FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2060815067> ?p ?o ?g. }

• W2060815067 endingPage "147" @default.
• W2060815067 startingPage "141" @default.
• W2060815067 abstract "Activated pancreatic stellate cells (PSCs) have recently been implicated in the pathogenesis of pancreatic fibrosis and inflammation. Peroxisome proliferator-activated receptor γ (PPAR-γ) is a ligand-activated transcription factor which controls growth, differentiation, and inflammation in different tissues. Roles of PPAR-γ activation in PSCs are poorly characterized. Here we examined the effects of PPAR-γ ligands on the key parameters of PSC activation. PSCs were isolated from rat pancreas tissue, and used in their culture-activated, myofibroblast-like phenotype. Activation of PPAR-γ was induced with 15-deoxy-Δ12,14-prostaglandin J2(15d-PGJ2) or with troglitazone. Expression of PPAR-γ was predominantly localized in the nuclei, and PPAR-γ was transcriptionally active after ligand stimulation. PPAR-γ ligands inhibited platelet-derived growth factor-induced proliferation. This effect was associated with inhibition of cell cycle progression beyond the G1 phase. PPAR-γ ligands decreased α-smooth muscle actin protein expression and α1(I) procollagen and prolyl 4-hydroxylase(α) mRNA levels. Activation of PPAR-γ also resulted in the inhibition of inducible monocyte chemoattractant protein-1 expression. 15d-PGJ2, but not troglitazone, inhibited the degradation of IκB-α and consequent NF-κB activation. In conclusion, activation of PPAR-γ inhibited profibrogenic and proinflammatory actions in activated PSCs, suggesting a potential application of PPAR-γ ligands in the treatment of pancreatic fibrosis and inflammation. Activated pancreatic stellate cells (PSCs) have recently been implicated in the pathogenesis of pancreatic fibrosis and inflammation. Peroxisome proliferator-activated receptor γ (PPAR-γ) is a ligand-activated transcription factor which controls growth, differentiation, and inflammation in different tissues. Roles of PPAR-γ activation in PSCs are poorly characterized. Here we examined the effects of PPAR-γ ligands on the key parameters of PSC activation. PSCs were isolated from rat pancreas tissue, and used in their culture-activated, myofibroblast-like phenotype. Activation of PPAR-γ was induced with 15-deoxy-Δ12,14-prostaglandin J2(15d-PGJ2) or with troglitazone. Expression of PPAR-γ was predominantly localized in the nuclei, and PPAR-γ was transcriptionally active after ligand stimulation. PPAR-γ ligands inhibited platelet-derived growth factor-induced proliferation. This effect was associated with inhibition of cell cycle progression beyond the G1 phase. PPAR-γ ligands decreased α-smooth muscle actin protein expression and α1(I) procollagen and prolyl 4-hydroxylase(α) mRNA levels. Activation of PPAR-γ also resulted in the inhibition of inducible monocyte chemoattractant protein-1 expression. 15d-PGJ2, but not troglitazone, inhibited the degradation of IκB-α and consequent NF-κB activation. In conclusion, activation of PPAR-γ inhibited profibrogenic and proinflammatory actions in activated PSCs, suggesting a potential application of PPAR-γ ligands in the treatment of pancreatic fibrosis and inflammation. pancreatic stellate cell α-smooth muscle actin activator protein-1 extracellular signal-regulated kinase interleukin c-Jun N-terminal kinase/stress-activated protein kinase monocyte chemoattractant protein-1 nuclear factor-κB platelet-derived growth factor 15-deoxy-Δ12,14-prostaglandin J2 peroxisome proliferator-activated receptor tumor necrosis factor-α Recently, star-shaped cells in the pancreas, namely pancreatic stellate cells (PSCs),1 have been identified and characterized (1Bachem M.G. Schneider E. Gross H. Weidenbach H. Schmidt R.M. Menke A. Siech M. Beger H. Grunert A. Adler G. Gastroenterology. 1998; 115: 421-432Abstract Full Text Full Text PDF PubMed Scopus (859) Google Scholar, 2Apte M.V. Haber P.S. Applegate T.L. Norton I.D. McCaughan G.W. Korsten M.A. Pirola R.C. Wilson J.S. Gut. 1998; 43: 128-133Crossref PubMed Scopus (737) Google Scholar). They are morphologically similar to the hepatic stellate cells that play a central role in the inflammation and fibrogenesis of the liver (3Friedman S.D. N. Engl. J. Med. 1993; 328: 1828-1835Crossref PubMed Scopus (0) Google Scholar). There is accumulating evidence that PSCs, like hepatic stellate cells, are responsible for the development of pancreatic fibrosis (1Bachem M.G. Schneider E. Gross H. Weidenbach H. Schmidt R.M. Menke A. Siech M. Beger H. Grunert A. Adler G. Gastroenterology. 