FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2059969460> ?p ?o ?g. }

• W2059969460 endingPage "7364" @default.
• W2059969460 startingPage "7359" @default.
• W2059969460 abstract "TAK1, a member of the mitogen-activated kinase kinase kinase family, is activated in vivo by various cytokines, including interleukin-1 (IL-1), or when ectopically expressed together with the TAK1-binding protein TAB1. However, this molecular mechanism of activation is not yet understood. We show here that endogenous TAK1 is constitutively associated with TAB1 and phosphorylated following IL-1 stimulation. Furthermore, TAK1 is constitutively phosphorylated when ectopically overexpressed with TAB1. In both cases, dephosphorylation of TAK1 renders it inactive, but it can be reactivated by preincubation with ATP. A mutant of TAK1 that lacks kinase activity is not phosphorylated either following IL-1 treatment or when coexpressed with TAB1, indicating that TAK1 phosphorylation is due to autophosphorylation. Furthermore, mutation to alanine of a conserved serine residue (Ser-192) in the activation loop between kinase domains VII and VIII abolishes both phosphorylation and activation of TAK1. These results suggest that IL-1 and ectopic expression of TAB1 both activate TAK1 via autophosphorylation of Ser-192. TAK1, a member of the mitogen-activated kinase kinase kinase family, is activated in vivo by various cytokines, including interleukin-1 (IL-1), or when ectopically expressed together with the TAK1-binding protein TAB1. However, this molecular mechanism of activation is not yet understood. We show here that endogenous TAK1 is constitutively associated with TAB1 and phosphorylated following IL-1 stimulation. Furthermore, TAK1 is constitutively phosphorylated when ectopically overexpressed with TAB1. In both cases, dephosphorylation of TAK1 renders it inactive, but it can be reactivated by preincubation with ATP. A mutant of TAK1 that lacks kinase activity is not phosphorylated either following IL-1 treatment or when coexpressed with TAB1, indicating that TAK1 phosphorylation is due to autophosphorylation. Furthermore, mutation to alanine of a conserved serine residue (Ser-192) in the activation loop between kinase domains VII and VIII abolishes both phosphorylation and activation of TAK1. These results suggest that IL-1 and ectopic expression of TAB1 both activate TAK1 via autophosphorylation of Ser-192. mitogen-activated protein kinases MAPK kinase MAPKK kinase MAPKKK kinase extracellular signal-regulated kinase c-Jun N-terminal kinase MAPK/ERK kinase MEK kinase mixed lineage kinase hematopoietic progenitor kinase/germinal center kinase-like kinase tumor necrosis factor interleukin-1 nuclear factor-κB hemagglutinin polyacrylamide gel electrophoresis N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine The mitogen-activated protein kinases (MAPKs)1 are a family of serine/threonine kinases that have been shown to function in a wide variety of biological processes (1.Davis R.J. Trends Biochem. Sci. 1994; 19: 470-473Abstract Full Text PDF PubMed Scopus (918) Google Scholar, 2.Su B. Karin M. Curr. Opin. Immunol. 1996; 8: 402-411Crossref PubMed Scopus (721) Google Scholar, 3.Treisman R. Curr. Opin. Cell Biol. 1996; 8: 205-215Crossref PubMed Scopus (1165) Google Scholar). MAPKs are activated by phosphorylation of specific tyrosine and threonine residues by a family of dual-specificity protein kinase MAPK kinases (MAPKKs). MAPKKs are, in turn, activated by phosphorylation of serine and serine/threonine residues by MAPKK kinases (MAPKKKs) (4.Cobb M.H. Goldsmith E.J. J. Biol. Chem. 1995; 270: 14843-14846Abstract Full Text Full Text PDF PubMed Scopus (1663) Google Scholar, 5.Fanger G.R. Gerwins P. Widmann C. Jarpe M.B. Johnson G.L. Curr. Opin. Genet. Dev. 1997; 7: 67-74Crossref PubMed Scopus (299) Google Scholar, 6.Robinson M.J. Cobb M.H. Curr. Opin. Cell Biol. 1997; 9: 180-186Crossref PubMed Scopus (2286) Google Scholar). Three distinct members of the MAPK family have been identified: extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38. Whereas the ERK family is activated by growth factors and is involved in cell proliferation, JNK and p38 are activated in response to proinflammatory cytokines and various types of environmental stresses. ERK family kinases are activated by the MEK1 and MEK2 MAPKKs; JNK by MKK4 and MKK7; and p38 by MKK3 and MKK6. Further upstream, Raf-1 functions as a MAPKKK in the ERK activation pathway. A subgroup of MAPKKKs including the MEKK family (MEKK1, MEKK2, MEKK3, and MEKK4/MTK1), the MLK family (MLK1, MLK2, MLK3, and DLK), ASK1, and TAK1 activate the MAPKKs that phosphorylate JNK and p38, but not the MAPKKs that phosphorylate ERK (5.Fanger G.R. Gerwins P. Widmann C. Jarpe M.B. Johnson G.L. Curr. Opin. Genet. Dev. 1997; 7: 67-74Crossref PubMed Scopus (299) Google Scholar, 6.Robinson M.J. Cobb M.H. Curr. Opin. Cell Biol. 1997; 9: 180-186Crossref PubMed Scopus (2286) Google Scholar). Different mechanisms activate MAPKKKs. Autophosphorylation mediated by an intramolecular reaction has been implicated in the activation of MEKK1 and Ssk2, a MAPKKK in budding yeast (7.Deak J.C. Templeton D.J. Biochem. J. 1997; 322: 185-192Crossref PubMed Scopus (61) Google Scholar, 8.Siow Y.L. Kalmar G.B. Sanghera J.S. Tai G. Oh S.S. Pelech S.L. J. Biol. Chem. 1997; 272: 7586-7594Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 