FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2061935675> ?p ?o ?g. }

• W2061935675 endingPage "47310" @default.
• W2061935675 startingPage "47298" @default.
• W2061935675 abstract "The actions of the active metabolite of 1,25-(OH)2D3 (1,25-D) are mediated primarily by the vitamin D receptor (VDR), a member of the nuclear receptor family of ligand-activated transcription factors. Although their ligands cause transcriptional activation, many of the ligands also rapidly activate cellular signaling pathways through mechanisms that have not been fully elucidated. We find that 1,25-D causes a rapid, but sustained activation of ERK (extracellular signal-regulated kinase) in bone cell lines. However, the effect of ERK activation on VDR transcriptional activity was cell line-specific. Inhibition of ERK activation by the MEK inhibitor, U0126, stimulated VDR activity in MC3T3-E1 cells, but inhibited the activity in MG-63 cells as well as in HeLa cells. VDR is not a known target of ERK. We found that the ERK target responsible for reduced VDR activity in MC3T3-E1 cells is RXRα. MC3T3-E1 cells express lower levels of RXRβ and RXRγ than either HeLa or MG-63 cells. Although overexpression of RXRα in MC3T3-E1 cells increased VDR activity, U0126 further enhanced the activity. In contrast, overexpression of RXRγ stimulated VDR activity but abrogated the stimulation by U0126. Thus, although 1,25-D treatment activates ERK in many cell types, subsequently inducing changes independent of VDR, the effects of treatment with 1,25-D on the transcriptional activity of VDR are RXR isoform-specific. In cells in which RXRα is the VDR partner, the transcriptional activation of VDR by 1,25-D is attenuated by the concomitant activation of ERK. In cells utilizing RXRγ, ERK activation enhances VDR transcriptional activity. The actions of the active metabolite of 1,25-(OH)2D3 (1,25-D) are mediated primarily by the vitamin D receptor (VDR), a member of the nuclear receptor family of ligand-activated transcription factors. Although their ligands cause transcriptional activation, many of the ligands also rapidly activate cellular signaling pathways through mechanisms that have not been fully elucidated. We find that 1,25-D causes a rapid, but sustained activation of ERK (extracellular signal-regulated kinase) in bone cell lines. However, the effect of ERK activation on VDR transcriptional activity was cell line-specific. Inhibition of ERK activation by the MEK inhibitor, U0126, stimulated VDR activity in MC3T3-E1 cells, but inhibited the activity in MG-63 cells as well as in HeLa cells. VDR is not a known target of ERK. We found that the ERK target responsible for reduced VDR activity in MC3T3-E1 cells is RXRα. MC3T3-E1 cells express lower levels of RXRβ and RXRγ than either HeLa or MG-63 cells. Although overexpression of RXRα in MC3T3-E1 cells increased VDR activity, U0126 further enhanced the activity. In contrast, overexpression of RXRγ stimulated VDR activity but abrogated the stimulation by U0126. Thus, although 1,25-D treatment activates ERK in many cell types, subsequently inducing changes independent of VDR, the effects of treatment with 1,25-D on the transcriptional activity of VDR are RXR isoform-specific. In cells in which RXRα is the VDR partner, the transcriptional activation of VDR by 1,25-D is attenuated by the concomitant activation of ERK. In cells utilizing RXRγ, ERK activation