1998; 115: 421-432Abstract Full Text Full Text PDF PubMed Scopus (859) Google Scholar, 2Apte M.V. Haber P.S. Applegate T.L. Norton I.D. McCaughan G.W. Korsten M.A. Pirola R.C. Wilson J.S. Gut. 1998; 43: 128-133Crossref PubMed Scopus (737) Google Scholar, 4Haber P.S. Keogh G.W. Apte M.V. Moran C.S. Stewart N.L. Crawford D.H. Pirola R.C. McCaughan G.W. Ramm G.A. Wilson J.S. Am. J. Pathol. 1999; 155: 1087-1095Abstract Full Text Full Text PDF PubMed Scopus (352) Google Scholar). In the normal pancreas, stellate cells are quiescent and can be identified by the presence of vitamin A-containing lipid droplets in the cytoplasm. In response to pancreatic injury or inflammation, they are transformed (“activated”) from their quiescent phenotype into highly proliferative myofibroblast-like cells. This process involves changes in cell morphology and gene expression and is characterized by the gradual loss of retinoid content, increased expression of the cytoskeletal protein α-smooth muscle actin (α-SMA), and synthesis of type I collagen and other extracellular matrix components. Many of the morphological and metabolic changes associated with the activation of PSCs in animal models of fibrosis also occur when these cells are grown in culture on plastic (1Bachem M.G. Schneider E. Gross H. Weidenbach H. Schmidt R.M. Menke A. Siech M. Beger H. Grunert A. Adler G. Gastroenterology. 1998; 115: 421-432Abstract Full Text Full Text PDF PubMed Scopus (859) Google Scholar, 2Apte M.V. Haber P.S. Applegate T.L. Norton I.D. McCaughan G.W. Korsten M.A. Pirola R.C. Wilson J.S. Gut. 1998; 43: 128-133Crossref PubMed Scopus (737) Google Scholar). It has also been suggested that PSCs may participate in the pathogenesis of acute pancreatitis (1Bachem M.G. Schneider E. Gross H. Weidenbach H. Schmidt R.M. Menke A. Siech M. Beger H. Grunert A. Adler G. Gastroenterology. 1998; 115: 421-432Abstract Full Text Full Text PDF PubMed Scopus (859) Google Scholar, 5Wells R.G. Crawford J.M. Gastroenterology. 1998; 115: 491-493Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). The peroxisome proliferator-activated receptor-γ (PPAR-γ) is a member of the nuclear hormone receptor superfamily originally reported to be expressed at high levels in adipose tissue and to play a critical role in adipocyte differentiation (6Evans R.M. Science. 1988; 240: 889-895Crossref PubMed Scopus (6341) Google Scholar, 7Tontonoz P. Hu E. Spiegelman B.M. Cell. 1994; 79: 1147-1156Abstract Full Text PDF PubMed Scopus (3133) Google Scholar). Ligands of PPAR-γ include oxidative metabolites of polyunsaturated fatty acids and prostaglandins of the J series such as 15-deoxy-Δ12,14-prostaglandin J2 (15d-PGJ2) (8Forman B.M. Tontonoz P. Chen J. Brun R.P. Spiegelman B.M. Evans R.M. Cell. 1995; 83: 803-812Abstract Full Text PDF PubMed Scopus (2740) Google Scholar). Although the precise enzymatic pathway leading to 15d-PGJ2 generation is not completely understood, it has been shown that 15d-PGJ2 is produced in intact cells and organisms (9Gilroy D.W. Colville-Nash P.R. Willis D. Chivers J. Paul-Clark M.J. Willoughby D.A. Nat. Med. 1999; 5: 698-701Crossref PubMed Scopus (1123) Google Scholar) and is likely to represent a physiological ligand for PPAR-γ. PPAR-γ is also activated by antidiabetic drugs of the thiazolidinedione group such as troglitazone (10Lehmann J.M. Moore L.B. Smith-Oliver T.A. Wilkison W.O. Willson T.M. Kliewer S.A. J. Biol. Chem. 1995; 270: 12953-12956Abstract Full Text Full Text PDF PubMed Scopus (3469) Google Scholar). There is accumulating evidence that PPAR-γ is implicated as an important regulator of inflammatory and immune responses (11Ricote M. Li A.C. Willson T.M. Kelly C.J. Glass C.K. Nature. 1998; 391: 79-82Crossref PubMed Scopus (3271) Google Scholar, 12Jiang C. Ting A.T. Seed B. Nature. 1998; 391: 82-86Crossref PubMed Scopus (539) Google Scholar). PPAR-γ ligands were shown to inhibit the production of nitric oxide and macrophage-derived cytokines,i.e. tumor necrosis factor-α (TNF-α), interleukin (IL)-1, and IL-6, at least in part by antagonizing the activation of transcription factors such as activator protein-1 (AP-1) and nuclear factor κB (NF-κB) (11Ricote M. Li A.C. Willson T.M. Kelly C.J. Glass C.K. Nature. 