FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2061377366> ?p ?o ?g. }

• W2061377366 endingPage "480" @default.
• W2061377366 startingPage "471" @default.
• W2061377366 abstract "Conversion of fibroblasts into myofibroblasts as mediated by transforming growth factor-β1 (TGF-β1) is the most prominent stromal reaction to a number of epithelial lesions including breast cancer. To identify genes which are regulated during this process, the mRNA profiles from primary breast fibroblasts treated with or without TGF-β1 were analyzed by differential display. Ninety-five differentially expressed transcripts were PCR-cloned and sequenced, and 28 clones were selected for verification in a hybridization array. By use of gene-specific sequence tags, nine differentially expressed genes were identified. One of the clones, identified as CLIC4, a member of the CLIC family of chloride channels, was up-regulated more than 16 times in myofibroblasts and was therefore chosen for further analysis. Using RT-PCR, comparison with CLIC1, CLIC2, CLIC3, and CLIC5 demonstrated that CLIC4 was unique by being up-regulated by TGF-β1 in myofibroblasts. Immunohistochemistry showed a hitherto unknown, distinctive pattern of CLIC4 expression in breast stroma. Whereas normal breast fibroblasts were devoid of CLIC4 protein expression, myofibroblasts of breast carcinomas were strongly CLIC4-positive. The functional significance of CLIC4 was analyzed in MEF/3T3 fibroblasts by conditional expression using the tetracycline-repressive gene regulation system. In a migration assay, we found that CLIC4 inhibited cell motility by 27%. These results suggest that CLIC4 is differentially regulated in fibroblasts and that its expression contributes to a collective stationary myofibroblast phenotype. Conversion of fibroblasts into myofibroblasts as mediated by transforming growth factor-β1 (TGF-β1) is the most prominent stromal reaction to a number of epithelial lesions including breast cancer. To identify genes which are regulated during this process, the mRNA profiles from primary breast fibroblasts treated with or without TGF-β1 were analyzed by differential display. Ninety-five differentially expressed transcripts were PCR-cloned and sequenced, and 28 clones were selected for verification in a hybridization array. By use of gene-specific sequence tags, nine differentially expressed genes were identified. One of the clones, identified as CLIC4, a member of the CLIC family of chloride channels, was up-regulated more than 16 times in myofibroblasts and was therefore chosen for further analysis. Using RT-PCR, comparison with CLIC1, CLIC2, CLIC3, and CLIC5 demonstrated that CLIC4 was unique by being up-regulated by TGF-β1 in myofibroblasts. Immunohistochemistry showed a hitherto unknown, distinctive pattern of CLIC4 expression in breast stroma. Whereas normal breast fibroblasts were devoid of CLIC4 protein expression, myofibroblasts of breast carcinomas were strongly CLIC4-positive. The functional significance of CLIC4 was analyzed in MEF/3T3 fibroblasts by conditional expression using the tetracycline-repressive gene regulation system. In a migration assay, we found that CLIC4 inhibited cell motility by 27%. These results suggest that CLIC4 is differentially regulated in fibroblasts and that its expression contributes to a collective stationary myofibroblast phenotype. The fibroblast is the most abundant cell type in normal connective tissues and plays a central role in synthesis, degradation, and remodeling of the extracellular matrix in health and disease. The majority of fibroblasts demonstrate the ability to convert into α-smooth muscle (α-sm) actin-containing myofibroblasts in response to specific stimuli.1Rønnov-Jessen L Petersen OW Bissell MJ Cellular changes involved in conversion of normal to malignant breast: the importance of the stromal reaction.Physiol Rev. 1996; 76: 69-125PubMed Google Scholar, 2Rønnov-Jessen L Stromal reaction to invasive cancer: the cellular origin of the myofibroblast and implications for tumor development.Breast J. 1996; 2: 320-339Crossref Scopus (16) Google Scholar, 3Elenbaas B Weinberg RA Heterotypic signaling between epithelial tumor cells and fibroblasts in carcinoma formation.Exp Cell Res. 2001; 264: 169-184Crossref PubMed Scopus (444) Google Scholar Whereas myofibroblasts are only transiently present in normal wound healing, continuous conversion of fibroblasts into myofibroblasts followed by myofibroblast proliferation are chronic processes in numerous fibrotic lesions including the desmoplastic response to invading breast carcinoma.4Sappino A-P Skalli O Jackson B Schürch W Gabbiani G Smooth-muscle differentiation in stromal cells of malignant and non-malignant breast tissues.Int J Cancer. 