected under a confocal microscope. The images captured by the digital camera on the microscope were further processed with Adobe Photoshop software. To analyze colocalization of HS1-GFP or HS1Y388F/Y405F-GFP with BCR, cells grown at log phase were stimulated by addition of 25 μg/ml TRITC-conjugated goat anti-mouse IgM followed by incubation at 37 °C for the times as indicated. For the time point at 0, cells were placed on ice for 5 min and incubated with TRITC-anti-IgM antibody on ice without shifting to 37 °C. The stimulated cells were washed once with cold PBS, resuspended in 50 μl of cold PBS, and examined as above. HS1 Is Cotranslocated into Lipid Rafts with Arp2/3 Complex and WASP—In an effort to explore the signaling pathway in which HS1 is involved, we examined the potential of HS1 to associate with lipid rafts of WEHI-231 B lymphocytes. The B cells were stimulated with anti-mouse IgM (μ chain) antibody, which cross-links BCR on the cell surface and subsequently triggers a signal cascade to apoptosis (25Reth M. Annu. Rev. Immunol. 1992; 10: 97-121Crossref PubMed Google Scholar). The treated cells were lysed in 1% Triton X-100, and the lysates were subjected to a sucrose gradient centrifugation (3Cheng P.C. Dykstra M.L. Mitchell R.N. Pierce S.K. J. Exp. Med. 1999; 190: 1549-1560Crossref PubMed Scopus (412) Google Scholar). Fractions of 1 ml were collected from the top of the centrifuge tube and analyzed for the presence of HS1 by immunoblotting with HS1 antibody. As shown in Fig. 1B, left panel, most HS1 proteins in non-treated cell lysates were found in fractions 10-12 near the bottom of the centrifugation tube. These fractions are rich in detergent-soluble materials as well as cytoskeletal proteins and thereby referred to here as high (density) fractions. Small amounts of HS1 proteins were also detected in fractions 4-6 in which lipid rafts are normally located (4Simons K. Toomre D. Nat. Rev. Mol. Cell. Biol. 2000; 1: 31-39Crossref PubMed Scopus (5187) Google Scholar). Lipid rafts in those fractions were verified by the presence of GM1 gangliosides and protein-tyrosine kinase Lyn, both of which are known to associate constitutively with lipid rafts (3Cheng P.C. Dykstra M.L. Mitchell R.N. Pierce S.K. J. Exp. Med. 1999; 190: 1549-1560Crossref PubMed Scopus (412) Google Scholar) (Fig. 1B). Upon BCR cross-linking, more HS1 proteins were apparently partitioned into rafts as evidenced by a gradual shifting from fraction 12 to fraction 5. HS1 was also found in the fractions 7-9 between high density and raft fractions of the stimulated cells. In contrast, CD71, the receptor for transferrin that is known to be a non-raft-associated protein (26Xavier R. Brennan T. Li Q. McCormack C. Seed B. Immunity. 1998; 8: 723-732Abstract Full Text Full Text PDF PubMed Scopus (840) Google Scholar, 27Shrivastava P. Katagiri T. Ogimoto M. Mizuno K. Yakura H. Blood. 2004; 103: 1425-1432Crossref PubMed Scopus (37) Google Scholar), was predominantly found in the high fractions of the cells treated with or without anti-IgM antibody. Trace amounts of CD71 detected in the raft fractions of non-treated cells may be caused by an incomplete solubility of membranes in the lysates, which might also explain the presence of some HS1 proteins in the raft fractions of non-stimulated cells. To ensure that the shifting of HS1 to the lighter fractions was not due to a nonspecific raft or membrane association, the same fractions were also probed with antibody against histone H1, which is not a membrane-associated protein. This analysis demonstrated histone H1 was exclusively distributed in high fractions of either stimulated or non-stimulated cells (Fig. 1B). Thus, the protein associated with fractions 7-9 may represent a transition form during the process of the recruitment of HS1 to lipid rafts. In addition to HS1, we also analyzed Arp2/3 complex and WASP as these molecules are also implicated in actin dynamics. Arp2/3 complex was detected by antibody against Arp3, a subunit of Arp2/3 complex (13Uruno T. Zhang P. Liu J. Hao J.J. Zhan X. Biochem. J. 2003; 371: 485-493Crossref PubMed Scopus (65) Google Scholar). Like HS1, these proteins were present predominantly in the high fractions of non-treated cells but also in the raft fractions of the cells treated with anti-IgM antibody (Fig. 1B). We also immunoblotted the fractions with anti-IgM antibody (μ chain-specific) to detect BCR. While there was significant BCR immunoreactivity found in lipid raft fractions in resting cells, a slightly gradual increase in the intensity of BCR bands in fractions 5-9 of the lysates derived from stimulated cells was evident, although the extent of the translocation appeared to be less significant than that for HS1. A previous report had described that translocation of BCR into rafts is more efficient in mature B lymphocyte CH27 cells than in WEHI-231 cells (28Sproul T.W. Malapati S. Kim J. Pierce S.K. J. Immunol. 