FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2059356721> ?p ?o ?g. }

• W2059356721 endingPage "11498" @default.
• W2059356721 startingPage "11487" @default.
• W2059356721 abstract "Occludin is hyperphosphorylated on Ser and Thr residues in intact epithelial tight junction (TJ); however, the role of this phosphorylation in the assembly of TJ is unclear. The influence of protein phosphatases PP2A and PP1 on the assembly of TJ and phosphorylation of occludin was evaluated in Caco-2 cells. Protein phosphatase inhibitors and reduced expression of PP2A-Cα and PP1α accelerated the calcium-induced increase in transepithelial electrical resistance and barrier to inulin permeability and also enhanced the junctional organization of occludin and ZO-1 during TJ assembly. Phosphorylation of occludin on Thr residues, but not on Ser residues, was dramatically reduced during the disassembly of TJ and was gradually increased during the reassembly. PP2A and PP1 co-immunoprecipitate with occludin, and this association was reduced during the assembly of TJ. Glutathione S-transferase (GST) pull-down assay using recombinant GST-occludin demonstrated that cellular PP2A and PP1 bind to the C-terminal tail of occludin, and these interactions were also reduced during the assembly of TJ. A pairwise binding assay using GST-occludin and purified PP2A and PP1 demonstrates that PP2A and PP1 directly interacts with the C-terminal tail of occludin. In vitro incubation of phospho-occludin with PP2A or PP1 indicated that PP2A dephosphorylates occludin on phospho-Thr residues, whereas PP1 dephosphorylates it on phospho-Ser. This study shows that PP2A and PP1 directly interact with occludin and negatively regulate the assembly of TJ by modulating the phosphorylation status of occludin. Occludin is hyperphosphorylated on Ser and Thr residues in intact epithelial tight junction (TJ); however, the role of this phosphorylation in the assembly of TJ is unclear. The influence of protein phosphatases PP2A and PP1 on the assembly of TJ and phosphorylation of occludin was evaluated in Caco-2 cells. Protein phosphatase inhibitors and reduced expression of PP2A-Cα and PP1α accelerated the calcium-induced increase in transepithelial electrical resistance and barrier to inulin permeability and also enhanced the junctional organization of occludin and ZO-1 during TJ assembly. Phosphorylation of occludin on Thr residues, but not on Ser residues, was dramatically reduced during the disassembly of TJ and was gradually increased during the reassembly. PP2A and PP1 co-immunoprecipitate with occludin, and this association was reduced during the assembly of TJ. Glutathione S-transferase (GST) pull-down assay using recombinant GST-occludin demonstrated that cellular PP2A and PP1 bind to the C-terminal tail of occludin, and these interactions were also reduced during the assembly of TJ. A pairwise binding assay using GST-occludin and purified PP2A and PP1 demonstrates that PP2A and PP1 directly interacts with the C-terminal tail of occludin. In vitro incubation of phospho-occludin with PP2A or PP1 indicated that PP2A dephosphorylates occludin on phospho-Thr residues, whereas PP1 dephosphorylates it on phospho-Ser. This study shows that PP2A and PP1 directly interact with occludin and negatively regulate the assembly of TJ by modulating the phosphorylation status of occludin. An important function of the epithelial tight junction (TJ) 2The abbreviations used are: TJ, tight junction; PBS, phosphate-buffered saline; HRP, horseradish peroxidase; ZO-1, ZO-2, and ZO-3, zonula occludens 1, 2, and 3; TER, transepithelial electrical resistance; PP2A, protein phosphatase 2A; PP2A-Cα, catalytic subunit of PP2A; PP1, protein phosphatase 1; PKC, protein kinase C; GST, glutathione S-transferase; GST-occludin-C, GST-conjugated C-terminal tail of occludin; p-, phosphorylated; DMEM, Dulbecco's modified Eagle's medium; MDCK cells, Madin-Darby canine kidney cells; si-, small interfering; PPase, phosphatase. is to form a barrier to the diffusion of pathogens, toxins, and allergens from the external environment into the tissues. The disruption of TJ plays a crucial role in the pathogenesis of a number of diseases related to the gastrointestinal tract, lung, and kidney (1Hollander D. Gut. 1994; 26: 1621-1624Google Scholar, 2Matthay M.A. Chest. 