enhances VDR transcriptional activity. The active form of vitamin D, 1,25-(OH)2D3 (1,25-D) 1The abbreviations used are: 1,25-D, 1,25(OH)2D3; VDR, vitamin D receptor; RXR, retinoid X receptor; ERK, extracellular signal-regulated kinase; ALP, alkaline phosphatase; MEK, mitogen-activated protein kinase kinase; SRC, steroid receptor coactivator; DRIP, vitamin D receptor-interacting protein; TR, thyroid receptor; PR, progesterone receptor; BSA, bovine serum albumin; EMSA, electrophoretic mobility shift assay; PIPES, 1,4-piperazinediethanesulfonic acid; RT, reverse transcription; GRE, glucocorticoid response element; PBS, phosphate-buffered saline; CAT, chloramphenicol acetyltransferase., regulates calcium homeostasis (1Brown S.A. Ontjes D.A. Lester G.E. Lark R.K. Hensler M.B. Blackwood A.D. Caminiti M.J. Backlund D.C. Aris R.M. Osteoporos. Int. 2003; 14: 442-449Crossref PubMed Scopus (34) Google Scholar, 2Fukugawa M. Kurokawa K. Nephron. 2002; 92: 41-45Crossref PubMed Scopus (35) Google Scholar, 3Tryfonidou M.A. Stevenhagen J.J. van den Bemd G.J. Oosterlaken-Dijksterhuis M.A. DeLuca H.F. Mol J.A. van den Brom W.E. van Leeuwer J.P. Hazewinkel H.A. J. Nutr. 2002; 132: 2644-2650Crossref PubMed Scopus (25) Google Scholar), bone remodeling (4DeLuca H.F. Osteoporos. 1997; 7: S24-S29Crossref PubMed Google Scholar, 5Kabasawa Y. Asahina I. Gunji A. Omura K. DNA Cell Biol. 2003; 22: 541-546Crossref PubMed Scopus (13) Google Scholar), proliferation (6Blutt S.E. Allegretto E.A. Pike J.W. Weigel N.L. Endocrinology. 1997; 138: 1491-1497Crossref PubMed Scopus (191) Google Scholar, 7Blutt S.E. Polek T.C. Stewart L.V. Kattan M.W. Weigel N.L. Cancer Res. 2000; 60: 779-782PubMed Google Scholar), differentiation (8Danilenko M. Wang Q. Wang X. Levy J. Sharoni Y. Studzinski G.P. Cancer Res. 2003; 63: 1325-1332PubMed Google Scholar), and other cellular and physiological processes. Many of the actions of 1,25-D are mediated by an intracellular receptor, the vitamin D receptor (VDR), a member of the steroid/thyroid receptor superfamily of ligand-regulated transcription factors (9Ozono K. Sone T. Pike J.W. J. Bone Miner Res. 1991; 6: 1021-1027Crossref PubMed Scopus (102) Google Scholar, 10Brown A.J. Dusso A. Slatopolsky E. Am. J. Physiol. 1999; 277: F157-F175Crossref PubMed Google Scholar). The activity of VDR is dependent not only on the concentration of receptor and hormone but also on its heterodimer partner, retinoid X receptor (RXR), and the coactivator proteins that bind to the VDR and facilitate transcription of target genes (11Christakos S. Dhawan P. Liu Y. Peng X. Porta A. J. Cell. Biochem. 2003; 88: 695-705Crossref PubMed Scopus (271) Google Scholar). In addition to its actions as a modulator of transcription through activation of the VDR, 1,25-D can rapidly activate cell signaling cascades independent of a requirement for transcription (12de Boland A.R. Boland R.L. Cell Signal. 1994; 6: 717-724Crossref PubMed Scopus (116) Google Scholar, 13Zanello L.P. Norman A.W. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 1589-1594Crossref PubMed Scopus (137) Google Scholar, 14Erben R.G. Soegiarto D.W. Weber K. Zeitz U. Lieberherr M. Gniadecki R. Moller G. Adamski J. Balling R. Mol. Endocrinol. 