1998; 391: 79-82Crossref PubMed Scopus (3271) Google Scholar, 12Jiang C. Ting A.T. Seed B. Nature. 1998; 391: 82-86Crossref PubMed Scopus (539) Google Scholar). They also induce apoptosis in several types of cells including macrophages (13Chinetti G. Griglio S. Autonucci M. Torra I.P. Delerive P. Majd Z. Fruchart J.-C. Chapman J. Najib J. Staels B. J. Biol. Chem. 1998; 273: 25573-25580Abstract Full Text Full Text PDF PubMed Scopus (856) Google Scholar), fibroblasts (14Altiok S. Xu M. Spiegelman B.M. Genes Dev. 1997; 11: 1987-1998Crossref PubMed Scopus (337) Google Scholar), and endothelial cells (15Bishop-Bailey D. Hla T. J. Biol. Chem. 1998; 274: 17042-17048Abstract Full Text Full Text PDF Scopus (407) Google Scholar). Although PPAR-γ gene expression is reportedly observed in a variety of tissues in addition to the adipose tissue, little is known about the pathophysiological relevance of PPAR-γ activation in PSCs. In this study, we examined the effects of PPAR-γ ligands on the activation of PSCs: proliferation, expression of α-SMA, expression of α1(I) procollagen and prolyl 4-hydroxylase(α) genes, and monocyte chemoattractant protein 1 (MCP-1) production. We show here that PPAR-γ ligands inhibit these parameters of PSC activation, suggesting a potential application of PPAR-γ ligands in the treatment of pancreatic fibrosis and inflammation. 15d-PGJ2 and WY-14643, purchased from Biomol (Plymouth Meeting, PA), were resuspended at 10 and 100 mm, respectively, in dimethyl sulfoxide. Poly(dI-dC)-poly(dI-dC), [α-32P]dCTP, and [γ-32P]ATP were from Amersham Biosciences, Inc. Rat IL-1β and TNF-α were from Endogen (Woburn, MA). Recombinant rat platelet-derived growth factor (PDGF)-BB was from R&D Systems (Minneapolis, MN). Recombinant human epidermal growth factor was from Life Technologies, Inc. Rabbit antibody against IκB-α was purchased from New England Biolabs (Beverly, MA). Rabbit polyclonal antibody against PPAR-γ was from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit antibodies against rat type I collagen and prolyl 4-hydroxylase(α) were from LSL Cosmo Bio (Tokyo, Japan). Troglitazone was kindly provided by Sankyo Pharmaceutical Co. (Tokyo, Japan) and dissolved at 10 mm in dimethyl sulfoxide. All other reagents were from Sigma unless specifically described. Rat PSCs were prepared as previously described using Nycodenz solution (2Apte M.V. Haber P.S. Applegate T.L. Norton I.D. McCaughan G.W. Korsten M.A. Pirola R.C. Wilson J.S. Gut. 1998; 43: 128-133Crossref PubMed Scopus (737) Google Scholar). All animal procedures were performed in accordance with the National Institutes of Health Animal Care and Use Guidelines. Isolated stellate cells were cultured in Ham's F-12 containing 10% fetal bovine serum (ICN Biomedicals, Aurora, OH), penicillin sodium, and streptomycin sulfate. All experiments were performed using cells between passages two and five. Cells were grown on 96-well flat-bottom plates for cell proliferation assay and enzyme-linked immunosorbent assay or on tissue culture dishes for other experiments. On the day of experiment, cells were refed with fresh medium containing 0.1% fetal bovine serum, incubated for 6 h, and treated with experimental reagents in the presence of 0.1% fetal bovine serum. We assessed PPAR-γ expression in activated PSCs by immunohistochemical staining. Culture-activated PSCs were grown directly on glass coverslips, and immunostaining for PPAR-γ was performed using a streptavidin-biotin-peroxidase complex detection kit (Histofine Kit; Nichirei, Tokyo, Japan) according to the manufacturer's instruction. Incubations were performed at room temperature unless otherwise specified. Cells were fixed with ice-cold methanol for 10 min, and then endogenous peroxidase activity was blocked by incubation in methanol with 0.3% hydrogen peroxide for 30 min. After immersion in normal rabbit serum for 1 h, the slides were incubated with rabbit polyclonal anti-PPAR-γ antibody diluted at 1:100 in phosphate-buffered saline or rabbit immunoglobulin G at 4 °C overnight. The slides were incubated with biotinylated goat anti-rabbit immunoglobulin antibody for 45 min followed by peroxidase-conjugated streptavidin for 30 min. Finally, color was developed by incubating the slides for several minutes with diaminobenzidine (Dojindo, Kumamoto, Japan). Expression of α-SMA, type I collagen, and prolyl 4-hydroxylase(α) was examined in a similar manner. The luciferase expression vector containing three PPAR-responsive elements (16Osada S. Tsukamoto T. Takiguchi M. Mori M. Osumi T. Genes Cells. 