2000; 165: 6020-6023Crossref PubMed Scopus (100) Google Scholar). Therefore, we analyzed the association of BCR and HS1 with raft fractions in the lysates from CH27 cells as well. Consistent with the previous report, the translocation of BCR into rafts was readily detected in CH27 cells (Fig. 1C). Residues Tyr388 and Tyr405 Are Required for HS1 Translocation into Lipid Rafts upon BCR Cross-linking—To study the role of HS1 in BCR signaling in more detail, we examined tyrosine phosphorylation of HS1 in WEHI-231 cells upon BCR cross-linking. As shown in Fig. 2, HS1 underwent a rapid tyrosine phosphorylation that reached a plateau within 5 min followed by a rapid decline and eventual disappearance in 2 h. The induction appeared to be specific for BCR cross-linking because no apparent increase in HS1 phosphorylation was observed in the cells treated with anti-IgG antibody (Fig. 2, right panels). This result is consistent with a previous report by others (17Yamanashi Y. Okada M. Semba T. Yamori T. Umemori H. Tsunasawa S. Toyoshima K. Kitamura D. Watanabe T. Yamamoto T. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 3631-3635Crossref PubMed Scopus (142) Google Scholar). To determine the tyrosine phosphorylation status of HS1 in rafts, we analyzed by phosphotyrosine immunoblot the HS1 associated with raft and high density fractions of the cells with and without anti-IgM antibody treatment. As shown in Fig. 2B, a significant level of phosphorylated HS1 was found in a pooled raft fraction of the stimulated cells. Next we analyzed whether tyrosine phosphorylation was required for HS1 raft association. As a result, we prepared a GFP-tagged murine HS1 mutant where Tyr388 and Tyr405 were replaced by phenylalanine; these residues correspond to Tyr378 and Tyr397 in human HS1 that are targets for Syk protein-tyrosine kinase (19Brunati A.M. Donella-Deana A. James P. Quadroni M. Contri A. Marin O. Pinna L.A. J. Biol. Chem. 1999; 274: 7557-7564Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). The resulting mutant, HS1Y388F/Y405F-GFP, was introduced into WEHI-231 cells via a retroviral vector. The defect of this mutant in tyrosine phosphorylation was verified by phosphotyrosine immunoblot (Fig. 3A). While HS1-GFP was readily phosphorylated in the cells treated with anti-IgM antibody, HS1Y388F/Y405F-GFP failed to show any increase in its phosphorylation level in response to BCR cross-linking. To visualize the distribution of HS1-GFP variants in relation to lipid rafts within cells, cells expressing HS1Y388F/Y405F-GFP and HS1-GFP were incubated with TRITC-CTB for GM1 ganglioside staining and anti-IgM antibody for BCR cross-linking. The treated live cells were then examined by confocal microscopy. As a control, cells without IgM antibody treatment were examined in parallel. In most (∼75%, n = 300) non-treated cells, HS1-GFP displayed a cell peripheral and punctate staining (Fig. 3B, a and a′), a pattern similar to what has been described for cortactin in adherent cells (29Liu J. Huang C. Zhan X. Oncogene. 1999; 18: 6700-6706Crossref PubMed Scopus (73) Google Scholar). A punctate staining was also seen with GM1 as detected by TRITC-CTB (Fig. 3B, b and b′). Some GM1 puncta were apparently colocalized with or in proximity to HS1-GFP puncta (Fig. 3B, c). After BCR cross-linking, both HS1-GFP and GM1 were evidently translocated into large patches in many cells (∼80%, n = 200) (Fig. 3B, d, e, d′, and e′) where their colocalization was more evident (Fig. 3B, f). In contrast, HS1Y388F/Y405F-GFP displayed a quite diffuse pattern in the cytoplasm either in most (∼95%, n = 200) non-treated cells (Fig. 3B, g and g′) or in the cells treated with anti-IgM antibody (Fig. 3B, j and j′). No colocalization of the mutant with GM1 was detected in patches under either condition (Fig. 3B, i and l). The lipid raft association with HS1-GFP and HS1Y388F/Y405F-GFP mutant was also examined by gradient centrifugation of Triton X-100 lysates of their overexpressors. As shown in Fig. 3C, both HS1-GFP and HS1Y388F/Y405F-GFP proteins were mainly found in the high fraction in resting cells. Upon BCR cross-linking, only HS1-GFP but not HS1Y388F/Y405F-GFP was shifted into the lipid raft fractions. These data indicate that lipid raft association requires functional tyrosine residues Tyr388 and Tyr405. Residues Tyr388 and Tyr405 Are Required for HS1 to Co" @default.
• W2059253071 created "2016-06-24" @default.
• W2059253071 creator A5001537486 @default.
• W2059253071 creator A5005939783 @default.
• W2059253071 creator A5073651132 @default.
• W2059253071 date "2004-08-01" @default.
• W2059253071 modified "2023-10-13" @default.
• W2059253071 title "Syk-mediated Tyrosine Phosphorylation Is Required for the Association of Hematopoietic Lineage Cell-specific Protein 1 with Lipid Rafts and B Cell Antigen Receptor Signalosome Complex" @default.