2002; 16: 1524-1537Crossref PubMed Scopus (208) Google Scholar). The means by which 1,25-D induces these changes has not been fully elucidated. Rapid activation of extracellular signal-regulated kinases, ERK1/ERK2 in NB4 promyelocytic leukemia cells can be induced not only by 1,25-D, but also by analogs that are unable to activate VDR, suggesting the possibility of a separate receptor (15Song X. Bishop J.E. Okamura W.H. Norman A.W. Endocrinology. 1998; 139: 457-465Crossref PubMed Scopus (113) Google Scholar). Antibodies to a membrane protein identified by Nemere et al. (16Nemere I. Schwartz Z. Pedrozo H. Sylvia V.L. Dean D.D. Boyan B.D. J. Bone Miner Res. 1998; 13: 1353-1359Crossref PubMed Scopus (192) Google Scholar) block the ability of 1,25-D to induce rapid calcium uptake and activation of PKC in cartilage cells. VDR-/- osteoblasts take up calcium and activate PKC similar to the wild-type osteoblasts, implicating proteins other than VDR in these actions (17Wali R.K. Kong J. Sitrin M.D. Bissonnette M. Li Y.C. J. Cell. Biochem. 2003; 88: 794-801Crossref PubMed Scopus (74) Google Scholar). In contrast, Gniadecki (18Gniadecki R. J. Investig. Dermatol. 1996; 106: 1212-1217Abstract Full Text PDF PubMed Scopus (93) Google Scholar) has described activation of ERK through 1,25-D-induced activation of Raf as a result of interactions between VDR and the adaptor protein Shc. VDR-null osteoblasts do not exhibit ion channel responses in response to 1,25-D (13Zanello L.P. Norman A.W. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 1589-1594Crossref PubMed Scopus (137) Google Scholar) and Erben et al. (14Erben R.G. Soegiarto D.W. Weber K. Zeitz U. Lieberherr M. Gniadecki R. Moller G. Adamski J. Balling R. Mol. Endocrinol. 2002; 16: 1524-1537Crossref PubMed Scopus (208) Google Scholar) have reported that deletion of the VDR DNA binding domain also eliminates non-genomic responses. Thus some of the rapid actions of 1,25-D may be dependent upon VDR, whereas others are not. Nuclear receptor family members including VDR and RXR as well as many of their coactivators, are phosphoproteins whose activities are also regulated by cell signaling pathways (19Gianni M. Tarrade A. Nigro E.A. Garattini E. Rochette-Egly C. J. Biol. Chem. 2003; 278: 34458-34466Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 20Bastien J. Adam-Stitah S. Plassat J.L. Chambon P. Rochette-Egly C. J. Biol. Chem. 2002; 277: 28683-28689Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 21Adachi S. Okuno M. Matsushima-Nishiwaki R. Takano Y. Kojima S. Friedman S.L. Moriwaki H. Okano Y. Hepatology. 2002; 35: 332-340Crossref PubMed Scopus (64) Google Scholar, 22Weigel N.L. Biochem. J. 1996; 319: 657-667Crossref PubMed Scopus (321) Google Scholar, 23Jones B.B. Jurutka P.W. Haussler C.A. Haussler M.R. Whitfield G.K. Mol. Endocrinol. 1991; 5: 1137-1146Crossref PubMed Scopus (29) Google Scholar, 24Jurutka P.W. Terpening C.M. Haussler M.R. Biochemistry. 1993; 32: 8184-8192Crossref PubMed Scopus (33) Google Scholar, 25Jurutka P.W. Hsieh J.-C. MacDonald P.N. Terpening C.M. Haussler C.A. Haussler M.R. Whitfield G.K. J. Biol. Chem. 1993; 268: 6791-6799Abstract Full Text PDF PubMed Google Scholar, 26Rowan B.G. Garrison N. Weigel N.L. O'Malley B.W. Mol. Cell. Biol. 2000; 20: 8720-8730Crossref PubMed Scopus (203) Google Scholar, 27Lee H.Y. Suh Y.A. Robinson M.J. Clifford J.L. Hong W.K. Woodgett J.R. Cobb M.H. Mangelsdorf D.J. Kurie J.M. J. Biol. Chem. 2000; 275: 32193-32199Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). Thus 1,25-D can modulate VDR activity both through direct binding to VDR as well as by altering the kinase activities within the cell (9Ozono K. Sone T. Pike J.W. J. Bone Miner Res. 1991; 6: 1021-1027Crossref PubMed Scopus (102) Google Scholar, 11Christakos S. Dhawan P. Liu Y. Peng X. Porta A. J. Cell. Biochem. 