1988; 41: 707-712Crossref PubMed Scopus (269) Google Scholar, 5Rønnov-Jessen L van Deurs B Nielsen M Petersen OW Identification, paracrine generation, and possible function of human breast carcinoma myofibroblasts in culture.In Vitro Cell Dev Biol. 1992; 28A: 273-283Crossref PubMed Scopus (59) Google Scholar, 6Rønnov-Jessen L Petersen OW Koteliansky VE Bissell MJ The origin of the myofibroblasts in breast cancer: recapitulation of tumor environment in culture unravels diversity and implicates converted fibroblasts and recruited smooth muscle cells.J Clin Invest. 1995; 95: 859-873Crossref PubMed Scopus (369) Google Scholar We have previously demonstrated that expression of α-sm actin in breast myofibroblasts is triggered by transforming growth factor (TGF)-β1,7Rønnov-Jessen L Petersen OW Induction of α-smooth muscle actin by transforming growth factor-β1 in quiescent human breast gland fibroblasts: implications for myofibroblast generation in breast neoplasia.Lab Invest. 1993; 68: 696-707PubMed Google Scholar and TGF-β1 is now considered as a key molecule and a master switch for the general fibrotic program.8Reisdorf P Lawrence DA Sivan V Klising E Martin MT Alteration of transforming growth factor-β1 response involves down-regulation of smad3 signaling in myofibroblasts from skin fibrosis.Am J Pathol. 2001; 159: 263-272Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar Beyond the level of cytoskeletal modulation, little is known about which genes are regulated during the induction of myofibroblast differentiation. The aim of the present study was to identify such genes. Using fibroblasts from normal primary breast biopsies isolated under chemically defined conditions, which support the in situ G0 phenotype, differential display-reverse transcription PCR (DD-RT-PCR) was used to unravel transcriptional changes after TGF-β1 stimulation. Our data indicate that independently of cell cycle, TGF-β1 regulates transcription factors, cytoskeletal proteins, extracellular matrix molecules, cytokines and receptors, and transport proteins, including a member of the chloride intracellular channel (CLIC) gene family, CLIC4. The human genes of the CLIC protein family so far includes five members: CLIC1/NCC27, CLIC2/XAP121, CLIC3, CLIC4, and CLIC5,9Valenzuela SM Martin DK Por SB Robbins JM Warton K Bootcov MR Schofield PR Campbell TJ Breit SN Molecular cloning and expression of a chloride ion channel of cell nuclei.J Biol Chem. 1997; 272: 12575-12582Crossref PubMed Scopus (171) Google Scholar, 10Heiss NS Poustka A Genomic structure of a novel chloride channel gene, CLIC2, in Xq28.Genomics. 1997; 45: 224-228Crossref PubMed Scopus (66) Google Scholar, 11Qian Z Okuhara D Abe MK Rosner MR Molecular cloning and characterization of a mitogen-activated protein kinase-associated intracellular chloride channel.J Biol Chem. 1999; 274: 1621-1627Crossref PubMed Scopus (104) Google Scholar, 12Chuang J-Z Milner TA Zhu M Sung C-H A 29 kDa intracellular chloride channel p64H1 is associated with large dense-core vesicles in rat hippocampal neurons.J Neurosci. 1999; 19: 2919-2928Crossref PubMed Google Scholar, 13Edwards JC A novel p64-related CI-channel: subcellular distribution and nephron segment-specific expression.Am J Physiol. 1999; 276: F398-F407PubMed Google Scholar, 14Berryman M Bretscher A Identification of a novel member of the chloride intracellular channel gene family (CLIC5) that associates with the actin cytoskeleton of placental microvilli.Mol Biol Cell. 2000; 11: 1509-1521Crossref PubMed Scopus (130) Google Scholar whose expression have been described in various tissues. It has been a matter of debate if the proteins are subunits of a chloride channel complex rather than channels themselves.12Chuang J-Z Milner TA Zhu M Sung C-H A 29 kDa intracellular chloride channel p64H1 is associated with large dense-core vesicles in rat hippocampal neurons.J Neurosci. 