9.Posas F. Saito H. EMBO J. 1998; 17: 1385-1394Crossref PubMed Scopus (252) Google Scholar). ASK1 and MLK3 have been demonstrated to form dimers in response to upstream stimuli, an event important for their catalytic activities (10.Leung I.W. Lassam N. J. Biol. Chem. 1998; 273: 32408-32415Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar, 11.Gotoh Y. Cooper J.A. J. Biol. Chem. 1998; 273: 17477-17482Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar). This dimerization may facilitate intermolecular autophosphorylation leading to activation, as is the case for receptor tyrosine kinases. In some signaling pathways, MAPKKKs may be activated by the action of upstream MAPKKK kinases (MAPKKKKs). For example, in the budding yeast mating pheromone pathway, MAPKKKK Ste20 functions to activate MAPKKK Ste11 (12.Herskowitz I. Cell. 1995; 80: 187-197Abstract Full Text PDF PubMed Scopus (867) Google Scholar). Similarly, Ste20-like kinases have been implicated in the activation of MAPKKKs in mammalian cells. For example, Raf-1 is phosphorylated and activated by p21 (Rac/Cdc42)-activated kinase (13.King A.J. Sun H. Diaz B. Barnard D. Miao W. Bagrodia S. Marshall M.S. Nature. 1998; 396: 180-183Crossref PubMed Scopus (386) Google Scholar). Germinal center kinase functions upstream of MEKK1 in the tumor necrosis factor (TNF) signaling pathway leading to JNK activation (14.Yuasa T. Ohno S. Kehrl J.H. Kyriakis J.M. J. Biol. Chem. 1998; 273: 22681-22692Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar); and hematopoietic progenitor kinase and hematopoietic progenitor kinase/germinal center kinase-like kinase (HGK) are involved in the activation of TAK1 that leads to JNK activation (15.Wang W. Zhou G. Hu M. Yao Z. Tan T.H. J. Biol. Chem. 1997; 272: 22771-22775Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar, 16.Yao Z. Zhou G. Wang X.S. Brown A. Diener K. Gan H. Tan T.H. J. Biol. Chem. 1999; 274: 2118-2125Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). TAK1 is a member of the MAPKKK family and is activated by various cytokines, including transforming growth factor-β family ligands and interleukin-1 (IL-1) (17.Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1178) Google Scholar, 18.Shirakabe K. Yamaguchi K. Shibuya H. Irie K. Matsuda S. Moriguchi T. Gotoh Y. Matsumoto K. Nishida E. J. Biol. Chem. 1997; 272: 8141-8144Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar). We have previously demonstrated that TAK1 functions in transforming growth factor-β signaling pathways in mammalian cells (17.Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1178) Google Scholar). In early Xenopus embryos, TAK1 also participates in mesoderm induction and patterning meditated by bone morphogenetic protein, a transforming growth factor-β family ligand (19.Yamaguchi K. Nagai S. Ninomiya T.J. Nishita M. Tamai K. Irie K. Ueno N. Nishida E. Shibuya H. Matsumoto K. EMBO J. 1999; 18: 179-187Crossref PubMed Scopus (326) Google Scholar, 20.Shibuya H. Iwata H. Masuyama N. Gotoh Y. Yamaguchi K. Irie K. Matsumoto K. Nishida E. Ueno N. EMBO J. 1998; 17: 1019-1028Crossref PubMed Scopus (191) Google Scholar). Furthermore, we have recently demonstrated that TAK1 is involved in the IL-1 signaling pathway by activating two kinase cascades (21.Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar); one is a MAPK cascade leading to JNK activation, and the other is a kinase cascade composed of nuclear factor-κB (NF-κB)-inducing kinase and IκB kinases, ultimately leading to NF-κB activation. TAB1 is a mammalian protein that interacts with TAK1 and was identified in a yeast two-hybrid screen (22.Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (524) Google Scholar). When ectopically expressed together with TAK1, TAB1 can augment the kinase activity of TAK1. The C-terminal 68-amino acid portion of TAB1 is sufficient for binding to and activation of TAK1. However, the molecular mechanism for this activation remains to be elucidated. In this report, we sought to determine the mechanism for both IL-1- and TAB1-induced activation of TAK1. We found that endogenous TAK1 associates with TAB1 constitutively and is activated by autophosphorylation following IL-1 stimulation. Similarly, ectopically expressed TAK1, once bound to TAB1, is also activated by autophosphorylation. The primary site of TAK1 autophosphorylation is Ser-192 in the kinase activation loop. Phosphorylation of this residue correlates with activation of TAK1. 293 and 293IL-1RI (23.Cao Z. Henzel W.J. Gao X. Science. 1996; 271: 1128-1131Crossref PubMed Scopus (777) Google Scholar) cells were maintained in Dulbecco's modified Eagle's medium supplemented with fetal calf serum (10%) at 37 °C and 5% CO2. The mammalian expression vectors for TAB1, N-terminal hemagglutinin (HA) epitope-tagged TAK1, and TAB1 (pEF-TAB1, pEF-HA-TAK1, pEF-HA-TAK1(K63W), and pEF-HA-TAB1) have been described previously (17.Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1178) Google Scholar,18.Shirakabe K. Yamaguchi K. Shibuya H. Irie K. Matsuda S. Moriguchi T. Gotoh Y. Matsumoto K. Nishida E. J. Biol. Chem. 1997; 272: 8141-8144Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar, 22.Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (524) Google Scholar). Several TAK1 mutants (TAK1(S192A), TAK1(S192D), and TAK1(S192E)) that contain various substitutions of a serine residue in the activation loop were generated by polymerase chain reaction. First, a 5′-oligonucleotide containing a SacI restriction site (TTGTGGAGCTCCGGCAGTTG) together with a 3′-oligonucleotide containing aNarI restriction site (TTCAGGCGCCATCCAAGCAGCAGCCCC for TAK1(S192A), TTCAGGCGCCATCCAAGCAGCATCCCC for TAK1(S192D), or TTCAGGCGCCATCCAAGCAGCTTCCCC for TAK1(S192E)) were used to generate TAK1 mutant fragments. The resulting DNA fragments were digested with SacI and NarI and subcloned into the SacI and NarI sites of pSP72-HA-TAK1, which contains an N-terminal HA epitope-tagged full-length TAK1 cDNA fragment in the EcoRI and BamHI sites of the vector pSP72 (Promega). The mutations were verified by DNA sequencing. Next, the EcoRI-BamHI TAK1 mutant fragments were cloned into the EcoRI and BamHI sites of the vector pEF to generate pEF-HA-TAK1 mutants. To generate the TAK1 C-terminal truncation constructs, EcoRI-PstI fragments from pEF-HA-TAK1 or pEF-HA-TAK1(K63W), containing the N-terminal HA epitope-tagged 402 amino acids of TAK1, were inserted into the EcoRI and PstI sites of the vector pKT10 (24.Tanaka K. Matsumoto K. Toh-e A. Mol. Cell. Biol. 1989; 9: 757-768Crossref PubMed Scopus (175) Google Scholar) to add a stop codon. Then the EcoRI-SalI fragments from the above-generated pKT10-TAK1ΔC plasmids, containing the HA epitope-tagged truncated TAK1 cDNA and a stop codon, were inserted into the EcoRI and SalI sites of the pEF vector, producing pEF-HA-TAK1ΔC and pEF-HA-TAK1ΔC(K63W). 293IL-1RI cells were either left untreated or treated with IL-1 (10 ng/ml) for 10 min. For the transfection studies, 293 or 293IL-1RI cells (1 × 106) were plated in 10-cm dishes, transfected with a total of 10 μg of DNA containing various expression vectors, and incubated for 24–36 h. Cells were washed once with phosphate-buffered saline and lysed in 0.3 ml of 0.5% Triton X-100 lysis buffer containing 20 mm HEPES (pH 7.4), 150 mm NaCl, 12.5 mm β-glycerophosphate, 1.5 mmMgCl2, 2 mm EGTA, 10 mm NaF, 2 mm dithiothreitol, 1 mm sodium orthovanadate, 1 mm phenylmethylsulfonyl fluoride, and 20 μmaprotinin. Cellular debris was removed by centrifugation at 10, 000 × g for 5 min. Proteins from cell lysates were incubated with 1 μg of anti-TAK1 antibody or anti-HA antibody HA.11 (Babco) and 15 μl of protein G-Sepharose (Amersham Pharmacia Biotech). The beads were washed extensively with phosphate-buffered saline. For immunoblotting, the immunoprecipitates or whole cell lysates were resolved by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to Hybond-P membranes (Amersham Pharmacia Biotech). The membranes were immunoblotted with various antibodies, and the bound antibody was visualized with horseradish peroxidase-conjugated antibodies to rabbit or mouse IgG using the enhanced chemiluminescence Western blotting system (ECL, Amersham Pharmacia Biotech). Endogenous TAK1 or various ectopically expressed versions of HA-TAK1 were immunoprecipitated with anti-TAK1 or anti-HA antibody, respectively, as described above. Immunoprecipitates were incubated with or without 1 μg of bacterially expressed MKK6 (25.Moriguchi T. Kuroyanagi N. Yamaguchi K. Gotoh Y. Irie K. Kano T. Shirakabe K. Muro Y. Shibuya H. Matsumoto K. Nishida E. Hagiwara M. J. Biol. Chem. 1996; 271: 13675-13679Abstract Full Text Full Text PDF PubMed Scopus (407) Google Scholar) in 10 μl of kinase buffer containing 10 mm HEPES (pH 7.4), 1 mm dithiothreitol, 5 mm MgCl2, and 5 μCi of [γ-32P]ATP (3000 Ci/mmol) at 25 °C for 2 min. Samples were fractionated by 10% SDS-PAGE and visualized by autoradiography. For phosphatase treatment, immunoprecipitates were incubated with λ-protein phosphatase (New England Biolabs Inc.) in phosphatase buffer containing 50 mm Tris-HCl (pH 7.5), 0.1 mm EDTA, 5 mm dithiothreitol, 0.01% Brij 35, and 2 mm MnCl2 at 30 °C for 30 min. Samples were then washed twice with the lysis buffer described above and twice with phosphate-buffered saline. Some samples were further incubated with a unlabeled ATP buffer containing 20 mm Tris-HCl (pH 7.6), 20 mm MgCl2, 20 mmβ-glycerophosphate, 1 mm EDTA, 1 mm sodium orthovanadate, 0.4 mm phenylmethylsulfonyl fluoride, and 1 mm ATP at 37 °C for 20 min. Subsequently, samples were washed three times with phosphate-buffered saline. All samples were subjected to an in vitro phosphorylation assay as described above. HA-TAK1 was immunoprecipitated and phosphorylated in vitro with [γ-32P]ATP as described above. The labeled immunoprecipitates were fractionated by SDS-PAGE and transferred to nitrocellulose membranes. The phosphorylated HA-TAK1 band was identified by autoradiography, excised, and digested with CNBr (Sigma) (26.Luo K.X. Hurley T.R. Sefton B.M. Methods Enzymol. 1991; 201: 149-152Crossref PubMed Scopus (131) Google Scholar). The resulting peptides were analyzed by Tris/Tricine gel electrophoresis (20% polyacrylamide gels) (27.Schagger H. von Jagow G. Anal. Biochem. 1987; 166: 368-379Crossref PubMed Scopus (10505) Google Scholar). Polypeptide SDS-PAGE standards (Bio-Rad) and a 1.0-kDa phosphopeptide generated by trypsin digestion of glutathioneS-transferase-tagged IκBN (IκB, amino acids 1–72) phosphorylated in vitro with IκB kinase (21.Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar) were used as molecular mass standards. Reporter gene activity assays were performed as described (21.Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar). An Ig-κ/luciferase reporter was used to measure NF-κB-dependent transcription. A plasmid containing the β-galactosidase gene under the control of the β-actin promoter was used for normalizing transfection efficiency. To address how TAK1 is activated following IL-1 stimulation, we initially analyzed endogenous TAK1 complexes in untreated and IL-1-treated cells. 293 cells overexpressing the IL-1 receptor (293IL-1RI cells) were stimulated with IL-1, and cell extracts were subjected to immunoprecipitation with anti-TAK1 antibody and subsequent immunoblotting with anti-TAK1 and anti-TAB1 antibodies (Fig.1, upper panel). TAK1 kinase activity was also measured in vitro using bacterially expressed MKK6 as an exogenous substrate (Fig. 1, lower panel). TAK1 was activated upon IL-1 treatment, as observed previously (18.Shirakabe K. Yamaguchi K. Shibuya H. Irie K. Matsuda S. Moriguchi T. Gotoh Y. Matsumoto K. Nishida E. J. Biol. Chem. 1997; 272: 8141-8144Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar, 21.Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar). Immunoblotting revealed that TAB1 coprecipitated with TAK1 in both untreated and IL-1-treated cells (Fig. 1,lanes 1 and 2), suggesting that TAB1 constitutively associates with TAK1. However, TAK1 and TAB1 were found to migrate more slowly on SDS-PAGE when cells were treated with IL-1. Treatment with phosphatase eliminated these more slowly migrating bands, suggesting that they are the result of phosphorylation (Fig. 1,lanes 3 and 4). Next, to test if TAK1 activity correlates with phosphorylation of TAK1 and TAB1, we examined whether dephosphorylation reduces TAK1 kinase activity. Anti-TAK1 immunoprecipitates were treated with phosphatase, extensively washed with a buffer containing phosphatase inhibitors, and measured for TAK1 activity in vitro. Phosphatase treatment of the TAK1 complex abolished the ability of TAK1 to phosphorylate MKK6, indicating that dephosphorylation inactivates TAK1 kinase activity (Fig. 1, lanes 3 and 4). The phosphatase-treated immunoprecipitates were subsequently incubated with excessive amounts of unlabeled ATP and re-assayed for kinase activity. This treatment resulted in the prominent reappearance of the slowly migrating forms of TAK1 and TAB1 in both untreated and IL-1-treated cells. Concomitantly, the kinase activity of TAK1 was greatly increased (Fig. 1, lanes 5 and6). Thus, phosphorylation of TAK1 and TAB1 correlates with activation of TAK1. These results suggest that IL-1 activates TAK1 via phosphorylation of a preformed TAK1·TAB1 complex. We have previously shown that TAK1 has no kinase activity when ectopically expressed alone, but is activated when TAB1 is coexpressed (18.Shirakabe K. Yamaguchi K. Shibuya H. Irie K. Matsuda S. Moriguchi T. Gotoh Y. Matsumoto K. Nishida E. J. Biol. Chem. 1997; 272: 8141-8144Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar, 22.Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (524) Google Scholar). We thus analyzed how TAB1 activates ectopically expressed TAK1. We transiently expressed HA-TAK1 alone or together with TAB1 in 293 cells. Cell extracts were subjected to immunoprecipitation with anti-HA antibody, immunoblotting, and then in vitrokinase assay (Fig. 2). When expressed alone, HA-TAK1 appeared as a smeared band on SDS-PAGE, and coexpression with TAB1 caused a noticeable shift in its mobility. This apparent modification of TAK1 by TAB1 was accompanied by the induction of TAK1 kinase activity: activity was not detected when TAK1 was ectopically expressed alone, but was detected when TAK1 and TAB1 were coexpressed (Fig. 2, lanes 1 and 2). These results raise the possibility that TAB1-induced activation of ectopically expressed TAK1 is mediated by phosphorylation, as is activation of endogenous TAK1 by IL-1. Treatment of the TAK1 immunoprecipitates with phosphatase both eliminated the slower migrating forms of TAK1 and abolished its kinase activity (Fig. 2, lane 4). When immunocomplexes prepared from cells coexpressing TAK1 and TAB1 were dephosphorylated and then incubated with excessive amounts of unlabeled ATP, TAK1 was rephosphorylated, and its kinase activity was restored (Fig. 2,lane 6). Thus, TAB1-induced activation of TAK1 correlates with phosphorylation of TAK1. When HA-TAK1 was expressed alone in 293 cells, subjected to immunoprecipitation, dephosphorylated, and then incubated with unlabeled ATP, it was found to be neither modified nor activated (Fig.2, lane 5). In contrast, endogenous TAK1 was modified and activated following similar treatment, even in cells not treated with IL-1 (Fig. 1, lane 5). The critical difference between these two cases is that endogenous TAK1 was found to be constitutively associated with TAB1, whereas most of the ectopically expressed HA-TAK1 was found unassociated. Therefore, association of TAK1 with TAB1 may be required for phosphorylation and activation of TAK1. This association is likely to be sufficient for activation of TAK1 in vitrosince TAK1 is activated when TAB1 is coexpressed. On the other hand, endogenous TAK1 remains inactive even though it constitutively forms a complex with TAB1. One possibility is that overexpression of TAK1 and TAB1 somehow mimics the effect of IL-1 stimulation by overcoming the effect of some repressing factor. As shown in Fig. 1, phosphorylation of endogenous TAB1 correlated with