2002; 122: 340S-343SAbstract Full Text Full Text PDF PubMed Google Scholar, 3Lee D.B.N. Huang E. Ward H.J. Am. J. Physiol. 2006; 290: F20-F34Crossref PubMed Scopus (151) Google Scholar). The TJ is organized by specific interactions between a wide spectrum of proteins. Three types of transmembrane proteins, occludin (4Anderson J.M. Van Italie C.M. Am. J. Physiol. 1995; 269: G467-G475Crossref PubMed Google Scholar), claudins (5Tsukita S. Furuse M. Trends Cell Biol. 1999; 9: 268-273Abstract Full Text Full Text PDF PubMed Scopus (507) Google Scholar), and junctional adhesion molecule (6Martin-Padura L. Lostaglio S. Schneemann M. Williams L. Romano M. Feuscella P. Panzeri C. Stoppacciaro A. Ruco L. Villa A. Simmons D. Dejana E. J. Cell Biol. 1998; 142: 117-127Crossref PubMed Scopus (1158) Google Scholar) interact with other intracellular plaque proteins such as ZO-1, ZO-2, ZO-3, cingulin, and 7H6, which in turn anchor the transmembrane proteins to the actin cytoskeleton (7Wittchen E.S. Haskins J. Stevenson B.R. J. Biol. Chem. 1999; 49: 35179-35185Abstract Full Text Full Text PDF Scopus (411) Google Scholar, 8Furuse M. Itoh M. Hirose T. Nagafuchi A. Yonemura S. Tsukita S. Tsukita S. J. Cell Biol. 1994; 127: 1617-1626Crossref PubMed Scopus (809) Google Scholar, 9Goodenough D.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 319-321Crossref PubMed Scopus (66) Google Scholar). A significant body of evidence indicates that the activities of various intracellular signaling molecules regulate the integrity of TJ. The signaling pathways involving protein kinases and GTPase switch proteins regulate the TJ permeability in different epithelial monolayer (10Stuart R.O. Nigam S.K. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 6072-6076Crossref PubMed Scopus (245) Google Scholar, 11Denker B.M. Saha C. Khawaja S. Nigam S.K. J. Biol. Chem. 1996; 271: 25750-25753Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 12Ries J. Stein J. Traynis-Kaplan A.E. Barrett K.A. Am. J. Physiol. 1997; 272: C794-C803Crossref PubMed Google Scholar, 13Nusrat A. Giry M. Turner J.R. Colgan S.P. Parkos C.A. Carnes D. Lemichez E. Boquet P. Madara J.L. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 10629-10633Crossref PubMed Scopus (358) Google Scholar, 14Walsh S.W. Hopkins A.M. Chen J. Narumiya S. Parkos C.A. Nusrat A. Gastroenterology. 2001; 121: 566-579Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar, 15Rao R.K. Baker R.D. Baker S.S. Gupta A. Holycross M. Am. J. Physiol. 1997; 273: G812-G823PubMed Google Scholar, 16Rao R.K. Baker R.D. Baker S.S. Biochem. Pharmacol. 1999; 57: 685-695Crossref PubMed Scopus (81) Google Scholar, 17Rao R.K. Li L. Baker R.D. Baker S.S. Gupta A. Am. J. Physiol. 2000; 279: G332-G340Crossref PubMed Google Scholar, 18Atkinson K.A. Rao R.K. Am. J. Physiol. 2001; 280: G1280-G1288Crossref PubMed Google Scholar, 19Rao R.K. Basuroy S. Rao V.U. Karnaky K.J. Gupta A. (2002) Biochem. J. 2002; 368: 471-481Crossref PubMed Scopus (346) Google Scholar, 20Basuroy S. Sheth P. Kuppuswamy D. Balasubramanian S. Ray R.M. Rao R.K. J. Biol. Chem. 2003; 278: 11916-11924Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar, 21Chen Y.H. Lu Q. Goodenough D.A. Jeansonne B. Mol. Cell. Biol. 2002; 13: 1227-1237Crossref Scopus (144) Google Scholar, 22Sheth P. Basuroy S. Li C. Naren A.P. Rao R.K. J. Biol. Chem. 2003; 278: 49239-49245Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). Tyrosine kinases such as c-Yes, c-Src, and focal adhesion kinase are localized in the vicinity of TJ (4Anderson J.M. Van Italie C.M. Am. J. Physiol. 1995; 269: G467-G475Crossref PubMed Google Scholar). A number of previous studies have shown that oxidative stress induces disruption of TJ and an increase in paracellular permeability by a tyrosine kinase-dependent mechanism (15Rao R.K. Baker R.D. Baker S.S. Gupta A. Holycross M. Am. J. Physiol. 1997; 273: G812-G823PubMed Google Scholar, 16Rao R.K. Baker R.D. Baker S.S. Biochem. Pharmacol. 1999; 57: 685-695Crossref PubMed Scopus (81) Google Scholar, 17Rao R.K. Li L. Baker R.D. Baker S.S. Gupta A. Am. J. Physiol. 