2003; 88: 695-705Crossref PubMed Scopus (271) Google Scholar, 12de Boland A.R. Boland R.L. Cell Signal. 1994; 6: 717-724Crossref PubMed Scopus (116) Google Scholar, 28Chae H.J. Jeong B.J. Ha M.S. Lee J.K. Byun J.O. Jung W.Y. Yun Y.G. Lee D.G. Oh S.H. Chae S.W. Kwak Y.G. Kim H.H. Lee Z.H. Kim H.R. Immunopharmacol. Immunotoxicol. 2002; 24: 31-41Crossref PubMed Scopus (27) Google Scholar). Although VDR has not been reported to be a substrate for ERK, RXRα (one of the three RXR isoforms) (29Solomon C. White J.H. Kremer R. J. Clin. Investig. 1999; 103: 1729-1735Crossref PubMed Scopus (124) Google Scholar) is phosphorylated by ERK, as are some of the VDR coactivators including SRC-1 (30Rowan B.G. Weigel N.L. O'Malley B.W. J. Biol. Chem. 2000; 275: 4475-4483Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar). To better understand the functional interactions between VDR and the ERK signaling pathway, we sought to determine whether 1,25-D activates ERK in the osteoblastic cell lines, MG-63 and MC3T3-E1, and to evaluate the effects of ERK on VDR activity. We found that 1,25-D rapidly induced ERK activity and that this activation persisted at 24 h in both cell lines. Surprisingly, the effects of ERK activation on VDR activity in the two cell lines were very different. Overexpression of Raf-1 (an upstream activator of ERK) reduced VDR activity in MC3T3-E1 cells, but stimulated activity in MG-63 cells. Similarly, inhibition of ERK by the MEK inhibitor U0126 stimulated VDR activity in MC3T3-E1 cells. However, it inhibited VDR activity in MG-63 cells as well as in HeLa cells, a cervical carcinoma cell line commonly utilized to study the functions of nuclear receptors. Although coactivators are targets of ERK signaling (30Rowan B.G. Weigel N.L. O'Malley B.W. J. Biol. Chem. 2000; 275: 4475-4483Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar, 31Font de Mora J. Brown M. Mol. Cell. Biol. 2000; 20: 5041-5047Crossref PubMed Scopus (401) Google Scholar), the primary effect of U0126 in MC3T3-E1 cells appears to be enhancement of nuclear localization and DNA binding. An examination of the expression of the RXR isoforms revealed that MC3T3-E1 cells expressed lower levels of RXRβ and RXRγ than did either HeLa or MG-63 cells, suggesting that in MC3T3-E1 cells the VDR may be more dependent upon RXRα, an isoform whose activity is regulated by ERK (29Solomon C. White J.H. Kremer R. J. Clin. Investig. 1999; 103: 1729-1735Crossref PubMed Scopus (124) Google Scholar). Whereas U0126 somewhat increased total VDR expression in both MC3T3-E1 and HeLa cells, nuclear localization and DNA binding of VDR were substantially increased in MC3T3-E1 cells, but were minimally affected in HeLa cells. Although overexpression of RXRα in MC3T3-E1 cells increased VDR activity, U0126 further enhanced the activity. In contrast, overexpression of RXRγ stimulated VDR activity but abrogated the stimulation of activity by U0126. Thus, in cells in which RXRα is the dominant VDR partner, activation of ERK by 1,25-D reduces the activity of VDR, whereas in cells utilizing RXRβ or RXRγ, the activation of ERK enhances the activity of VDR. Materials—All cell culture reagents were obtained from Invitrogen (Carlsbad, CA). The phospho-ERK (p42/44) antibody was obtained from New England Biolabs (Beverly, MA), the actin antibody from Chemicon International (Temecula, CA), RXRα, RXRβ, RXRγ, SRC-1, and DRIP205/TRAP-220 antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA), and the VDR antibody was obtained from Affinity Bioreagents (Golden, CO). 