1997; 2: 315-327Crossref PubMed Scopus (48) Google Scholar) was kindly provided by Dr. Takashi Osumi (Himeji Institute of Technology, Hyogo, Japan). The vector contains three copies of PPAR responsive element from the promoter of rat acyl coenzyme A oxidase. For the luciferase assay, ∼1 × 106 PSCs were transfected with 2 μg of the luciferase expression vector along with 40 ng of pRL-TK vector (Promega, Madison, WI) as an internal control, using LipofectAMINE reagent (Life Technologies, Inc.). After 24 h, the transfected cells were treated with 15d-PGJ2 (at 5 μm), troglitazone (at 10 μm), or vehicle (0.1% dimethyl sulfoxide) for an additional 24 h. At the end of the incubation, cell lysates were prepared using a Pica Gene kit (Toyo Ink Co., Tokyo, Japan), and the light intensities were measured using a model Lumat LB9507 luminescence reader (EG&G Berthold, Bad Wildbad, Germany). PSCs (∼30% density) were treated with 15d-PGJ2 or troglitazone at various concentrations for 1 h and then stimulated with PDGF (at 10 ng/ml), fetal bovine serum (at 5%), or epidermal growth factor (at 5 ng/ml) for 72 h. Cell proliferation was assessed using a commercial kit (CellTiter nonradioactive cell proliferation assay, Promega) according to the manufacturer's instruction. Cell viability was determined by differences in absorbance at wavelength 570versus 690 nm. The cell cycle of PSCs was analyzed by flow cytometry. Briefly, serum-deprived PSCs (∼60–70% density) were treated with 15d-PGJ2 (5 μm), troglitazone (10 μm), or its vehicle for 1 h and then exposed to 10 ng/ml PDGF. After 24 h, cells were harvested and washed twice with phosphate-buffered saline. Cells were suspended in phosphate-buffered saline solution containing 40 μg/ml propidium iodide, 0.02% Triton X-100, and 50 μg/ml ribonuclease A. Samples were incubated in the dark at room temperature for 30 min and stored at 4 °C until analysis. Cell fluorescence was measured by FACSCaliber flow cytometer (Becton Dickinson Co. Ltd., Tokyo, Japan) and analyzed using ModFit LT software (Verity Software House, Topsham, ME) to determine the distribution of cells in the various phases of the cell cycle. Confluent PSCs were treated with PPAR-γ ligands at indicated concentrations for 30 min and then stimulated with IL-1β (at 10 ng/ml) or TNF-α (at 10 ng/ml). After 24 h, cell culture supernatants were harvested and stored at −80 °C until measurement. MCP-1 levels in the supernatants were measured by enzyme-linked immunosorbent assay (Endogen) according to the manufacturer's instruction. Total RNA was isolated using RNeasy total RNA preparation kit (Qiagen, Chatsworth, CA). Ten μg of total RNA was separated on a 1% agarose-2.2 m formaldehyde gel and transferred to a nylon membrane filter (Amersham Biosciences, Inc.). Blots were hybridized for 16 h at 42 °C to the32P-labeled DNA probes of MCP-1, α1(I) procollagen, and prolyl 4-hydroxylase(α) generated by polymerase chain reaction. Specific primer sets were as follows (listed as 5′-3′, sense and antisense, respectively): MCP-1, AGCCAGATGCAGTTAATGCC and GGAAAAGAGAGTGGATGCAT; α1(I) procollagen, CCTGCTGGACCCCGAGGAAAC and TCACACCAGTATCACCAGGT; prolyl 4-hydroxylase(α), TACTTCCTCAGTGTTCAGCC and CATCCAGAGTTCTGTGTGGT. The PCR procedure consisted of 30 cycles at 94 °C (for 1 min), at 55 °C (for 1 min), and at 72 °C (for 1 min). The identity of the reverse transcription-polymerase chain reaction was confirmed by direct sequencing. After the hybridization, the filter was washed three times with 2× standard saline citrate (3m NaCl, 0.3 m sodium citrate) and 0.1% SDS at 42 °C for 10 min. The washed filter was subjected to autoradiography at −80 °C overnight. Nuclear extracts were prepared, and an electrophoretic mobility shift assay was performed as described previously (17Masamune A. Igarashi Y. Hakomori S. J. Biol. Chem. 1996; 271: 9368-9375Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). Double-stranded