TAK1 activity. Similarly, phosphorylation of ectopically expressed TAB1 also correlated with TAK1 activity (Fig. 2, lanes 2, 4, and 6). When HA-TAK1 alone was ectopically expressed and immunoprecipitated, a small amount of endogenous TAB1 was found to coprecipitate. This associated TAB1 migrated slowly, although HA-TAK1 showed no detectable kinase activity (Fig. 2, lane 1). One explanation for these results is that the small portion of HA-TAK1 that is bound to endogenous TAB1 is in fact catalytically active, but is too minor to be detected by our kinase assay. Consistent with this possibility, a small portion of HA-TAK1 from cells not expressing TAB1 was also observed to migrate slowly (Fig. 2, lane 1). IL-1-induced phosphorylation of TAK1 could be mediated by autophosphorylation or by phosphorylation in trans by another protein kinase. These two possibilities could be distinguished by testing whether a catalytically inactive mutant of TAK1 is phosphorylated upon IL-1 treatment. If another kinase is responsible for TAK1 phosphorylation, catalytically inactive TAK1 should still be phosphorylated in response to IL-1. In contrast, if autophosphorylation is responsible, catalytically inactive TAK1 would not be phosphorylated. We employed a catalytically inactive mutant of TAK1 generated by replacing a lysine in the ATP-binding site with tryptophan (HA-TAK1(K63W)). 293IL-1RI cells expressing wild-type HA-TAK1 or HA-TAK1(K63W) were left untreated or were treated with IL-1, and HA epitope-tagged proteins were immunoblotted with anti-HA antibody. Treatment with IL-1 resulted in a decrease in the mobility of HA-TAK1 (Fig.3 A, lanes 1 and2), similar to what was observed with endogenous TAK1 (Fig.1). In contrast, IL-1 stimulation had no effect on the mobility of HA-TAK1(K63W), indicating that TAK1 kinase activity is required for its phosphorylation (Fig. 3 A, lanes 3 and4). These results suggest that TAK1 is autophosphorylated upon IL-1 treatment. We next asked whether the TAB1-induced modification of TAK1 observed earlier is also mediated by autophosphorylation. We transiently expressed HA-TAK1(K63W) together with TAB1 in 293 cells. The HA-TAK1 and TAB1 proteins were detected with anti-HA and anti-TAB1 antibodies, respectively. No slowly migrating form of TAK1 was observed when HA-TAK1(K63W) was coexpressed with TAB1 (Fig. 3 B,lanes 1 and 3). Thus, coexpression with TAB1 stimulates TAK1 autophosphorylation activity. In addition, the slowly migrating forms of TAB1 were not observed when TAB1 was coexpressed with the kinase-inactive TAK1 derivative (Fig.3 B, lanes 1 and 3). This suggests that phosphorylation of TAB1 is also mediated by TAK1. The activation of many protein kinases, including MAPKKKs, involves the phosphorylation of serine and/or threonine residues in a region termed the kinase activation loop between subdomains VII and VIII (28.Johnson L.N. Noble M.E. Owen D.J. Cell. 1996; 85: 149-158Abstract Full Text Full Text PDF PubMed Scopus (1182) Google Scholar). For example, Thr-1393 of MEKK1 and Thr-1460 of budding yeast Ssk2, both located within the activation loop, are essential for their autophosphorylation and activation (7.Deak J.C. Templeton D.J. Biochem. J. 1997; 322: 185-192Crossref PubMed Scopus (61) Google Scholar, 8.Siow Y.L. Kalmar G.B. Sanghera J.S. Tai G. Oh S.S. Pelech S.L. J. Biol. Chem. 1997; 272: 7586-7594Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 9.Posas F. Saito H. EMBO J. 1998; 17: 1385-1394Crossref PubMed Scopus (252) Google Scholar). As shown in Fig. 3 D, Ser-192 of TAK1 corresponds to Thr-1393 of MEKK1 and Thr-1460 of Ssk2. Therefore, we mutated this residue to alanine and tested whether the resulting mutant protein (TAK1(S192A)) was phosphorylated upon IL-1 treatment or by coexpression with TAB1. HA-TAK1(S192A) was expressed in 293IL-1RI cells, and its mobility on SDS-PAGE was examined by immunoblotting with anti-HA antibody. We found that the mobility of this mutant was unaffected by IL-1 treatment (Fig. 3 A, lanes 5 and6) or coexpression of TAB1 (Fig. 3 B,lane 2). To test if Ser-192 is essential for TAK1 kinase activity, we examined its ability to phosphorylate MKK6. In contrast to wild-type TAK1, no kinase activity was detected when the S192A mutant was coexpressed with TAB1 (Fig.4 A). These results show that Ser-192 is important for both IL-1- and TAB1-induced autophosphorylation and activation of TAK1 and thus is probably the site for autophosphorylation. To directly confirm the phosphorylation at position 192 in activated TAK1, we used high resolution Tris/Tricine gel electrophoresis to fractionate proteolyzed 32P-labeled TAK1 (Fig.3 C). HA-TAK1 or HA-TAK1(S192A) was coexpressed with TAB1 in 293 cells and immunoprecipitated with anti-HA antibody. The immunoprecipitates were incubated with [γ-32P]ATP and digested with CNBr. Coexpression of TAB1 increased phosphorylation of multiple phosphopeptides of wild-type TAK1 containing a phosphopeptide of ∼1.0 kDa (Fig. 3 C, lanes 1 and2). Only two CNBr-cleaved fragments of TAK1 are predicted to migrate around 1.0 kDa; one is peptide 187–196, which contains Thr-187 and Ser-192, and the another is peptide 494–502, which does not contain any serine, threonine, or tyrosine residues. Mutation of Ser-192 abolished phosphorylation of the 1.0-kDa peptide (Fig.3 C, lane 3). Thus, we conclude that Ser-192 is a phosphorylation site of activated