1999; 19: 2919-2928Crossref PubMed Google Scholar It has, however, recently been demonstrated that members of the CLIC gene family indeed function as chloride transporters15Tulk BM Schlesinger PH Kapadia SA Edwards JC CLIC-1 functions as a chloride channel when expressed and purified from bacteria.J Biol Chem. 2000; 275: 26986-26993Abstract Full Text Full Text PDF PubMed Google Scholar, 16Edwards JC Tulk BM Kapadia SA Purified recombinant CLIC4 functions as a unique chloride-selective channel when reconstituted in phospholipid vesicles.J Am Soc Nephrol. 2001; 12 (Abstract): 29APubMed Google Scholar but the functional significance of CLIC expression per se has hitherto not been addressed. In this work, we show that a possible function of CLIC4 in breast myofibroblasts is to retard cell motility. Normal breast biopsies (n = 3) were cut and rotated for 24 hours in serum-free medium, Dulbecco's modified Eagle's medium–Ham's F12 (DME-F12) supplemented with 2 mmol/L glutamine (Sigma-Aldrich, Vallensbæk Strand, Denmark) and 50 μg gentamicin/ml (Garamycin, Schering, Kenilworth, NJ) and 900 IU collagenase/ml (CLS III, Worthington Biochemical Corporation, purchased from Medinova, Hellerup, Denmark). The fibroblasts were isolated by differential centrifugation of the collagenase digest and plated in DME-F12 in Primaria T-25 flasks (Falcon 3813, Becton Dickinson, Albertslund, Denmark) as previously described.7Rønnov-Jessen L Petersen OW Induction of α-smooth muscle actin by transforming growth factor-β1 in quiescent human breast gland fibroblasts: implications for myofibroblast generation in breast neoplasia.Lab Invest. 1993; 68: 696-707PubMed Google Scholar Within the first week of cultivation, the cultures were stimulated with 100 pg of TGF-β1/ml (T-1654, Sigma-Aldrich) or vehicle for 6 days7Rønnov-Jessen L Petersen OW Induction of α-smooth muscle actin by transforming growth factor-β1 in quiescent human breast gland fibroblasts: implications for myofibroblast generation in breast neoplasia.Lab Invest. 1993; 68: 696-707PubMed Google Scholar before RNA extraction. RNA was extracted with TRIZOL Reagent (Gibco BRL, Life Technologies, Tåstrup, Denmark) according to the manufacturer's instructions. The yield was 7 to 18 μg of total RNA per subconfluent T-25 flask. Before RT-PCR and DD, total RNA samples were treated with DNase I (18068–015, Gibco BRL) to remove any possible DNA contamination. DD-RT-PCR was performed using the HIEROGLYPH mRNA profile kit (Genomyx Corporation, Foster City, CA) which includes 12 oligo(dT) anchored T7 3′ primers (5′-ACGACTCACTATAGGGCTT-TTTTTTTTTTXX-3′) and 20 arbitrary M13r 5′ primers (5′-ACAATTTCACACAGGA(10X)-3′) which in combination cover up to 95% of the entire mRNA pool. For reverse transcription, 2 μl of total RNA (0.1 μg/μl) was mixed with 2 μl of anchored primer (2 μmol/L), and incubated at 65°C for 5 minutes in a thermal cycler with a heated lid (PTC−100, MJ Research), and cooled on ice. 16 μl of a core mix containing a final concentration of 1X SuperScript II RT buffer (18064–14, Gibco BRL), 25 μmol/L dNTP mix (Boehringer Mannheim purchased from Ercopharm Roche, Hvidovre, Denmark), 10 mmol/L DTT (Gibco BRL), 1 unit/μl RNasin (N2511, Promega, purchased from Bie & Berntsen, Rødovre, Denmark) and 2 units/μl SuperScript II RT enzyme (Gibco BRL) was added per tube, and RT was run in the thermal cycler at 25°C for 10 minutes, 42°C for 60 minutes, 70°C for 15 minutes, followed by hold at 4°C. In each experiment two control samples without RT enzyme were included. The following DD-PCR was carried out in duplicate. For each sample, 2 μl of the arbitrary primer (2 μmol/L) was mixed with 2 μl RT mix, and a PCR core mix was prepared for each anchored primer containing a final concentration of 1X PCR buffer (15 mmol/L MgCl2), 20 μmol/L dNTP mix, 0.2 μmol/L anchored primer, 0.05 unit/μl Tag DNA polymerase (Boehringer Mannheim), and 0.125 μCi/μl [α-33P]dATP (AH9904, Amersham Pharmacia Biotech, Hørsholm, Denmark). 