oligonucleotide probes for NF-κB (5′-AGTTGAGGGGACTTTCCCAGGC-3′) and AP-1 (5′-CGCTTGATGAGTCAGCCGGAA-3′) were end-labeled with [γ-32P]ATP. Nuclear extracts (∼5 μg) were incubated with the labeled oligonucleotide probe for 20 min at 22 °C and electrophoresed through a 4% polyacrylamide gel. Gels were dried and autoradiographed at −80 °C overnight. A 100-fold excess of unlabeled oligonucleotide was incubated with nuclear extracts for 10 min prior to the addition of the radiolabeled probe in the competition experiments. PSCs were treated with experimental reagents and lysed in SDS buffer (62.5 mm Tris-HCl at pH 6.8, 2% SDS, 10% glycerol, 50 mm dithiothreitol, 0.1% bromphenol blue) for 15 min on ice. The samples were then sonicated for 2 s, heated for 5 min, and centrifuged at 12000 ×g for 5 min to remove insoluble cell debris. Whole cell extracts (∼100 μg protein) were fractionated on a 10% SDS polyacrylamide gel (Bio-Rad) and transferred to a nitrocellulose membrane (Bio-Rad). The membrane was incubated with the first antibody at 4 °C overnight. After incubation with the secondary antibody (horseradish peroxidase-conjugated), proteins were visualized using an ECL kit (Amersham Biosciences, Inc.). Differences between experimental groups were evaluated by the two-tailed unpaired Student'st test for other studies. A p value of less than 0.05 was considered statistically significant. It has been shown that PSCs are activated (express α-SMA) after ∼48 h of culture on plastic (2Apte M.V. Haber P.S. Applegate T.L. Norton I.D. McCaughan G.W. Korsten M.A. Pirola R.C. Wilson J.S. Gut. 1998; 43: 128-133Crossref PubMed Scopus (737) Google Scholar). As mentioned earlier, all experiments used passaged stellate cells, which were considered activated. Indeed, the fibrillary staining of α-SMA was observed by immunostaining (Fig.1A). We examined PPAR-γ expression by immunostaining. Culture-activated PSCs (on day 7, passage 2) showed positive staining of PPAR-γ predominantly in the nuclei (Fig. 1B). No immunoreactivity was observed when nonspecific rabbit immunoglobulin G was used (data not shown). We also investigated whether PPAR-γ exerts transcriptional effects in culture-activated PSCs. In cells transiently transfected with a luciferase reporter plasmid consisting of three copies of the PPAR-responsive element (16Osada S. Tsukamoto T. Takiguchi M. Mori M. Osumi T. Genes Cells. 1997; 2: 315-327Crossref PubMed Scopus (48) Google Scholar), exposure to 15d-PGJ2 (at 5 μm) and troglitazone (at 10 μm) induced an ∼5-fold increase in the activity of the reporter gene (Fig. 1C). These results indicated that PPAR-γ is expressed and transcriptionally active after ligand stimulation in activated PSCs. It has been shown that PPAR-γ ligands modulate cell proliferation in several types of cells (13Chinetti G. Griglio S. Autonucci M. Torra I.P. Delerive P. Majd Z. Fruchart J.-C. Chapman J. Najib J. Staels B. J. Biol. Chem. 1998; 273: 25573-25580Abstract Full Text Full Text PDF PubMed Scopus (856) Google Scholar, 14Altiok S. Xu M. Spiegelman B.M. Genes Dev. 1997; 11: 1987-1998Crossref PubMed Scopus (337) Google Scholar, 15Bishop-Bailey D. Hla T. J. Biol. Chem. 1998; 274: 17042-17048Abstract Full Text Full Text PDF Scopus (407) Google Scholar). We examined whether PPAR-γ ligands could modulate proliferation of PSCs. Consistent with the previous report (18Apte M.V. Haber P.S. Darby S.J. Rodgers S.C. McCaughan G.W. Korsten M.A. Pirola R.C. Wilson J.S. Gut. 1999; 44: 534-541Crossref PubMed Scopus (488) Google Scholar), PDGF induced an approximately 7-fold increase of cell proliferation in serum-free medium after 72 h (Fig.2A). PPAR-γ ligands (15d-PGJ2 or troglitazone) inhibited PDGF-induced cell proliferation in a dose-dependent manner (Fig.2A). The inhibitory effects were significant starting at 1 μm for 15d-PGJ2 and at 2.5 μmfor troglitazone. At 5 μm 15d-PGJ2 or 10 μm troglitazone, the stimulation of cell proliferation by PDGF was virtually abolished. In these experiments, 15d-PGJ2 and troglitazone up to these concentrations did not affect the cell viability during the incubation as assessed by a trypan blue exclusion test (data not shown). However, when PSCs were treated with PPAR-γ ligands above these concentrations, cytotoxic effects were observed during the incubation. Treatment