TAK1. It has been shown for some kinases that replacing particular residues in the activation loop with negatively charged amino acids results in the generation of a constitutively active mutant (28.Johnson L.N. Noble M.E. Owen D.J. Cell. 1996; 85: 149-158Abstract Full Text Full Text PDF PubMed Scopus (1182) Google Scholar). We thus generated mutants of TAK1 in which Ser-192 was replaced with aspartic acid or glutamic acid (TAK1(S192D) or TAK1(S192E), respectively) and compared their kinase activities with that of wild-type TAK1. We found that neither mutant exhibited TAK1 kinase activity, even when coexpressed together with TAB1 (Fig. 4 A; data not shown). These results suggest that the molecular environment achieved by phosphorylation of Ser-192 in TAK1 cannot be mimicked by replacement with negatively charged residues. We have previously demonstrated that TAK1 activates NF-κB via the NF-κB-inducing kinase/IκB kinase cascade (21.Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar). To verify that phosphorylation of Ser-192 is critical for NF-κB activation, we examined the effect of TAK1 mutants on activation using an NF-κB-dependent reporter system (Fig. 4 B). We transiently expressed an NF-κB-dependent reporter plasmid (Ig-κ/luciferase) together with wild-type or various mutants of TAK1. As observed previously (21.Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar), wild-type TAK1 strongly stimulated NF-κB-dependent reporter expression when coexpressed with TAB1. In contrast, none of the S192A, S192D, and S192E mutants defective in kinase activity activated NF-κB-dependent transcription, even when coexpressed with TAB1. Thus, Ser-192 is also important for TAK1-mediated activation of NF-κB. Autophosphorylation can occur by either an intra- or intermolecular reaction. To distinguish between these, we constructed an HA epitope-tagged deletion mutant of TAK1 (HA-TAK1ΔC) that lacks 176 amino acids of the TAK1 C terminus, but contains the entire kinase domain. HA-TAK1ΔC can be separated from wild-type HA-TAK1 by SDS-PAGE. We transiently expressed HA-TAK1, HA-TAK1(K63W), HA-TAK1ΔC, or the catalytically inactive mutant of HA-TAK1ΔC (HA-TAK1ΔC(K63W)) together with HA-TAB1 as an activator of TAK1. In addition, HA-TAB1 was added to monitor transphosphorylation by TAK1. Cell extracts were subjected to immunoprecipitation with anti-HA antibody followed byin vitro kinase assay. HA-TAK1, when coexpressed with HA-TAB1, became autophosphorylated and phosphorylated HA-TAB1 intrans (Fig. 5, lane 1). HA-TAK1ΔC was catalytically active, phosphorylating both HA-TAB1 and itself (Fig. 5, lane 2). When HA-TAK1 was coexpressed with the catalytically inactive mutant HA-TAK1ΔC(K63W) and HA-TAB1, HA-TAK1 and HA-TAB1 became phosphorylated, but HA-TAK1ΔC(K63W) did not (Fig. 5, lane 3). Conversely, when HA-TAK1ΔC was coexpressed with the catalytically inactive mutant HA-TAK1(K63W) and TAB1, HA-TAK1ΔC and TAB1 became phosphorylated, but HA-TAK1(K63W) did not (Fig. 5,lane 4). Thus, autophosphorylation of TAK1 is an intramolecular reaction. The mechanisms by which MAPKKKs are activated are now being elucidated. In many cases, activation involves phosphorylation of MAPKKKs. In some signaling pathways, phosphorylation of MAPKKKs is mediated by other protein kinases such as Ste20-like MAPKKKKs. In other cases, autophosphorylation is implicated in the activation of MAPKKKs. In this study, we demonstrated that autophosphorylation of TAK1 is important for IL-1- and TAB1-induced activation of TAK1. Mutation to alanine of Ser-192, which lies in the activation loop between subdomains VII and VIII, abolishes both IL-1- and TAB1-induced phosphorylation of TAK1. Furthermore, this mutation generates a kinase-inactive form of TAK1 that is impaired in its ability to phosphorylate exogenous substrates or to activate NF-κB. Based on these results, we conclude that Ser-192 is the site of TAK1 autophosphorylation and is critical for its catalytic activity. In addition, we also replaced Ser-192 with aspartic acid or glutamic acid in an attempt to mimic the negative charges resulting from phosphorylation. However, these mutations caused the loss of kinase activity. Similar observations have been reported for analogous mutants in MEK5, MKK4, and MEKK1 (8.Siow Y.L. Kalmar G.B. Sanghera J.S. Tai G. Oh S.S. Pelech S.L. J. Biol. Chem. 1997; 272: 7586-7594Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 29.English J.M. Vanderbilt C.A. Xu S. Marcus S. Cobb M.H. J. Biol. Chem. 1995; 270: 28897-28902Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar). This further suggests that the molecular environment of phosphorylated Ser-192 in TAK1 is important for its catalytic activity. HGK, a Ste20-like MAPKKKK, has been implicated in the activation of TAK1 leading to JNK activation (16.Yao Z. Zhou G. Wang X.S. Brown A. Diener K. Gan H. Tan T.H. J. Biol. Chem. 1999; 274: 2118-2125Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar). HGK is a serine/threonine kinase, and HGK-induced JNK activation is blocked by a kinase-negative mutant of TAK1, but not by a kinase-negative mutant of MEKK1. Since HGK is activated by TNF and UV irradiation, HGK may function as an upstream kinase for TAK1 in these signaling pathways. Given that TAK1 is activated by a variety of extracellular stimuli, including transforming growth factor-β, TNF, IL-1, and environmental