2000; 279: G332-G340Crossref PubMed Google Scholar, 19Rao R.K. Basuroy S. Rao V.U. Karnaky K.J. Gupta A. (2002) Biochem. J. 2002; 368: 471-481Crossref PubMed Scopus (346) Google Scholar, 20Basuroy S. Sheth P. Kuppuswamy D. Balasubramanian S. Ray R.M. Rao R.K. J. Biol. Chem. 2003; 278: 11916-11924Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar). Oxidative stress induces Tyr phosphorylation of a wide spectrum of proteins, including occludin, ZO-1, E-cadherin, and β-catenin (19Rao R.K. Basuroy S. Rao V.U. Karnaky K.J. Gupta A. (2002) Biochem. J. 2002; 368: 471-481Crossref PubMed Scopus (346) Google Scholar). Phosphorylation of occludin on Tyr residues results in the loss of its interaction with ZO-1, ZO-2, and ZO-3 (23Kale G. Rao R.K. Biochem. Biophys. Res. Commun. 2003; 302: 324-329Crossref PubMed Scopus (165) Google Scholar). Furthermore, recent studies have demonstrated that activation of c-Src (20Basuroy S. Sheth P. Kuppuswamy D. Balasubramanian S. Ray R.M. Rao R.K. J. Biol. Chem. 2003; 278: 11916-11924Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar) and phosphatidylinositol 3-kinase (22Sheth P. Basuroy S. Li C. Naren A.P. Rao R.K. J. Biol. Chem. 2003; 278: 49239-49245Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar) is involved in the oxidative stress-induced disruption of TJ in Caco-2 cell monolayer. Occludin is hyperphosphorylated on Ser and Thr residues (24Sakakibara A. Furuse M. Saitou M. Ando-Akatsuka Y. Tsukita S. J. Cell Biol. 1997; 137: 1393-1401Crossref PubMed Scopus (511) Google Scholar, 25Wong V. Am. J. Physiol. 1997; 273: C1859-C1867Crossref PubMed Google Scholar, 26Hirase T. Kawashima S. Wong E.Y.M. Ueyama T. Rikitake Y. Tsukita S. Yokoyama M. Staddon J.M. J. Biol. Chem. 2001; 276: 10423-10431Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar, 27Andreeva A.Y. Krause E. Muller E.-C. Blasig I.E. Utepbergenov D.I. J. Biol. Chem. 2001; 276: 38480-38486Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar) in an intact epithelium. Although the significance of Ser/Thr phosphorylation of occludin in TJ assembly is unclear, occludin is shown to undergo dephosphorylation on Ser/Thr residues during the disruption of TJ by calcium depletion, phorbol esters, or bacterial infection (28Farshori P. Kachar B. J. Membr. Biol. 1999; 170: 147-156Crossref PubMed Scopus (144) Google Scholar, 29Simonovic I. Rosenberg J. Koutsouris A. Hecht G. Cell. Microbiol. 2000; 2: 305-315Crossref PubMed Scopus (229) Google Scholar, 30Clarke H. Soler A.P. Mullin J.M. J. Cell Science. 2000; 113: 3187-3196Crossref PubMed Google Scholar). Phosphorylation of occludin on Ser/Thr residues may be mediated by atypical protein kinase C (PKC), such as PKCζ and PKCλ, which are localized in the vicinity of TJ (10Stuart R.O. Nigam S.K. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 6072-6076Crossref PubMed Scopus (245) Google Scholar). A previous study indicated that PP2A, a Ser/Thr-phosphatase, interacts with TJ protein complex and suggested that it may influence the integrity of TJ in MDCK cells that overexpress PP2A (31Nunbhakdi-Craig V. Machleidt M. Ogris E. Bellotto D. White C.L. Sontag E. J. Cell Biol. 2002; 158: 967-978Crossref PubMed Scopus (223) Google Scholar). Therefore, the balance between atypical PKC and PP2A may determine the Ser/Thr phosphorylation status of occludin. In the present study we examined the influence of endogenous PP2A and PP1 on the calcium switch-induced assembly of TJ in Caco-2 cells. This study demonstrates that 1) inhibition of PPase activity by selective inhibitors and reduced expression of PP2A-Cα or PP1α by siRNA and/or antisense oligonucleotides accelerates the assembly of TJ, 2) the assembly of TJ is associated with the phosphorylation of occludin on Thr residues, which is enhanced by reduced expression of PP2A, 3) PP2A and PP1 directly interact with occludin, and their interaction with occludin is reduced during the assembly of TJ, and 4) PP2A dephosphorylates occludin on p-Thr residues, whereas PP1 dephosphorylates it on p-Ser. Chemicals—Cell culture reagents and supplies and Oligofectamine® were purchased from Invitrogen. Fluorescein isothiocyanate-inulin, GSH, leupeptin, aprotinin, bestatin, pepstatin A, phenylmethylsulfonyl fluoride, GSH-agarose, Triton X 100, vanadate, Malachite green, protein-A-Sepharose, and protein-G-Sepharose were purchased from Sigma. Okadaic acid, fostriecin, and calyculin-A were purchased from Calbiochem. Purified PP2A, PP1, and phosphopeptide, RRApSVA (pS is phosphoserine), were purchased from Upstate (Charlottesville, VA). The PPase substrate phosphopeptide (KRpTIRR) and p-Tyr peptide DADEpYLIPQQG were custom synthesized by Sigma Genosys (St. Louis, MO). All other chemicals were of analytical grade