• W2059253071 cites W136542906 @default.
• W2059253071 cites W1564861448 @default.
• W2059253071 cites W1633029073 @default.
• W2059253071 cites W1774191128 @default.
• W2059253071 cites W1815877259 @default.
• W2059253071 cites W1862106564 @default.
• W2059253071 cites W1975500397 @default.
• W2059253071 cites W1980334501 @default.
• W2059253071 cites W1998368829 @default.
• W2059253071 cites W2000855635 @default.
• W2059253071 cites W2004979362 @default.
• W2059253071 cites W2013247982 @default.
• W2059253071 cites W2014304617 @default.
• W2059253071 cites W2019027747 @default.
• W2059253071 cites W2026659052 @default.
• W2059253071 cites W2030217314 @default.
• W2059253071 cites W2034146282 @default.
• W2059253071 cites W2036575265 @default.
• W2059253071 cites W2041794326 @default.
• W2059253071 cites W2045416076 @default.
• W2059253071 cites W2053987316 @default.
• W2059253071 cites W2054507865 @default.
• W2059253071 cites W2056668880 @default.
• W2059253071 cites W2063192139 @default.
• W2059253071 cites W2067585786 @default.
• W2059253071 cites W2068260663 @default.
• W2059253071 cites W2074932405 @default.
• W2059253071 cites W2084250362 @default.
• W2059253071 cites W2088463353 @default.
• W2059253071 cites W2095352560 @default.
• W2059253071 cites W2099555659 @default.
• W2059253071 cites W2101773396 @default.
• W2059253071 cites W2115037258 @default.
• W2059253071 cites W2134505654 @default.
• W2059253071 cites W2139846514 @default.
• W2059253071 cites W2156648441 @default.
• W2059253071 cites W2172393633 @default.
• W2059253071 doi "https://doi.org/10.1074/jbc.m313564200" @default.
• W2059253071 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15166239" @default.
• W2059253071 hasPublicationYear "2004" @default.
• W2059253071 type Work @default.
• W2059253071 sameAs 2059253071 @default.
• W2059253071 citedByCount "43" @default.
• W2059253071 countsByYear W20592530712012 @default.
• W2059253071 countsByYear W20592530712013 @default.
• W2059253071 countsByYear W20592530712015 @default.
• W2059253071 countsByYear W20592530712016 @default.
• W2059253071 countsByYear W20592530712018 @default.
• W2059253071 countsByYear W20592530712020 @default.
• W2059253071 countsByYear W20592530712021 @default.
• W2059253071 countsByYear W20592530712022 @default.
• W2059253071 countsByYear W20592530712023 @default.
• W2059253071 crossrefType "journal-article" @default.
• W2059253071 hasAuthorship W2059253071A5001537486 @default.
• W2059253071 hasAuthorship W2059253071A5005939783 @default.
• W2059253071 hasAuthorship W2059253071A5073651132 @default.
• W2059253071 hasBestOaLocation W20592530711 @default.
• W2059253071 hasConcept C101544691 @default.
• W2059253071 hasConcept C11960822 @default.
• W2059253071 hasConcept C170493617 @default.
• W2059253071 hasConcept C185592680 @default.
• W2059253071 hasConcept C2776165026 @default.
• W2059253071 hasConcept C2777553839 @default.
• W2059253071 hasConcept C35174551 @default.
• W2059253071 hasConcept C42362537 @default.
• W2059253071 hasConcept C55493867 @default.
• W2059253071 hasConcept C62478195 @default.
• W2059253071 hasConcept C79266657 @default.
• W2059253071 hasConcept C86803240 @default.
• W2059253071 hasConcept C95444343 @default.
• W2059253071 hasConceptScore W2059253071C101544691 @default.
• W2059253071 hasConceptScore W2059253071C11960822 @default.
• W2059253071 hasConceptScore W2059253071C170493617 @default.
• W2059253071 hasConceptScore W2059253071C185592680 @default.
• W2059253071 hasConceptScore W2059253071C2776165026 @default.
• W2059253071 hasConceptScore W2059253071C2777553839 @default.
• W2059253071 hasConceptScore W2059253071C35174551 @default.
• W2059253071 hasConceptScore W2059253071C42362537 @default.
• W2059253071 hasConceptScore W2059253071C55493867 @default.
• W2059253071 hasConceptScore W2059253071C62478195 @default.
• W2059253071 hasConceptScore W2059253071C79266657 @default.
• W2059253071 hasConceptScore W2059253071C86803240 @default.
• W2059253071 hasConceptScore W2059253071C95444343 @default.
• W2059253071 hasIssue "32" @default.
• W2059253071 hasLocation W20592530711 @default.
• W2059253071 hasOpenAccess W2059253071 @default.
• W2059253071 hasPrimaryLocation W20592530711 @default.
• W2059253071 hasRelatedWork W1534090153 @default.
• W2059253071 hasRelatedWork W1591309477 @default.
• W2059253071 hasRelatedWork W1987307749 @default.

• next