stresses (18.Shirakabe K. Yamaguchi K. Shibuya H. Irie K. Matsuda S. Moriguchi T. Gotoh Y. Matsumoto K. Nishida E. J. Biol. Chem. 1997; 272: 8141-8144Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar), it should not be surprising that TAK1 is regulated by multiple mechanisms. TNF may activate TAK1 via HGK-mediated phosphorylation, whereas IL-1 activates TAK1 via autophosphorylation. Thus, it will be interesting to determine whether HGK activates TAK1 by phosphorylation of Ser-192, similar to how TAK1 is autophosphorylated in response to IL-1. Autophosphorylation of a kinase may be mediated by either an inter- or intramolecular reaction. One common example of intermolecular autophosphorylation is the activation of receptor tyrosine kinases (30.Stock J. Curr. Biol. 1996; 6: 825-827Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). Upon ligand binding, these receptors form homodimers and phosphorylate their dimerized partner, resulting in activation of the kinase. Similar mechanisms of activation have been described for such MAPKKKs as ASK1 and MLK3 (10.Leung I.W. Lassam N. J. Biol. Chem. 1998; 273: 32408-32415Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar, 11.Gotoh Y. Cooper J.A. J. Biol. Chem. 1998; 273: 17477-17482Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar). In response to upstream stimuli, both MLK3 and ASK1 form homodimers and are consequently activated. Furthermore, they are highly active when overexpressed without upstream stimuli, presumably due to spontaneous dimerization resulting from overexpression. This is not the case for TAK1, which has virtually no kinase activity when overexpressed alone. Furthermore, we have shown here that autophosphorylation of TAK1 occurs by an intramolecular reaction. In addition, we performed co-immunoprecipitation assays using two different epitope-tagged versions of TAK1 (HA-TAK1 and FLAG-TAK1). HA-TAK1 was not coprecipitated with FLAG-TAK1 in IL-1-treated cells or in cells cotransfected with TAB1. 2K. Kishimoto, unpublished observation. Therefore, it appears that the activation of TAK1 does not involve dimerization. Similarly, autophosphorylation by an intramolecular reaction has been reported for MEKK1 and Ssk2 (7.Deak J.C. Templeton D.J. Biochem. J. 1997; 322: 185-192Crossref PubMed Scopus (61) Google Scholar, 9.Posas F. Saito H. EMBO J. 1998; 17: 1385-1394Crossref PubMed Scopus (252) Google Scholar). The potential autophosphorylation sites of TAK1, MEKK1, and Ssk2 are present at homologous positions within their activation loops. In the case of TAK1, we have demonstrated that another protein, TAB1, is required for autophosphorylation and activation. Interestingly, autophosphorylation of Ssk2 also requires the interacting protein Ssk1, which functions as an upstream regulator of Ssk2 (9.Posas F. Saito H. EMBO J. 1998; 17: 1385-1394Crossref PubMed Scopus (252) Google Scholar). Thus, TAK1, Ssk2, and possibly MEKK1 may be regulated by a common activation mechanism. Collectively, these observations suggest that there are at least two different mechanisms for MAPKKK activation that involve autophosphorylation, namely dimerization-induced intermolecular autophosphorylation and regulator-dependent intramolecular autophosphorylation. IL-1 plays a central role in proinflammatory responses. Cellular responses to IL-1 are mediated by cascades of intracellular signaling events, including activation of NF-κB as well as activation of JNK (31.Dinarello C.A. Blood. 1996; 87: 2095-2147Crossref PubMed Google Scholar). Upon binding of IL-1 to its receptor, the IL-1 signal is transduced from the IL-1 receptor complex to an adapter protein, TNF-associated factor 6 (32.Cao Z. Xiong J. Takeuchi M. Kurama T. Goeddel D.V. Nature. 1996; 383: 443-446Crossref PubMed Scopus (1123) Google Scholar). Following exposure of the cells to IL-1, TAK1 is recruited to the TNF-associated factor 6 complex, where it becomes activated (21.Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar). Activated TAK1 then stimulates a MAPK cascade leading to JNK activation and an NF-κB-inducing kinase/IκB kinase cascade leading to NF-κB activation. We have demonstrated here that TAK1 is activated via autophosphorylation in response to IL-1. How, then, does IL-1 induce TAK1 autophosphorylation? Although endogenous TAK1 constitutively associates with TAB1, it remains unphosphorylated and inactive in the absence of IL-1 stimulation. Therefore, binding of TAB1 to TAK1 is not sufficient to induce phosphorylation and activation of endogenous TAK1 in vivo. On the other hand, ectopically expressed TAK1 is activated by coexpression with TAB1 even in the absence of IL-1. Furthermore, when endogenous TAK1·TAB1 complexes prepared from unstimulated cells are incubated in vitro with ATP, TAK1 is phosphorylated and activated. Thus, binding of TAB1 to TAK1 seems to be sufficient for activation in vitro. These results raise the possibility that a putative inhibitory factor blocks the activity of the endogenous TAK1·TAB1 complex in the absence of IL-1 stimulation. IL-1 treatment may disrupt this inhibitory regulation and thereby allow autophosphorylation and subsequent activation of TAK1 to proceed. Further study to identify this inhibitory regulation of TAK1 will be needed. We thank E. Nishida for helpful discussions and M. Lamphier and R. Ruggieri for critical reading of the manuscript." @default.