16 μl PCR core mix was added per tube, and DD-PCR was performed at 95°C for 2 minutes, 4 cycles at 92°C for 15 seconds, 46°C for 30 seconds, 72°C for 2 minutes, 25 cycles at 92°C for 15 seconds, 60°C for 30 seconds, 72°C for 2 minutes, followed by 7 minutes at 72°C and hold at 4°C. Samples were mixed with Stop Solution (US70724, USB Corporation, purchased from Amersham), heat denatured and loaded on a 6% denaturing polyacrylamide gel (HR-1000, Genomyx), and run in a GenomyxLR programmable DNA sequencer apparatus (Genomyx) at 40°C, 800 V, 100 W for 16 hours. After washing and drying, the gel was exposed overnight to a Kodak Biomax MR film (Kodak, Glostrup, Denmark). Differentially expressed bands were cut out, reamplified with the Expand High Fidelity PCR System (Boehringer Mannheim) and purified with QIAquick Gel Extraction Kit (Struers KEBO Lab, Albertslund, Denmark) before automatic sequencing in an ABI PRISM 310 Genetic Analyzer (Applied Biosystems, Nærum, Denmark) using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit. The cDNA fragments were sequenced with M13 (−48) 24-mer reverse sequencing primer resulting in sequence information corresponding to the 3′ end of the mRNA. Nucleotide sequences were used to search the National Center for Biotechnology Information database with the use of the BLAST program.17Altschul SF Madden TL Schäffer AA Zhang J Zhang Z Miller W Lipman DJ Gapped BLAST and psi-BLAST: a new generation of protein database search programs.Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (59448) Google Scholar Multiple sequence alignment was performed with the Clustal W multiple alignment program (v. 1.7) and shaded with Boxshade 3.2.1. The sequences derived from the selected DD bands were used to design specific 5′ primers of 20–23 bases for use with the appropriate 3′-anchor primers allowing PCR-reamplification of homogeneous gene tags for the verification of expression patterns by hybridization analysis.18Martin KJ Kwan C-P O'Hare MJ Pardee AB Sager R Identification and verification of differential display cDNAs using gene-specific primers and hybridization arrays.BioTechniques. 1998; 24: 1018-1026PubMed Google Scholar Bands, which were not differentially expressed, and subsequently identified as KIAA1007 protein mRNA, were treated as described above and included as a control. After PCR, the products were run on an agarose gel, purified with QIAquick Gel Extraction Kit (Qiagen, Struers KEBO Lab) and spotted onto nylon membranes (Zeta-Probe GT, BioRad Laboratories, Copenhagen, Denmark) in duplicate by using a 96-well slot blot manifold (Bio-Dot, BioRad Laboratories). Following denaturation, each gene tag was applied in a dilution series of three (1, 1/5, 1/25); the starting amount for each tag was determined empirically. Five μg total RNA from activated and non-activated fibroblasts were used as template for the generation of 32P-labeled cDNA. Reverse transcription was performed with Superscript Preamplification System (Gibco BRL) using oligo(dT) primers and dNTP(÷C) mix, in the presence of 50 μCi of α[32P]dCTP (NEN, Dupharma, Kastrup, Denmark). Unincorporated nucleotides were removed with QIAquick Nucleotide Removal Kit (Qiagen, Struers Kebo Lab) Ten million cpm of each labeled cDNA preparation was hybridized to the duplicate membranes in 10 ml of hybridization solution (50% formamide, 5X SSPE, 2X Denhardt's solution, 0.1% SDS) overnight at 42°C. After washing (once in 1X SSC/0.1% SDS for 30 minutes at room temperature, and three times in 0.2X SSC/0.1% SDS for 30 minutes at 65°C), the membranes were exposed to x-ray film (BioMax MS & TranScreen HE, Kodak) for 1 to 3 days. The developed films were scanned on a SHARP JX-330/FSU and the signal intensities were measured using Gel-Pro Analyzer 3.0 (Media Cybernetics, Silver Spring, MD). Two μg of total RNA from fibroblasts with or without serum or TGF-β1 stimulation were DNase treated (DNase I Amp Grade, Gibco BRL) and used as template for first strand synthesis with oligo(dT) primers (SuperScript Preamplification System, Gibco BRL) in a 30 μl volume. A volume of 1 μl from this cDNA served as template for the subsequent PCR amplifications, using primers specific for CLIC1, CLIC2, CLIC3, CLIC4, CLIC5, KIAA1007 protein mRNA, and GAPDH (Table 1), or primers specific for metallothionein (FW: GTGGGCTGTGCCAAGTGT and RV: GGTCACGGTCAGGGTTGT) and WBSCR9 (FW: TGGACGTGCAAGAGTACTGG and RV: TCCCACAGCAT-ATTTGGTCA) using 56°C as annealing temperature (TA) and 28 and 35 PCR cycles, respectively.Table 1Primers Specific for CLIC and Control Genes Used for RT-PCRPrimerSequenceTACyclesAmplicon sizeCLIC1 FWACACAGCTGGGCTGGACATA54°38190CLIC1 RVAACTTCCTCTGAGAGACACCTTCACLIC2 FWCCTCACCTGAGTCCCAAGTACAA59°29374CLIC2 