purchased either from Sigma or Fisher. Antibodies—Mouse monoclonal anti-PP2A-Cα, anti-PP1α, HRP-conjugated anti-GST, and anti-PKCζ antibodies were purchased from BD Transduction. Mouse monoclonal anti-occludin, rabbit polyclonal anti-ZO-1, HRP-conjugated anti-occludin, rabbit polyclonal anti-p-Thr, and anti-p-Ser antibodies were purchased from Zymed Laboratories Inc. (San Francisco, CA). AlexaFluor 488-conjugated anti-mouse IgG antibody was obtained from Molecular Probes (Eugene, OR). Cy3-conjugated anti-rabbit IgG, HRP-conjugated anti-mouse IgG, anti-actin, and HRP-conjugated anti-rabbit IgG antibodies were purchased from Sigma. The specificity of anti-p-Thr and anti-p-Ser antibodies was confirmed by immunoblotting control cell extracts for p-Thr and p-Ser in the presence of varying concentrations of different peptides; RRApSVA, KRpTIRR, or DADEpYLIPQQG. Results are presented in Fig. 7, C and D. Antisense Oligonucleotide and siRNA—Antisense oligonucleotides were designed against the nucleotide sequence of the genes for catalytic subunits of human PP2A and human PP1. The nucleotide sequences of PP2A and PP1 were compared with each other using the ClustalW program, and unique sequences were selected for each protein. To determine the specificity of these oligos, the sequences were further verified by BLAST search of the known human genome databases, and no matches were found other than the respective proteins, confirming the uniqueness of these nucleotide sequences. The sequences of antisense oligos for PP2A and PP1 and the missense oligo are as follows: AS-PP2A-1, ttccggtcatggcaccagtt; AS-PP2A-2, ccttatctacagtcatgctg; AS-PP2A-3, cagtcacatcgtcttacagg; AS-PP1-1, gatgggtcggcctccagggt; AS-PP1-2, ctgaactgcccgtacttccc; AS-PP1-3, tttggcggaattgcggggtg; missense oligo, tatacgatggtacagtggagt. The sequence of the missense oligo did not match any sequence for human proteins. These antisense oligonucleotides were custom synthesized in the phosphorothioate and Cy3-conjugated form by Sigma Genosys and were purified by high performance liquid chromatography. siRNA to human PP2A-Cα and scrambled RNA control were purchased from Dharmacon (Lafayette, CO). Cell Culture—Caco-2 cells, purchased from American Type Culture Collection (Manassas, VA), were grown under standard cell culture conditions as described before (19Rao R.K. Basuroy S. Rao V.U. Karnaky K.J. Gupta A. (2002) Biochem. J. 2002; 368: 471-481Crossref PubMed Scopus (346) Google Scholar). Cells were grown on polycarbonate membranes in Transwells (6.5, 12, or 24 mm; Costar, Cambridge, MA), and experiments were conducted 11-13 days (6.5 or 12 mm Transwells) or 17-19 days (24 mm Transwells) post-seeding. TJ Assembly by Calcium Switch—Caco-2 cell monolayers were treated with 4 mm EGTA in both the apical and basal compartments until the transepithelial electrical resistance (TER) was reduced to about 15-17% that of basal values (usually reduced from 300 to 50 ohms·cm2); this was monitored by measuring TER every 5 min, and the average time recorded for EGTA treatment was 30 min. The cells were then quickly washed three times with DMEM to remove all traces of EGTA and incubated in regular DMEM containing calcium for varying times. The integrity of TJ was analyzed by measuring TER and unidirectional flux of fluorescein isothiocyanate-conjugated inulin. Treatment with PPase Inhibitors—Caco-2 cells were treated with PPase inhibitors as previously described (32Favre B. Turowski P. Hemmings B.A. J. Biol. Chem. 1997; 272: 13856-13863Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar). Cell monolayers were incubated with 100 nm fostriecin, 4 nm okadaic acid, and 0.5 nm calyculin A for 24 h before the experiment. The cells were then washed with DMEM, and the inhibitors were added again during the calcium switch experiments to maintain the inhibitory effect. Transfection of Antisense Oligos and siRNA—Caco-2 cells (125,000 cells/well) were seeded in six-well plates. The cells were then allowed to grow and attach for 24 h. After the incubation, the cells were treated with serum-free, antibiotic-free DMEM, and the incubation was continued for an additional 24 h. The cells were then transfected using 1 ml of antibiotic- and serum-free DMEM with or without 80 pmol of the antisense oligonucleotides or siRNA and 3.15 μl of Oligofectamine® reagent in each well and incubated for 6 h at 37 °C. Serum was then added to the medium to make a final concentration of 10% serum and incubated at 37 °C. After 24 h the cell monolayers were trypsinized and seeded on to Transwell inserts, and the TER was monitored every day. Calcium switch experiments were performed on day 4. For controls, cells were transfected with missense oligos or control RNA with scrambled nucleotide sequence at similar dose and transfection conditions. Measurement of TER—TER was measured as described previously (15Rao R.K. Baker R.D. Baker S.S. Gupta A. Holycross M. Am. J. Physiol. 