1,25-(OH)2D3 (1,25-D) was obtained from Solvay DuPhar (Weesp, The Netherlands). R5020 (promegestone) was obtained from PerkinElmer Life Sciences. Triiodothyronine (T3) and the alkaline phosphatase (ALP) assay kits were obtained from Sigma. U0126, the MEK-1 and MEK-2 inhibitor, was obtained from Promega Corporation (Madison, WI). All other reagents used were analytical grade. Plasmids—pCR3.1 SRC-1a (26Rowan B.G. Garrison N. Weigel N.L. O'Malley B.W. Mol. Cell. Biol. 2000; 20: 8720-8730Crossref PubMed Scopus (203) Google Scholar), pLEN PRB (32Vegeto E. Shahbaz M.M. Wen D.X. Goldman M.E. O'Malley B.W. McDonnell D.P. Mol. Endocrinol. 1993; 7: 1244-1255Crossref PubMed Scopus (556) Google Scholar), VDRE-tk-LUC (33Narayanan R. Smith C.L. Weigel N.L. Bone. 2002; 31: 381-388Crossref PubMed Scopus (23) Google Scholar), GRE2-E1b-LUC (34Nawaz Z. Lonard D.M. Smith C.L. Lev-Lehman E. Tsai S.Y. Tsai M.-J. O'Malley B.W. Mol. Cell. Biol. 1999; 19: 1182-1189Crossref PubMed Scopus (353) Google Scholar), IR0 TRE-tk-LUC (35Lee J.W. Ryan F. Swaffield J.C. Johnston S.A. Moore D.D. Nature. 1995; 374: 91-94Crossref PubMed Scopus (388) Google Scholar), and VDRE-tk-CAT (33Narayanan R. Smith C.L. Weigel N.L. Bone. 2002; 31: 381-388Crossref PubMed Scopus (23) Google Scholar) were described earlier. The thyroid receptor β (TRβ) expression vector (a gift from Dr. David Lonard, Baylor College of Medicine, Houston, TX) was made by inserting the TRβ cDNA into the EcoRI site in the pCR3.1 vector. The VDR expression plasmid was a gift from Dr. Wesley Pike, University of Wisconsin, Madison, WI (36Sone T. McDonnell D.P. O'Malley B.W. Pike J.W. J. Biol. Chem. 1990; 265: 1997-2003Abstract Full Text PDF Google Scholar). The Raf-1 and empty vector SRα3 plasmids were kind gifts from Dr. Bing Su, University of Texas, M. D. Anderson Cancer Center, Houston, TX. The vitamin D receptor-interacting protein (DRIP205) expression plasmid was a kind gift from Dr. Leonard P. Freedman, Memorial Sloan Kettering Research Center, New York (37Rachez C. Gamble M. Chang C.P. Atkins G.B. Lazar M.A. Freedman L.P. Mol. Cell. Biol. 2000; 20: 2718-2726Crossref PubMed Scopus (182) Google Scholar). RXRα and RXRγ expression plasmids were kind gifts from Dr. David J. Mangelsdorf, University of Texas Southwestern Medical Center, Dallas, TX and Dr. Ronald Evans, Salk Institute, La Jolla, CA (38Janowski B.A. Willy P.J. Devi T.R. Falck J.R. Mangelsdorf D.J. Nature. 1996; 383: 728-731Crossref PubMed Scopus (1467) Google Scholar). Cell Culture—MG-63 (human osteoblastic osteosarcoma cell line), HeLa (human cervical carcinoma cell line), MC3T3-E1 (clonal osteoblastic cell line) and CV-1 (green monkey kidney cell line) cells from ATCC were plated in Dulbecco's modified Eagle's medium and 10% charcoal-stripped serum with penicillin/streptomycin (Invitrogen) at 200,000 cells per well in 6-well plates and at 1 million cells per 10-cm dish. For phospho-ERK Westerns, the cells were incubated for 72 h in serum-free medium to reduce the basal phosphorylation and then treated with vehicle or the indicated concentrations of 