RVTCTTCACGGGCATAGGCATTCLIC3 FWGGACGGCGACAGGCTCAC59°29186CLIC3 RVAGGATCTCGGCGCTGTGCCLIC4 FWAGCAGAAGCAGCAGCAG56°27987CLIC4 RVTATACCTTGTCTATCCTTGATCCTACLIC5 FWGGAGATTGACGCCAACACTT54°33199CLIC5 RVACGGGCATAGGCGTTCTTKIAA1007 FWGCCACATCCTTGGGGTCTTC58°26293KIAA1007 RVCCAAAGGGCTGGGAAAGTCAGAPDH FWGAAGGTGAAGGTCGGAGT54°25226GAPDH RVGAAGATGGTGATGGGATTTC Open table in a new tab For each reaction amplification was performed with denaturation at 94°C for 1 minute, annealing at the specified TA (Table 1) for 1 minute, and extension at 72°C for 1 minute, followed by a final extension step at 72°C for 7 minutes. Each reaction was performed in a 50 μl volume using Expand High Fidelity PCR System (Roche Molecular Biochemicals) with 1.5 mmol/L MgCl2, 200 μmol/L dNTP, and 200 nmol/L of forward and reverse primers. For RT-PCR on total RNA from CLIC4-transfected MEF/3T3 fibroblasts (see below), mouse-specific primers (α-sm actin, FW: ACTGGGACGACATGGAAAAG and RV: AGAGGCATAGAGGGACAGCA, TA: 56°C, 26 cycles; GAPDH, FW: CACTCTTCCACCTTCGATGC and RV: CGAGTTGGGATAGGGCCTC, TA: 57°C, 25 cycles) were used. Control amplification was performed on RNA samples not subjected to reverse transcription to verify that no contaminating genomic DNA was present (data not shown). The PCR products were analyzed by electrophoresis in 1.5% agarose gels. The coding region of CLIC4 was inserted into pRevTRE (Clontech, BD Biosciences, Brøndby, Denmark) and stably transfected into MEF/3T3 Tet-Off (Clontech) using the RetroMax retroviral transfection assay as described by the manufacturer (Imgenex, San Diego, CA). MEF/3T3 Tet-Off cells were cultured in DMEM 11885 containing 10% Tet System Approved Fetal Bovine Serum (Clontech) supplemented with 2 mmol/L l-glutamine and 100 μg/ml G418 (Gibco BRL, purchased from Invitrogen, Tåstrup, Denmark). Clones containing the pRevTRE-CLIC4 vector were selected by adding 400 μg/ml hygromycin B (Gibco BRL). The resulting pRevTRE-CLIC4 containing cell line was cultured using the culture medium described above, with the addition of 10 ng/ml of the tetracycline derivative, doxycycline (Sigma-Aldrich, purchased from Gerner Jensen, Charlottenlund, Denmark), and CLIC4 expression was induced by removing doxycycline from the culture medium. Cryosections (8 μm) of normal or neoplastic breast (diagnosed and kindly provided by Dr. Fritz Rank, Rigshospitalet) were fixed in methanol for 5 minutes at − 20°C, blocked in 10% normal goat serum in phosphate-buffered saline, and incubated in the primary sequence for 2 hours with affinity-purified antiserum AP1058 raised against recombinant CLIC4/huH1(1:5;13Edwards JC A novel p64-related CI-channel: subcellular distribution and nephron segment-specific expression.Am J Physiol. 1999; 276: F398-F407PubMed Google Scholar) washed in 10% normal goat serum, and incubated for 30 minutes in the second sequence with FITC-conjugated goat anti-rabbit IgG (1:25, 4050–02, Southern Biotechnology Associates, Birmingham, AL). For double staining fluorescence of CLIC4 and α-sm actin, an affinity-purified antiserum raised against purified GST-p64H1 (1:100, CUMC29, kindly provided by Dr. C-H Sung, Weill Medical College of Cornell University, New York, NY12Chuang J-Z Milner TA Zhu M Sung C-H A 29 kDa intracellular chloride channel p64H1 is associated with large dense-core vesicles in rat hippocampal neurons.J Neurosci. 1999; 19: 2919-2928Crossref PubMed Google Scholar) and monoclonal anti-α-sm actin (clone 1A4, A-2547, 1:1000; Sigma-Aldrich) were used in the primary sequence followed by FITC-conjugated goat anti-rabbit IgG (1:25, 4050–02) and Texas Red-labeled goat anti-mouse IgG2a (1:50, 1080–07, Southern Biotechnology Associates) in the second sequence. Preimmune serum was included as a control for CUMC29. After rinsing, the sections were mounted in Fluoromount-G (Southern Biotechnology Associates) containing 2.5 mg/ml freshly prepared n-propyl gallate (Sigma-Aldrich). Images were obtained using a Zeiss LSM 510 laser scanning microscope (Carl Zeiss, Jena GmbH). CLIC4-MEF/3T3 fibroblasts were fixed in methanol, incubated with AP1058 (1:5) or anti-α-smooth muscle actin (1:1000; 1A4, Sigma-Aldrich), and peroxidase immunocytochemistry was performed essentially as previously described19Petersen OW Høyer PE van Deurs B Frequency and distribution of estrogen receptor-positive cells in normal, nonlactating human breast tissue.Cancer Res. 1987; 47: 5748-5751PubMed Google Scholar with the inclusion of mouse anti-rabbit antibodies (M737, Dako, Glostrup, Denmark) between the primary and secondary antibody for AP1058. Affinity-purified antiserum AP95 raised against a β-galactosidase p64 fusion protein, which recognizes native bovine p64, but not p64 homologues in human or mouse tissue13Edwards JC A novel p64-related CI-channel: subcellular distribution and nephron segment-specific expression.Am J Physiol. 