• W2059969460 created "2016-06-24" @default.
• W2059969460 creator A5011607655 @default.
• W2059969460 creator A5044516003 @default.
• W2059969460 creator A5078826648 @default.
• W2059969460 date "2000-03-01" @default.
• W2059969460 modified "2023-10-18" @default.
• W2059969460 title "TAK1 Mitogen-activated Protein Kinase Kinase Kinase Is Activated by Autophosphorylation within Its Activation Loop" @default.
• W2059969460 cites W1505363336 @default.
• W2059969460 cites W1515994079 @default.
• W2059969460 cites W1575383081 @default.
• W2059969460 cites W1666849257 @default.
• W2059969460 cites W1811565239 @default.
• W2059969460 cites W1938497882 @default.
• W2059969460 cites W1965583863 @default.
• W2059969460 cites W1968160256 @default.
• W2059969460 cites W1968606500 @default.
• W2059969460 cites W1969393277 @default.
• W2059969460 cites W1975085160 @default.
• W2059969460 cites W2002494513 @default.
• W2059969460 cites W2005792688 @default.
• W2059969460 cites W2008019124 @default.
• W2059969460 cites W2014732549 @default.
• W2059969460 cites W2014862668 @default.
• W2059969460 cites W2025548430 @default.
• W2059969460 cites W2031861066 @default.
• W2059969460 cites W2032582358 @default.
• W2059969460 cites W2055437587 @default.
• W2059969460 cites W2057069307 @default.
• W2059969460 cites W2064439294 @default.
• W2059969460 cites W2064558057 @default.
• W2059969460 cites W2068502127 @default.
• W2059969460 cites W2072061824 @default.
• W2059969460 cites W2075104267 @default.
• W2059969460 cites W2089938437 @default.
• W2059969460 cites W2090193716 @default.
• W2059969460 cites W2095152292 @default.
• W2059969460 cites W2132188426 @default.
• W2059969460 cites W2132805386 @default.
• W2059969460 cites W2155868854 @default.
• W2059969460 doi "https://doi.org/10.1074/jbc.275.10.7359" @default.
• W2059969460 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10702308" @default.
• W2059969460 hasPublicationYear "2000" @default.
• W2059969460 type Work @default.
• W2059969460 sameAs 2059969460 @default.
• W2059969460 citedByCount "252" @default.
• W2059969460 countsByYear W20599694602012 @default.
• W2059969460 countsByYear W20599694602013 @default.
• W2059969460 countsByYear W20599694602014 @default.
• W2059969460 countsByYear W20599694602015 @default.
• W2059969460 countsByYear W20599694602016 @default.
• W2059969460 countsByYear W20599694602017 @default.
• W2059969460 countsByYear W20599694602018 @default.
• W2059969460 countsByYear W20599694602019 @default.
• W2059969460 countsByYear W20599694602020 @default.
• W2059969460 countsByYear W20599694602021 @default.
• W2059969460 countsByYear W20599694602022 @default.
• W2059969460 countsByYear W20599694602023 @default.
• W2059969460 crossrefType "journal-article" @default.
• W2059969460 hasAuthorship W2059969460A5011607655 @default.
• W2059969460 hasAuthorship W2059969460A5044516003 @default.
• W2059969460 hasAuthorship W2059969460A5078826648 @default.
• W2059969460 hasBestOaLocation W20599694601 @default.
• W2059969460 hasConcept C124160383 @default.
• W2059969460 hasConcept C132149769 @default.
• W2059969460 hasConcept C137361374 @default.
• W2059969460 hasConcept C150109051 @default.
• W2059969460 hasConcept C159479382 @default.
• W2059969460 hasConcept C161238802 @default.
• W2059969460 hasConcept C184235292 @default.
• W2059969460 hasConcept C185592680 @default.
• W2059969460 hasConcept C59143045 @default.
• W2059969460 hasConcept C82495950 @default.
• W2059969460 hasConcept C86803240 @default.
• W2059969460 hasConcept C90934575 @default.
• W2059969460 hasConcept C95444343 @default.
• W2059969460 hasConcept C97029542 @default.
• W2059969460 hasConcept C99405784 @default.
• W2059969460 hasConceptScore W2059969460C124160383 @default.
• W2059969460 hasConceptScore W2059969460C132149769 @default.
• W2059969460 hasConceptScore W2059969460C137361374 @default.
• W2059969460 hasConceptScore W2059969460C150109051 @default.
• W2059969460 hasConceptScore W2059969460C159479382 @default.
• W2059969460 hasConceptScore W2059969460C161238802 @default.
• W2059969460 hasConceptScore W2059969460C184235292 @default.
• W2059969460 hasConceptScore W2059969460C185592680 @default.
• W2059969460 hasConceptScore W2059969460C59143045 @default.
• W2059969460 hasConceptScore W2059969460C82495950 @default.
• W2059969460 hasConceptScore W2059969460C86803240 @default.
• W2059969460 hasConceptScore W2059969460C90934575 @default.
• W2059969460 hasConceptScore W2059969460C95444343 @default.
• W2059969460 hasConceptScore W2059969460C97029542 @default.
• W2059969460 hasConceptScore W2059969460C99405784 @default.
• W2059969460 hasIssue "10" @default.
• W2059969460 hasLocation W20599694601 @default.
• W2059969460 hasOpenAccess W2059969460 @default.
• W2059969460 hasPrimaryLocation W20599694601 @default.
• W2059969460 hasRelatedWork W1504003784 @default.

• next