with a different peroxisome proliferator, WY-14643, at the concentration (at 10 μm) able to activate the PPAR-α isoform did not inhibit PSC proliferation, but it did inhibit PSC proliferation at the concentration (at 100 μm) also able to activate PPAR-γ (19Willson T.M. Brown P.J. Sternbach D.D. Henke B.R. J. Med. Chem. 2000; 43: 527-550Crossref PubMed Scopus (1706) Google Scholar) (Fig. 2B). We also tested the effects of PPAR-γ ligands on cell proliferation in response to epidermal growth factor or 10% fetal bovine serum. Serum-induced cell proliferation was inhibited by PPAR-γ ligands, although the inhibitory effects were less evident than in cells treated with PDGF (Fig. 2C). In addition, the proliferative response induced by epidermal growth factor was inhibited by PPAR-γ ligands (Fig. 2C), indicating that PPAR-γ ligands inhibit proliferation of PSCs independently of the mitogen used. We analyzed the cell cycle in PSCs in the presence or absence of PPAR-γ ligands. Exposure to PDGF was associated with a marked decrease in the percentage of cells in the G0/G1 phase together with an increase in the number of cells in the S phase (Fig.3). The addition of the PPAR-γ ligands before PDGF reduced the number of cells in the S phase, and the percentage of cells in the G0/G1 phase was similar to the percentage observed in untreated cells. Thus, the addition of PPAR-γ ligands inhibited PDGF-induced progression of the cell cycle beyond the G1 phase. It has been shown that culture-activated PSCs express α-SMA and produce type I collagen. Indeed, α-SMA expression has been accepted as a marker of PSC activation (2Apte M.V. Haber P.S. Applegate T.L. Norton I.D. McCaughan G.W. Korsten M.A. Pirola R.C. Wilson J.S. Gut. 1998; 43: 128-133Crossref PubMed Scopus (737) Google Scholar), and in situhybridization techniques showed that α-SMA-positive cells were the principal source of collagen in the fibrotic pancreas (4Haber P.S. Keogh G.W. Apte M.V. Moran C.S. Stewart N.L. Crawford D.H. Pirola R.C. McCaughan G.W. Ramm G.A. Wilson J.S. Am. J. Pathol. 1999; 155: 1087-1095Abstract Full Text Full Text PDF PubMed Scopus (352) Google Scholar). In agreement with the result of immunostaining, α-SMA expression was confirmed in culture-activated PSCs by Western blotting, and the treatment of PSCs with PPAR-γ ligands for 48 h significantly reduced α-SMA expression (Fig. 4A). We also examined the effects of PPAR-γ ligands on the expression of α1(I) procollagen and prolyl 4-hydroxylase(α) genes, both of which play a central role in the collagen synthesis. Type I collagen immunoreaction was detected predominantly intracellularly with the highest intensity in the perinuclear region (Fig. 4B). Prolyl 4-hydroxylase(α) is also a key enzyme that catalyzes the formation of 4-hydroxyproline, an essential residue for the folding of the procollagen polypeptide chains into triple helical molecules (21Takahashi Y. Takahashi S. Shiga Y. Yoshimi T. Miura T. J. Biol. Chem. 2000; 275: 14139-14146Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar). Expression of prolyl 4-hydroxylase(α) was observed strongly around the nuclei, and the expression spread toward the periphery of the cells (Fig. 4C). Steady-state mRNA levels of α1(I) procollagen and prolyl 4-hydroxylase(α) were high in culture-activated PSCs, and the levels were significantly decreased by PPAR-γ ligands after a 24-h incubation (Fig. 4D). Activated PSCs acquire the proinflammatory phenotype, and they may modulate the recruitment and activation of inflammatory cells. One candidate may be MCP-1, a potent chemoattractant for monocytes and T lymphocytes (22Ben-Baruch A. Michiel D.F. Oppenheim J.J. J. Biol. Chem. 1995; 270: 11703-11706Abstract Full Text Full Text PDF PubMed Scopus (369) Google Scholar). Proinflammatory cytokines IL-1β and TNF-α induced MCP-1 production in PSCs (Fig. 5A). Both of the PPAR-γ ligands decreased the inducible MCP-1 expression in a dose-dependent manner (Fig. 5A). The inhibitory effects were significant starting at 1 μm for both reagents. At concentrations as high as 5 μm15d-PGJ2 or 10 μm troglitazone, the MCP-1 induction was virtually abolished. We also examined the effects of PPAR-γ ligands on the MCP-1 gene expression by Northern blotting. Both IL-1β and TNF-α increased the level of MCP-1 mRNA, but the effect was inhibited in the presence of PPAR-γ ligands (Fig.5B), suggesting that PPAR-γ ligands inhibited MCP-1 expression at least in part at the transcriptional level. Because activation of NF-κB and AP-1 is important for MCP-1 expression in several types of cells (23Ueda A. Ishigatsubo Y. Okubo T. Yoshimura T. J. Biol. Chem. 1997; 272: 31029-31092Abstract Full Text Full Text PDF PubMed Scopus (11) Google Scholar, 24Martin T. Cardarelli P.M. Parry G.C.N. Felts K.A. Cobb R.R. Eur. J. Immunol. 