1997; 273: G812-G823PubMed Google Scholar) using a Millicell-ERS Electrical Resistance System (Millipore, Bedford, MA). TER was calculated as ohms·cm2 by multiplying it with the surface area of the monolayer. The resistance of the polycarbonate membrane in Transwells (∼30 ohms·cm2) was subtracted from all readings. Unidirectional Flux of Inulin—Transwells with the cell monolayers were incubated under different experimental conditions in the presence of fluorescein isothiocyanate-inulin (0.5 mg/ml) in the basal well. At varying times during the assembly of TJ, 100 μl each of apical and basal media were withdrawn, and fluorescence was measured using a fluorescence plate reader (BioTEK Instruments, Winooski, VT). The flux into the apical well was calculated as the percentage of total fluorescence administered into the basal well/h/cm2 of surface area. Immunofluorescence Microscopy—At varying times during the calcium switch, cell monolayers (12 mm) were washed with PBS and fixed in acetone:methanol (1:1) at 0 °C for 5 min. Cell monolayers were blocked in 3% nonfat milk in TBST (20 mm Tris, pH 7.2, and 150 mm NaCl) and incubated for 1 h with primary antibodies; rabbit polyclonal anti-ZO-1, anti-PP2A-Cα, or mouse monoclonal anti-occludin antibodies followed by incubation for 1 h with secondary antibodies; goat AlexaFluor 488-conjugated anti-mouse IgG and Cy3-conjugated anti-rabbit IgG antibodies. The fluorescence was visualized using a Zeiss LSM 5 laser scanning confocal microscope, and the images from Z-series sections (1 μm) were collected by using Zeiss LSM 5 Pascal, the confocal microscopy software (Release 3.2). Images were stacked using the software, Image J (NIH), and processed by Adobe Photoshop (Adobe Systems Inc., San Jose, CA). Preparation of Detergent-insoluble Fractions—Triton-insoluble fractions were prepared as previously described (33Basuroy S. Seth A. Elias B. Naren A.P. Rao R.K. Biochem. J. 2006; 393: 69-77Crossref PubMed Scopus (209) Google Scholar). Cell monolayers in Transwells (24 mm) were washed twice with ice-cold PBS and incubated for 5 min with lysis buffer-CS (50 mm Tris buffer, pH 7.4, containing 1.0% Triton X-100, 2 μg/ml leupeptin, 10 μg/ml aprotinin, 10 μg/ml bestatin, 10 μg/ml pepstatin-A, 1 mm vanadate, and 1 mm phenylmethylsulfonyl fluoride). Cell lysates were centrifuged at low speed (15,600 × g) for 4 min at 4 °C to sediment the high density actin-rich fraction. The pellet was suspended in 200 μl of lysis buffer-CS. Protein concentration in different fractions was measured by the BCA method (Pierce). Triton-insoluble and Triton-soluble fractions were mixed with an equal volume of Laemmli sample buffer (2× concentrated) and heated at 100 °C for 10 min. Immunoprecipitation—At varying times during the assembly of TJ, Caco-2 cell monolayers (24 mm Transwells) were washed with ice-cold 20 mm Tris, pH 7.4, and actin-rich Triton-insoluble and Triton-soluble fractions were prepared. The suspension of Triton-insoluble fraction was sonicated for 10 s in lysis buffer-N (20 mm Tris, pH 7.4, containing 0.2% Nonidet P-40, 0.1% sodium deoxycholate, and a mixture of protease inhibitors). Sonication induced fragmentation of the F-actin filaments and released actin-bound protein complexes. Under such conditions greater than 80% of occludin and ZO-1 were recovered in the supernatant fraction; however, co-immunoprecipitation studies indicated that the interaction between occludin and ZO-1 was unaffected. The actin lysate and Triton-soluble fraction (1.0 mg protein/ml) were incubated with 2 μg of anti-occludin antibodies at 4 °C for 16 h. The immune complexes were isolated by precipitation using protein-A/G-Sepharose (for 1 h at 4 °C). For immunoprecipitation of p-Thr and p-Ser, Triton-insoluble and -soluble fractions were heated in the presence of 0.3% SDS for 10 min at 100 °C