1,25-D. Basal levels of phospho-ERK were measured in cells incubated in DME supplemented with 10% charcoal-stripped serum for 2 days to mimic the level at the end of transfection studies. To differentiate MC3T3-E1 cells, the cells were plated at a density of 1.7 million cells per 10-cm dish in MEM and 10% serum with 10 mm β-glycerophosphate and 50 μg/ml ascorbic acid for 28 days. Medium was changed every third day. At the end of 25 days, the cells were plated in MEM and 10% charcoal-stripped serum and then treated as described in the figures. An increase in the basal alkaline phosphatase activity was taken as an indicator of differentiation. Transient Transfection—Transient transfection of the cells was carried out as described earlier using lysine-coupled inactivated adenovirus as non-covalent carriers of the plasmids (39Nazareth L.V. Weigel N.L. J. Biol. Chem. 1996; 271: 19900-19907Abstract Full Text Full Text PDF PubMed Scopus (366) Google Scholar). For each well of a 6-well plate, the indicated amount of plasmid DNA was mixed with HEPES-buffered saline (0.15 m NaCl, 0.02 m HEPES, pH 7.2), and then incubated with 108 virus particles. Thirty minutes later, additional poly-l-lysine (1.3 μg of poly-l-lysine/μg DNA) was added to shrink the DNA on the surface of the virus. The virus-DNA complex mixture was added to cells and allowed to infect the cells for 2 h in medium lacking serum, following which the medium was supplemented with charcoal-stripped serum to a final concentration of 5%, and the infection was allowed to continue for 24 h. The cells were treated with hormone for an additional 24 h, harvested, and assays performed. Reporter Gene Assays—The cells were harvested by incubating in TEN (0.15 m NaCl, 0.01 m EDTA, 0.04 m Tris, pH. 8.0) at room temperature for 30 min. The cells were pelleted at 13,000 rpm for 30 s in an Eppendorf 5415C tabletop centrifuge. Protein from the pelleted cells was extracted with 1× reporter lysis buffer (Promega) containing 0.4 m NaCl for 30 min at room temperature. Luciferase assays were performed using the luciferase assay reagent from Promega Inc. and a Monolight 2010 Luminometer (Analytical Luminescence Lab, Ann Arbor, MI). The luciferase values were normalized to the total protein levels in the cells as measured by the Bradford assay (Bio-Rad). Chloramphenicol acetyltransferase (CAT) assays were performed as described earlier (40Zhang Y. Bai W. Allgood V.E. Weigel N.L. Mol. Endocrinol. 1994; 8: 577-584Crossref PubMed Scopus (67) Google Scholar) and normalized to total cellular protein. Determination of Alkaline Phosphatase Activity—The cells were rinsed once in 1× phosphate-buffered saline (PBS) and then scraped in PBS. The cells were then pelleted for 30 s at 13,000 rpm at 4 °C. The cell pellets were suspended in 250 mm Tris (pH 7.5) containing protease inhibitors (1 μg/ml leupeptin, antipain, aprotinin, benzamidine HCl, chymostatin, and pepstatin) and lysed by three cycles of freeze-thaw. The lysates were centrifuged, and the supernatant was assayed for alkaline phosphatase activity (41Bowers Jr., G.N. McComb R.B. Clin. Chem. 1966; 12: 70-89Crossref PubMed Scopus (459) Google Scholar) using an alkaline phosphatase kit from Sigma. Western Analysis—The cells were rinsed once with cold PBS and then scraped in PBS. The cells were then pelleted and extracted in lysis buffer (homogenization buffer: 0.05 m potassium phosphate pH 7.5, 10 mm