1999; 276: F398-F407PubMed Google Scholar, 20Landry DW Akabas MH Redhead CR Edelman A Cragoe Jr, EJ Al-Awqati Q Purification and reconstitution of chloride channels from kidney and trachea.Science. 1989; 244: 1469-1472Crossref PubMed Scopus (134) Google Scholar was included as a control. Migratory activity was assessed using 8 μm pore size polyethylene terephthalate (PET) filter inserts in a 12-well companion plate (catalog nos. 3182 and 3503, Falcon, Becton Dickinson). 1.5 ml of culture medium with or without doxycycline was added to the wells, the filter inserts were placed in the wells and the culture plate was placed in the incubator, while the cells were prepared. Subconfluent cultures of CLIC4-MEF/3T3 or MEF/3T3 Tet-Off fibroblasts (control without CLIC4 insert) with or without 3 days of exposure to 10 ng/ml of doxycycline were trypsinized and counted. 2 × 105 were pelleted by centrifugation (125 × g for 5 minutes), resuspended in 0.5 ml of medium with or without doxycycline, and plated on the filters. After 6 hours of incubation, the cells on the upper side of the filter were removed with a cotton swab, and the filter inserts were transferred to a well containing a cell stain solution (part no. 20294 of catalog no. ECM502, Chemicon International, Inc. purchased from AHdiagnostics, Aarhus, Denmark), stained for 20 minutes, rinsed in H2O, and dried. The average number of migrated cells/field was counted using an ocular grid at 20× magnification. The relative percentage of migrated cells is given as the average of four sets of experiments ± SEM. To study migration at the individual cell level, time lapse video microscopy was used as previously described21Rønnov-Jessen L Petersen OW A function for filamentous α-smooth muscle actin: retardation of motility in fibroblasts.J Cell Biol. 1996; 134: 67-80Crossref PubMed Scopus (191) Google Scholar in three sets of paired measurements ± SD. Significance was tested by Student's t-test. To identify TGF-β1-specific changes in gene expression during conversion of fibroblasts to myofibroblasts, total RNA was extracted from three sets of primary breast fibroblasts, which were either untreated or stimulated for 6 days with TGF-β1.7Rønnov-Jessen L Petersen OW Induction of α-smooth muscle actin by transforming growth factor-β1 in quiescent human breast gland fibroblasts: implications for myofibroblast generation in breast neoplasia.Lab Invest. 1993; 68: 696-707PubMed Google Scholar DD-RT-PCR was performed using the HIEROGLYPH mRNA profile kit (Figure 1). Ninety-five differentially expressed transcripts were isolated, reamplified, purified and automatically sequenced. Seventy-seven successfully sequenced nucleotide sequences were used to search the NCBI BLASTN database. Thirty-five of the transcripts represented known genes (Table 2), and 42 represented unknown genes of which 17 resembled PAC/BAC clones (not shown). The major part of the known genes (11/35) represented enzymes, of which nine were up-regulated in myofibroblasts. Three of the up-regulated messages were identified as transport molecules, including a member of the CLIC family of chloride channel proteins. Twenty-eight of the 95 transcripts that were differentially expressed in fibroblasts from at least two of the three biopsies were selected for further verification by hybridization array using gene-specific primers.18Martin KJ Kwan C-P O'Hare MJ Pardee AB Sager R Identification and verification of differential display cDNAs using gene-specific primers and hybridization arrays.BioTechniques. 