followed by centrifugation. The clear supernatant was then used for immunoprecipitation. Immunoblot Analysis—Proteins were separated by SDS-polyacrylamide gel (7 or 4-12% gradient) electrophoresis and transferred to polyvinylidene difluoride membranes. Membranes were blotted for occludin, ZO-1, p-Thr, p-Ser, PP2A-Cα, PKCζ, or PP1α by using specific antibodies in combination with HRP-conjugated anti-mouse IgG or HRP-conjugated anti-rabbit IgG antibodies. HRP-conjugated anti-GST antibody was used for immunoblot analysis of GST or GST-occludin. The blot was developed using the ECL chemiluminescence method (Amersham Biosciences). Quantitation was performed by densitometric analysis of specific bands on the immunoblots by using the software Image J. PP2A Assay—Detergent-soluble or insoluble fractions or an immunocomplex was diluted in PPase buffer (50 mm HEPES, pH 7.2, 60 mm NaCl, 60 mm KCl, and protease inhibitors) to a final volume of 20 μl and incubated with 5 μl of phosphopeptide substrate, KRpTIRR (5 μg). After incubation at 30 °C for 10 min, free phosphate was assayed by adding 100 μl of Malachite green reagent to each sample in a 96-well microtiter plate. After 10 min of incubation at 30 °C, absorbance was measured at a 650-nm wavelength in a microplate reader (SpectraMax 190, Molecular Devices, Sunnyvale, CA). Zero-minute incubation was used for the control assay. Assay was also performed in the presence of 100 nm fostriecin. To determine PP2A-specific activity, the phosphatase activity measured in the presence of 100 nm fostriecin was subtracted from the corresponding total activity. The units of PP2A activity represent pmol of free phosphate generated in 1 h under assay conditions. Preparation of GST-occludin-C—C-terminal tail of chicken occludin was prepared as a GST fusion protein (GST-occludin-C) in Escherichia coli BL21DE (3Lee D.B.N. Huang E. Ward H.J. Am. J. Physiol. 2006; 290: F20-F34Crossref PubMed Scopus (151) Google Scholar) cells and purified using GSH-agarose as described before (23Kale G. Rao R.K. Biochem. Biophys. Res. Commun. 2003; 302: 324-329Crossref PubMed Scopus (165) Google Scholar). cDNA for the C-terminal tail of occludin (amino acids 354-503) in pGEX vector was received as a gift from Dr. J. M. Anderson, University of North Carolina (Chapel Hill, NC). GST Pulldown Assay—To prepare protein extracts, Caco-2 cell monolayers at different stages of calcium switch were lysed in 0.2% Triton X-100 in PBS containing 1 mm sodium orthovanadate, 10 mm sodium fluoride, 10 mm sodium pyrophosphate (3 ml/100 mm plate). Cell lysates were centrifuged at 15,000 × g for 15 min, and the supernatant was used for the pulldown assay. Cell lysate (0.6 ml) was incubated with 10 μg of GST-occludin-C and 20 μl of GSH-agarose at 4 °C for 15 h on an inverter. Agarose beads were washed 3 times with PBS, and proteins were extracted by heating at 100 °C for 10 min in 20 μl of Laemmli sample buffer. The amounts of PP2A, PP1, and PKCζ present in GSH-agarose pulldown were determined by immunoblot analysis. At the end of the experiment the blots were stained with Ponceau S and immunoblotted for GST to confirm the use of equal amounts of GST-occludin-C in different samples. Pairwise Binding Assay—To determine the direct interaction between occludin and PP2A-Cα or PP1α, GST-occludin-C (5-20 μg) was incubated with purified PP2A-Cα (0.1 or 0.25 μg) or purified PP1α (0.1 or 0.25 μg) in PBS containing 0.2% Triton X-100, 1 mm vanadate, and 10 mm sodium fluoride for 3 h at 30 °C on an inverter. GST-occludin-C was pulled down by binding to 20 μl of 50% GSH-agarose slurry at 30 °C for 1 h. The amounts of PP2A-Cα and PP1α bound to GSH-agarose pull-down were determined by immunoblot analysis. Nonspecific binding was determined by carrying out the binding with GST instead of GST-occludin-C. Dephosphorylation of Occludin by PP2A and PP1—Occludin was immunoprecipitated from the Triton-soluble fraction of Caco-2 cells. Occludin immunocomplexes were then incubated with 0.5 μg PP2A or PP1 in PPase buffer for 60 min. For control assay, PPase formulation buffer was used in place of PP2A and PP1. After incubation for 10-60 min at 30 °C, the reaction mixture was heated with Laemmli sample buffer and immunoblotted for p-Thr, p-Ser, and occludin. Statistics—Comparison between two groups was made by Student's t tests for grouped data. Significance in all