sodium molybdate, 50 mm sodium fluoride, 2 mm EDTA, 2 mm EGTA, and 0.05% monothioglycerol, protease inhibitors (1 μg/ml aprotinin, leupeptin, antipain, benzamidine HCl, pepstatin), 0.2 mm phenylmethylsulfonyl fluoride, and 1 mm sodium vanadate) by three freeze thaw cycles. If the protein extracts that were used for reporter gene assays were also subjected to Western analysis, the proteins were extracted in 1× lysis buffer with 0.4 m NaCl to extract the nuclear proteins. The cell debris was pelleted, and protein levels were measured by the Bradford assay. Equal amounts of protein extracts were run on a polyacrylamide gel, and the proteins were transferred overnight to nitrocellulose at 150 mA. After transfer, the membrane was blocked in 1% milk in TBST (1× TBS (Tris-buffered saline: 10 mm Tris-HCl, 150 mm NaCl, pH 7.5) and 0.1% Tween 20) for 1 h for RXR isoforms and actin Westerns or incubated in 4 m urea for 3 h at room temperature for VDR or pERK Westerns. The blots were washed three times in 1× TBST 5 min per wash and then incubated with the primary antibody in 1% milk in 1× TBST overnight at 4 °C. The blots were washed, then incubated for 2 h at room temperature with a rabbit anti-rat antibody (Zymed Laboratories Inc. Inc. San Francisco, CA) in 1% BSA in 1× TBST for VDR Westerns and with a rabbit anti-mouse antibody (Zymed Laboratories Inc. Inc.) in 1% BSA in 1× TBST for pERK or actin Westerns. The blots were washed as described above and the VDR, actin, pERK, and the RXR blots were incubated in an anti-rabbit horse-radish peroxidase-tagged antibody (Amersham Biosciences) in 1× TBST for 1 h. The blots were washed as described above, and the signals were detected by enhanced chemiluminescence (Amersham Biosciences). SRC-1 and DRIP205 Westerns were performed by incubating the blots in 5% milk in 1× TBST overnight at 4 °C. The blots were then incubated with the primary antibody for 2 h at room temperature, washed as indicated above, and incubated with the anti-rabbit horse-radish peroxidase antibody for 1 h at room temperature. The blots were washed, and the signals detected by enhanced chemiluminescence as described above. Nuclear Extract Preparation—Nuclear extracts were prepared from MC3T3-E1 or HeLa cells treated with 20 μm U0126, 10 nm 1,25-D, a combination of U0126 and 1,25-D, or with vehicle for 24 h, as described earlier (42Liu Y.Y. Nguyen C. Peleg S. Mol. Endocrinol. 2000; 14: 1776-1787Crossref PubMed Scopus (43) Google Scholar). Briefly, the cells were washed once with 1× PBS, scraped into 10 ml of PBS, centrifuged at 2000 rpm for 10 min at 4 °C, and resuspended in 1 ml of PBS. After centrifuging at 4000 rpm for 35 s at 4 °C, the cells were resuspended in 300 μl of buffer A (10 mm HEPES pH 7.9, 1.5 mm MgCl2, 10 mm KCl, and 0.5 mm dithiothreitol). After incubating for 10 min on ice to allow swelling, the cells were homogenized with 6 strokes of a Dounce homogenizer and centrifuged at 4000 rpm for 45 s at 4 °C. The nuclear pellets were gently resuspended in 50-80 μl of buffer C (20 mm HEPES pH 7.9, 400 mm KCl, 1.5 mm MgCl2, 0.2 mm EDTA, 25% glycerol, and 0.5 mm dithiothreitol), and homogenized with 8-10 strokes of the Dounce homogenizer. After 30 min of incubation on ice, the homogenates were centrifuged at 4500 rpm for 1 min at 4 °C. The nuclear extracts (supernatants) were aliquoted, frozen immediately in a dry ice/ethanol bath, and stored at -80 °C for further