1998; 24: 1018-1026PubMed Google Scholar Of these, nine turned out to be truly differentially expressed (Figure 2). Normal breast biopsies are limited in supply and experiments requiring larger quantities of cells are further hampered by the difficulty of expanding the cell population without extensive selection. We and others have previously demonstrated that fetal calf serum and TGF-β1 both readily convert fibroblasts to myofibroblasts.7Rønnov-Jessen L Petersen OW Induction of α-smooth muscle actin by transforming growth factor-β1 in quiescent human breast gland fibroblasts: implications for myofibroblast generation in breast neoplasia.Lab Invest. 1993; 68: 696-707PubMed Google Scholar, 22Desmoulière A Geinoz A Gabbiani F Gabbiani G Transforming growth factor-β1 induces α-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts.J Cell Biol. 1993; 122: 103-111Crossref PubMed Scopus (1860) Google Scholar Therefore, to obtain sufficient RNA for verification in the present study, we routinely used RNA from serum-generated myofibroblasts, which may explain why the expression pattern of metallothionein and WBSCR9 was opposite of that observed in DD of the TGF-β1-generated myofibroblasts. Thus, that TGF-β1 indeed up-regulates metallothionein was further confirmed by RT-PCR (data not shown), and others have shown that >24 hours of exposure of fibroblasts to FCS as used here leads to down-regulation of metallothionein.23Wick M Bürger C Brüsselbach S Lucibello FC Müller R Identification of serum-inducible genes: different patterns of gene regulation during Go to S and G1 to S progression.J Cell Sci. 1994; 107: 227-239Crossref PubMed Google Scholar In contrast, regulation of WBSCR9 by TGF-β1 could not be confirmed by RT-PCR (data not shown). The transcripts showing the highest ratios of differential expression in the hybridization array were the TGF-β3 receptor, down-regulated 24.8-fold, and the CLIC message, up-regulated 16.8-fold (Figure 2). TGF-β3R has been shown by others24Iyer VR Eisen MB Ross DT Schuler G Moore T Lee JCF Trent JM Staudt LM Hudson Jr, J Boguski MS Lashkari D Shalon D Botstein D Brown PO The transcriptional program in the response of human fibroblasts to serum.Science. 1999; 283: 83-87Crossref PubMed Scopus (1718) Google Scholar to be regulated in serum-stimulated fibroblasts. Therefore, the CLIC transcript was chosen for further analysis.Table 2Identified Known Genes Regulated by TGF-β1 in Normal Breast FibroblastsRegulated genesStatus in TGF-β1-activated cellsEnzymes HPK/GCK-like kinase↑ Human 68kD PIP5 KI α1↑ Human Krit 1↑ Lactate dehydrogenase↓ NADH4↑ N-terminal acetyl transferase ard1 subunit↓ PAPS synthetase 2↑ PI kinase↑ Putative helicase↑ SnoN2↑ SOD-1↓Transcription factors Cyclin I↓ EF-1α↑ TIF-1↓Transport proteins Metallothionein↑ High-density lipoprotein-binding protein↑ Putative Cl− channel↑ECM modulators Collagen X↑ Fibronectin↑ Lysyl oxidase↓ TIMP3↑Cytokines and receptors Eotaxin↓ HGF-like activator↑ KGF↓ Lipocortin/annexin↑ TGF-β3R↓Structure/motility proteins Ankyrin-like protein↓ Cornichon-like mRNA↓ Myosin I heavy chain↑ Myosin class I myh-1c↓Others GW128 mRNA↑ TGF-β1-induced mRNA↑ KIAA0551 protein mRNA↑ KIAA1334 protein mRNA↑ WBSCR 9 mRNA↓ Open table in a new tab Figure 2Verification of differential expression by hybridization analysis. Gene tags generated by PCR using gene-specific primers were spotted onto a nylon membrane in a dilution series of 1, 1/5, and 1/25 and hybridized with 32P-labeled cDNA from serum-stimulated fibroblasts (A) or non-activated fibroblasts (B). The ratios of differential expression (Ratio) was determined by measuring the respective signal intensities. A non-differentially expressed transcript, representing KIAA1007 protein, was used as reference (ratio measured: 1.4, set as 1.0, and the other ratios adjusted accordingly).View Large Image Figure ViewerDownload Hi-res image Download (PPT) When searched against the" @default.
• W2061377366 created "2016-06-24" @default.
• W2061377366 creator A5003330445 @default.
• W2061377366 creator A5005494301 @default.
• W2061377366 creator A5025120000 @default.
• W2061377366 creator A5084259371 @default.
• W2061377366 date "2002-08-01" @default.
• W2061377366 modified "2023-10-16" @default.
• W2061377366 title "Differential Expression of a Chloride Intracellular Channel Gene, CLIC4, in Transforming Growth Factor-β1-Mediated Conversion of Fibroblasts to Myofibroblasts" @default.
• W2061377366 cites W1483023618 @default.
• W2061377366 cites W1543593287 @default.
• W2061377366 cites W1580831370 @default.
• W2061377366 cites W1583997555 @default.