tests was set at 95% or greater confidence level. Inhibition of Protein Phosphatase Activity Accelerates the Calcium Switch-induced Assembly of TJ—The effect of endogenous PP2A and PP1 activities on the assembly of TJ was evaluated in Caco-2 cells. Assembly of TJ was monitored by the calcium switch method. PP2A activity in Caco-2 cells was selectively inhibited by pretreatment of cells with low concentrations of okadaic acid, fostriecin, or calyculin-A as reported before (32Favre B. Turowski P. Hemmings B.A. J. Biol. Chem. 1997; 272: 13856-13863Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar). Incubation with okadaic acid dose-dependently reduced PP2A activity in both detergent-insoluble and detergent-soluble fractions of Caco-2 cells (Fig. 1A). PP2A activity measured by immunocomplex PP2A assay also demonstrated a reduction in the PP2A activity in okadaic acid-treated cells (Fig. 1B). Similarly, incubation with fostriecin and calyculin-A also reduced PP2A activity (data not shown). Basal TER of cell monolayers treated with PPase inhibitors was not significantly different from the TER values for control (Fig. 1C). Calcium depletion by EGTA rapidly reduced the TER, and replenishment of calcium in the EGTA-treated cell monolayers gradually restored the TER to the basal level (Fig. 1D). Increased TER by calcium replenishment was accompanied by reduced permeability to inulin. Pretreatment of cells with okadaic acid, fostriecin, and calyculin-A significantly accelerated the restoration of TER during the reassembly of TJ by calcium replacement (Fig. 1D). The inulin permeability measured during the restoration of TER was significantly lower in inhibitor-treated cells compared with that in untreated cells (Fig. 1E). Confocal immunofluorescence microscopy showed that EGTA treatment resulted in the disruption of junctional organization of occludin and ZO-1 and redistribution of these proteins in the intracellular compartments (Fig. 2A). Three hours after calcium replacement a partial reorganization of occludin and ZO-1 at the intercellular junctions was achieved. However, in cells pretreated with fostriecin, both occludin and ZO-1 relocalization to the intercellular junctions was almost complete by 3 h. Densitometric analysis indicated that intracellular fluorescence of occludin (Fig. 2B) and ZO-1 (Fig. 2C) increased during EGTA treatment, whereas the junctional fluorescence was significantly reduced. During the reassembly, this process appeared to be reversed. However, the decrease in intracellular and increase in junctional fluorescence of both occludin and ZO-1 during the reassembly was significantly greater in fostriecin-treated cells compared with that in untreated cells. The z-sections of these images (Fig. 2D) confirm the accelerated reassembly of occludin and ZO-1 in cells pretreated with fostriecin. Confocal microscopy also indicates that occludin and ZO-1 are localized predominantly in vesicular structures in EGTA-treated cell monolayers. Reduced Expression of PP2A by Antisense Oligonucleotides or siRNA Accelerates the Assembly of TJ—To confirm the role of endogenous PP2A in the regulation of the assembly of TJ, we designed three different antisense oligonucleotides against the nucleotide sequence of human PP2A-Cα. Antisense oligonucleotides, AS-PP2A-2, AS-PP2A-3, or a combination of AS-PP2A-2 and AS-PP2A-3 were transfected into Caco-2 cells. Cy3-conjugated AS-PP2A-3 showed that Oligofectamine® effectively introduced the antisense oligonucleotides into the cell (Fig. 3A). Transfection with AS-PP2A-2, AS-PP2A-3, or AS-PP2A-2+AS-PP2A-3 resulted in a marked decrease in the levels of PP2A-Cα" @default.
• W2059356721 created "2016-06-24" @default.
• W2059356721 creator A5001935220 @default.
• W2059356721 creator A5042293525 @default.
• W2059356721 creator A5065584317 @default.
• W2059356721 creator A5079616290 @default.
• W2059356721 date "2007-04-01" @default.
• W2059356721 modified "2023-10-16" @default.
• W2059356721 title "Protein Phosphatases 2A and 1 Interact with Occludin and Negatively Regulate the Assembly of Tight Junctions in the CACO-2 Cell Monolayer" @default.
• W2059356721 cites W1964337753 @default.
• W2059356721 cites W1966728362 @default.
• W2059356721 cites W1979996406 @default.
• W2059356721 cites W1980932394 @default.
• W2059356721 cites W1984047231 @default.
• W2059356721 cites W1996902174 @default.