1997; 27: 1091-1097Crossref PubMed Scopus (295) Google Scholar), we investigated the effects of PPAR-γ ligands on the activation of these transcription factors. We first examined the effect of PPAR-γ ligands on NF-κB binding activity by electrophoretic mobility shift assay. Two NF-κB-specific DNA-protein complex formations were observed with nuclear proteins extracted from PSCs treated with IL-1β (Fig.6A). Preincubation of PSCs with 15d-PGJ2 decreased IL-1β-induced NF-κB binding activity, but troglitazone did not. Phosphorylation and degradation of the inhibitory protein IκB-α and the subsequent dissociation of this protein from NF-κB are thought to be necessary for the activation (25Grilli M. Chiu J.J.-S. Lenardo M.J. Int. Rev. Cytol. 1993; 143: 1-62Crossref PubMed Scopus (883) Google Scholar). We also examined the effect of PPAR-γ ligands on the level of IκB-α by Western blotting. In agreement with the result of electrophoretic mobility shift assay, 15d-PGJ2, but not troglitazone, inhibited IL-1β-induced degradation of IκB-α (Fig.6B). TNF-α also activated NF-κB, and the activation was inhibited by 15d-PGJ2 but not by troglitazone (data not shown). Neither 15d-PGJ2 nor troglitazone affected IL-1β- and TNF-α-induced AP-1-specific binding activity (Fig.7, data not shown).Figure 7PPAR-γ ligands did not alter IL-1β-induced AP-1 activation.PSCs were treated with 15d-PGJ2 or troglitazone at the indicated concentrations for 30 min and then stimulated with IL-1β (at 10 ng/ml). After 1 h, nuclear extracts were prepared, and specific binding activity of AP-1 was assessed by electrophoretic mobility shift assay.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Following pancreatic injury, PSCs undergo a transformation from quiescent cells to activated proliferating myofibroblast-like cells, which produce cytokines and extracellular matrix proteins. There is accumulating evidence that activated PSCs play principal roles in the pathogenesis of pancreatic fibrosis and inflammation (1Bachem M.G. Schneider E. Gross H. Weidenbach H. Schmidt R.M. Menke A. Siech M. Beger H. Grunert A. Adler G. Gastroenterology. 1998; 115: 421-432Abstract Full Text Full Text PDF PubMed Scopus (859) Google Scholar, 2Apte M.V. Haber P.S. Applegate T.L. Norton I.D. McCaughan G.W. Korsten M.A. Pirola R.C. Wilson J.S. Gut. 1998; 43: 128-133Crossref PubMed Scopus (737) Google Scholar, 4Haber P.S. Keogh G.W. Apte M.V. Moran C.S. Stewart N.L. Crawford D.H. Pirola R.C. McCaughan G.W. Ramm G.A. Wilson J.S. Am. J. Pathol. 1999; 155: 1087-1095Abstract Full Text Full Text PDF PubMed Scopus (352) Google Scholar, 5Wells R.G. Crawford J.M. Gastroenterology. 1998; 115: 491-493Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). The present study demonstrated that two PPAR-γ ligands, the endogenously produced prostanoid, 15d-PGJ2, and troglitazone, inhibited key parameters of PSC activation including cell proliferation, α-SMA expression, α1(I) procollagen and prolyl 4-hydroxylase(α) gene expression, and MCP-1 production. Treatment with a different peroxisome proliferator, WY-14643, at the concentration able to activate the PPAR-α isoform did not inhibit PSC proliferation but did so at the concentration also able to activate PPAR-γ, suggesting that specific activation of PPAR-γ is necessary to inhibit PSC proliferation. These inhibitory effects were not through the potential cytotoxic effects of PPAR-γ ligands, because th" @default.
• W2060815067 created "2016-06-24" @default.
• W2060815067 creator A5005492767 @default.
• W2060815067 creator A5010062675 @default.
• W2060815067 creator A5029930183 @default.
• W2060815067 creator A5034231699 @default.
• W2060815067 creator A5044706381 @default.
• W2060815067 creator A5071735777 @default.
• W2060815067 date "2002-01-01" @default.
• W2060815067 modified "2023-09-26" @default.