• W2061377366 cites W1584610324 @default.
• W2061377366 cites W1775225822 @default.
• W2061377366 cites W1976093993 @default.
• W2061377366 cites W1990448641 @default.
• W2061377366 cites W1995255507 @default.
• W2061377366 cites W1999138366 @default.
• W2061377366 cites W2001100547 @default.
• W2061377366 cites W2017571074 @default.
• W2061377366 cites W2018354560 @default.
• W2061377366 cites W2020371019 @default.
• W2061377366 cites W2037099316 @default.
• W2061377366 cites W2042293477 @default.
• W2061377366 cites W2053770442 @default.
• W2061377366 cites W2058077431 @default.
• W2061377366 cites W2073821224 @default.
• W2061377366 cites W2079593971 @default.
• W2061377366 cites W2080616094 @default.
• W2061377366 cites W2084647191 @default.
• W2061377366 cites W2096280264 @default.
• W2061377366 cites W2100959692 @default.
• W2061377366 cites W2109970232 @default.
• W2061377366 cites W2117733417 @default.
• W2061377366 cites W2141803075 @default.
• W2061377366 cites W2142746235 @default.
• W2061377366 cites W2150624183 @default.
• W2061377366 cites W2158714788 @default.
• W2061377366 cites W2166636567 @default.
• W2061377366 cites W2169240396 @default.
• W2061377366 cites W2182011056 @default.
• W2061377366 cites W2417590172 @default.
• W2061377366 cites W2482381083 @default.
• W2061377366 cites W42236227 @default.
• W2061377366 cites W4232961045 @default.
• W2061377366 cites W4243311809 @default.
• W2061377366 cites W65641291 @default.
• W2061377366 doi "https://doi.org/10.1016/s0002-9440(10)64203-4" @default.
• W2061377366 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1850723" @default.
• W2061377366 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12163372" @default.
• W2061377366 hasPublicationYear "2002" @default.
• W2061377366 type Work @default.
• W2061377366 sameAs 2061377366 @default.
• W2061377366 citedByCount "102" @default.
• W2061377366 countsByYear W20613773662012 @default.
• W2061377366 countsByYear W20613773662013 @default.
• W2061377366 countsByYear W20613773662014 @default.
• W2061377366 countsByYear W20613773662015 @default.
• W2061377366 countsByYear W20613773662016 @default.
• W2061377366 countsByYear W20613773662018 @default.
• W2061377366 countsByYear W20613773662019 @default.
• W2061377366 countsByYear W20613773662020 @default.
• W2061377366 countsByYear W20613773662021 @default.
• W2061377366 countsByYear W20613773662022 @default.
• W2061377366 crossrefType "journal-article" @default.
• W2061377366 hasAuthorship W2061377366A5003330445 @default.
• W2061377366 hasAuthorship W2061377366A5005494301 @default.
• W2061377366 hasAuthorship W2061377366A5025120000 @default.
• W2061377366 hasAuthorship W2061377366A5084259371 @default.
• W2061377366 hasBestOaLocation W20613773661 @default.
• W2061377366 hasConcept C104317684 @default.
• W2061377366 hasConcept C118131993 @default.
• W2061377366 hasConcept C142724271 @default.
• W2061377366 hasConcept C145822097 @default.
• W2061377366 hasConcept C150194340 @default.
• W2061377366 hasConcept C170493617 @default.
• W2061377366 hasConcept C207865475 @default.
• W2061377366 hasConcept C2775960820 @default.
• W2061377366 hasConcept C2778229498 @default.
• W2061377366 hasConcept C2780559512 @default.
• W2061377366 hasConcept C54355233 @default.
• W2061377366 hasConcept C71924100 @default.
• W2061377366 hasConcept C79879829 @default.
• W2061377366 hasConcept C86803240 @default.
• W2061377366 hasConcept C95444343 @default.
• W2061377366 hasConceptScore W2061377366C104317684 @default.
• W2061377366 hasConceptScore W2061377366C118131993 @default.
• W2061377366 hasConceptScore W2061377366C142724271 @default.
• W2061377366 hasConceptScore W2061377366C145822097 @default.
• W2061377366 hasConceptScore W2061377366C150194340 @default.
• W2061377366 hasConceptScore W2061377366C170493617 @default.
• W2061377366 hasConceptScore W2061377366C207865475 @default.
• W2061377366 hasConceptScore W2061377366C2775960820 @default.
• W2061377366 hasConceptScore W2061377366C2778229498 @default.
• W2061377366 hasConceptScore W2061377366C2780559512 @default.
• W2061377366 hasConceptScore W2061377366C54355233 @default.
• W2061377366 hasConceptScore W2061377366C71924100 @default.

• next