• W2059356721 cites W2005881612 @default.
• W2059356721 cites W2007495243 @default.
• W2059356721 cites W2015679476 @default.
• W2059356721 cites W2016753320 @default.
• W2059356721 cites W2017259440 @default.
• W2059356721 cites W2063875318 @default.
• W2059356721 cites W2066513453 @default.
• W2059356721 cites W2068518873 @default.
• W2059356721 cites W2081448426 @default.
• W2059356721 cites W2084429010 @default.
• W2059356721 cites W2086412362 @default.
• W2059356721 cites W2086798106 @default.
• W2059356721 cites W2110267612 @default.
• W2059356721 cites W2117070403 @default.
• W2059356721 cites W2128154787 @default.
• W2059356721 cites W2134292612 @default.
• W2059356721 cites W2141716903 @default.
• W2059356721 cites W2148504803 @default.
• W2059356721 cites W2158926036 @default.
• W2059356721 cites W2171951189 @default.
• W2059356721 cites W2313932305 @default.
• W2059356721 cites W2412686729 @default.
• W2059356721 doi "https://doi.org/10.1074/jbc.m610597200" @default.
• W2059356721 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17298946" @default.
• W2059356721 hasPublicationYear "2007" @default.
• W2059356721 type Work @default.
• W2059356721 sameAs 2059356721 @default.
• W2059356721 citedByCount "163" @default.
• W2059356721 countsByYear W20593567212012 @default.
• W2059356721 countsByYear W20593567212013 @default.
• W2059356721 countsByYear W20593567212014 @default.
• W2059356721 countsByYear W20593567212015 @default.
• W2059356721 countsByYear W20593567212016 @default.
• W2059356721 countsByYear W20593567212017 @default.
• W2059356721 countsByYear W20593567212018 @default.
• W2059356721 countsByYear W20593567212019 @default.
• W2059356721 countsByYear W20593567212020 @default.
• W2059356721 countsByYear W20593567212021 @default.
• W2059356721 countsByYear W20593567212022 @default.
• W2059356721 countsByYear W20593567212023 @default.
• W2059356721 crossrefType "journal-article" @default.
• W2059356721 hasAuthorship W2059356721A5001935220 @default.
• W2059356721 hasAuthorship W2059356721A5042293525 @default.
• W2059356721 hasAuthorship W2059356721A5065584317 @default.
• W2059356721 hasAuthorship W2059356721A5079616290 @default.
• W2059356721 hasBestOaLocation W20593567211 @default.
• W2059356721 hasConcept C11960822 @default.
• W2059356721 hasConcept C1491633281 @default.
• W2059356721 hasConcept C177779419 @default.
• W2059356721 hasConcept C178666793 @default.
• W2059356721 hasConcept C185592680 @default.
• W2059356721 hasConcept C193176779 @default.
• W2059356721 hasConcept C2775962179 @default.
• W2059356721 hasConcept C55493867 @default.
• W2059356721 hasConcept C7070889 @default.
• W2059356721 hasConcept C86803240 @default.
• W2059356721 hasConcept C95444343 @default.
• W2059356721 hasConceptScore W2059356721C11960822 @default.
• W2059356721 hasConceptScore W2059356721C1491633281 @default.
• W2059356721 hasConceptScore W2059356721C177779419 @default.
• W2059356721 hasConceptScore W2059356721C178666793 @default.
• W2059356721 hasConceptScore W2059356721C185592680 @default.
• W2059356721 hasConceptScore W2059356721C193176779 @default.
• W2059356721 hasConceptScore W2059356721C2775962179 @default.
• W2059356721 hasConceptScore W2059356721C55493867 @default.
• W2059356721 hasConceptScore W2059356721C7070889 @default.
• W2059356721 hasConceptScore W2059356721C86803240 @default.
• W2059356721 hasConceptScore W2059356721C95444343 @default.
• W2059356721 hasIssue "15" @default.
• W2059356721 hasLocation W20593567211 @default.
• W2059356721 hasOpenAccess W2059356721 @default.
• W2059356721 hasPrimaryLocation W20593567211 @default.
• W2059356721 hasRelatedWork W1965531250 @default.
• W2059356721 hasRelatedWork W1973553679 @default.
• W2059356721 hasRelatedWork W2000140084 @default.
• W2059356721 hasRelatedWork W2032925493 @default.
• W2059356721 hasRelatedWork W2059356721 @default.
• W2059356721 hasRelatedWork W2065422003 @default.
• W2059356721 hasRelatedWork W2120282652 @default.
• W2059356721 hasRelatedWork W2121979986 @default.
• W2059356721 hasRelatedWork W2560498837 @default.
• W2059356721 hasRelatedWork W4291465498 @default.
• W2059356721 hasVolume "282" @default.

• next