• W2060815067 title "Ligands of Peroxisome Proliferator-activated Receptor-γ Block Activation of Pancreatic Stellate Cells" @default.
• W2060815067 cites W1539392991 @default.
• W2060815067 cites W1561919952 @default.
• W2060815067 cites W1608005125 @default.
• W2060815067 cites W1633340712 @default.
• W2060815067 cites W1639924204 @default.
• W2060815067 cites W1966861485 @default.
• W2060815067 cites W1967846711 @default.
• W2060815067 cites W1971624992 @default.
• W2060815067 cites W1977666051 @default.
• W2060815067 cites W1978380407 @default.
• W2060815067 cites W1980722886 @default.
• W2060815067 cites W1989732890 @default.
• W2060815067 cites W1996267589 @default.
• W2060815067 cites W2002519246 @default.
• W2060815067 cites W2003115027 @default.
• W2060815067 cites W2005674716 @default.
• W2060815067 cites W2027550738 @default.
• W2060815067 cites W2028128714 @default.
• W2060815067 cites W2030588343 @default.
• W2060815067 cites W2034054192 @default.
• W2060815067 cites W2038990415 @default.
• W2060815067 cites W2047591801 @default.
• W2060815067 cites W2049868653 @default.
• W2060815067 cites W2053242629 @default.
• W2060815067 cites W2055453684 @default.
• W2060815067 cites W2064974844 @default.
• W2060815067 cites W2073802471 @default.
• W2060815067 cites W2073993982 @default.
• W2060815067 cites W2080988481 @default.
• W2060815067 cites W2085124463 @default.
• W2060815067 cites W2092819933 @default.
• W2060815067 cites W2095090793 @default.
• W2060815067 cites W2103633745 @default.
• W2060815067 cites W2111052846 @default.
• W2060815067 cites W2112172921 @default.
• W2060815067 cites W2116754355 @default.
• W2060815067 cites W2118881723 @default.
• W2060815067 cites W2124371647 @default.
• W2060815067 cites W2135778926 @default.
• W2060815067 cites W2155510164 @default.
• W2060815067 cites W2163207725 @default.
• W2060815067 cites W2164015929 @default.
• W2060815067 cites W2168051361 @default.
• W2060815067 cites W2171533490 @default.
• W2060815067 doi "https://doi.org/10.1074/jbc.m107582200" @default.
• W2060815067 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11606585" @default.
• W2060815067 hasPublicationYear "2002" @default.
• W2060815067 type Work @default.
• W2060815067 sameAs 2060815067 @default.
• W2060815067 citedByCount "130" @default.
• W2060815067 countsByYear W20608150672012 @default.
• W2060815067 countsByYear W20608150672013 @default.
• W2060815067 countsByYear W20608150672014 @default.
• W2060815067 countsByYear W20608150672015 @default.
• W2060815067 countsByYear W20608150672016 @default.
• W2060815067 countsByYear W20608150672017 @default.
• W2060815067 countsByYear W20608150672018 @default.
• W2060815067 countsByYear W20608150672019 @default.
• W2060815067 countsByYear W20608150672020 @default.
• W2060815067 countsByYear W20608150672021 @default.
• W2060815067 countsByYear W20608150672022 @default.
• W2060815067 countsByYear W20608150672023 @default.
• W2060815067 crossrefType "journal-article" @default.
• W2060815067 hasAuthorship W2060815067A5005492767 @default.
• W2060815067 hasAuthorship W2060815067A5010062675 @default.
• W2060815067 hasAuthorship W2060815067A5029930183 @default.
• W2060815067 hasAuthorship W2060815067A5034231699 @default.
• W2060815067 hasAuthorship W2060815067A5044706381 @default.
• W2060815067 hasAuthorship W2060815067A5071735777 @default.
• W2060815067 hasBestOaLocation W20608150671 @default.
• W2060815067 hasConcept C127078168 @default.
• W2060815067 hasConcept C134018914 @default.
• W2060815067 hasConcept C170493617 @default.
• W2060815067 hasConcept C176891718 @default.
• W2060815067 hasConcept C185592680 @default.
• W2060815067 hasConcept C187345961 @default.
• W2060815067 hasConcept C2524010 @default.
• W2060815067 hasConcept C2777210771 @default.
• W2060815067 hasConcept C33923547 @default.
• W2060815067 hasConcept C55493867 @default.
• W2060815067 hasConcept C86803240 @default.
• W2060815067 hasConcept C95444343 @default.
• W2060815067 hasConceptScore W2060815067C127078168 @default.
• W2060815067 hasConceptScore W2060815067C134018914 @default.
• W2060815067 hasConceptScore W2060815067C170493617 @default.
• W2060815067 hasConceptScore W2060815067C176891718 @default.
• W2060815067 hasConceptScore W2060815067C185592680 @default.

• next