analysis. Electrophoretic Mobility Shift Assay (EMSA)—EMSAs were performed as previously described (43MacDonald P.N. Dowd D.R. Nakajima S. Galligan M.A. Reeder M.C. Haussler C.A. Ozato K. Haussler M.R. Mol. Cell. Biol. 1993; 13: 5907-5917Crossref PubMed Scopus (237) Google Scholar). Binding reactions contained 20 mm Tris-HCl (pH 7.5), 60 mm KCl, 5 mm MgCl2, 1 mm DTT, 4% glycerol, 100 μg/ml BSA, 25 ng of poly(dI-dC)·poly(dI-dC) (Amersham Biosciences) as a nonspecific competitor, 10,000 cpm of 5′-end-labeled DNA (0.003-0.01 ng), and 3.75 μg of nuclear extract in a final volume of 25 μl. Some binding reactions were carried out in the presence of an anti-VDR antibody (Affinity Bioreagents; concentration 1 μg/μl), which was preincubated with nuclear extract in the presence of binding buffer for 20 min at 25 °C. Nonspecific competitor and probe DNA were then added, and incubation was carried out for a further 40 min. The binding reactions were fractionated through a native 5% polyacrylamide gel (29% acrylamide, 1% bis-acrylamide in 0.5× TBE), which was autoradiographed with an intensifying screen at -70 °C. The vitamin D response element of the mouse osteopontin gene (VDREmop) was used as the end-labeled DNA probe. The sequence of the upper strand is shown; the underlined sequences represent the two-hexanucleotide motifs from the mouse osteopontin gene VDRE: VDREmop 760-AGAGCAACAAGGTTCACGAGGTTCACGTCTC-730. Processing of Cells for Deconvolution Microscopy—All steps were performed at room temperature according to the protocol described earlier (44Stenoien D.L. Mancini M.G. Patel K. Allegretto E.A. Smith C.L. Mancini M.A. Mol. Endocrinol. 2000; 14: 518-534PubMed Google Scholar). The cells were plated on coverslips at 200,000 cells per well in a 6-well dish in Dulbecco's modified Eagle's medium supplemented with 10% stripped serum. After treatment, the cells were fixed in 4% formaldehyde (Polysciences Inc., Warrington, PA) in PEM buffer (80 mm potassium PIPES, pH 7.5, 5 mm EGTA, and 2 mm MgCl2) for 30 min. The cells were then washed three times (5 min per wash) in PEM buffer and incubated for 10 min in 0.1 m ammonium chloride to quench autofluorescence. The cells were then washed two times (5 min per wash) in PEM buffer and incubated in PEM and 0.5% Triton X-100 for 30 min to permeabilize the cells. After washing three times with PEM buffer, the cells were blocked with 5% milk in TBST for 30 min and incubated with the VDR antibody (0.5 μg/ml) in blocking solution for 1 h. The cells were then washed three times (5 min per wash) in TBST and incubated with goat anti-rat Alexa fluor 498 antibody (Molecular Probes, Eugene, OR) for 1 h at room temperature. The cells were washed and fixed again as described above and were counterstained for 1 min with 4,6-diamidino-2-phenylindole (DAPI) (1 μg/ml) in TBST and mounted in Slow Fade reagent (Molecular Probes, Inc.). Deconvolution Microscopy—Deconvolution microscopy was performed on the processed and mounted coverslips with a Zeiss AxioVert S100 TV microscope (Carl Zeiss, Thornwood, NY) and a Delta Vision Restoration Microscopy System (Applied Precision, Inc.). A Z-series of focal planes were digitally imaged and deconvolved with the Delta Vision constrained iterative algorithm to generate high resolution images (44Stenoien D.L. Mancini M.G. Patel K. Allegretto E.A. Smith C.L. Mancini M.A. Mol. Endocrinol. 2000; 14: 518-534PubMed Google Scholar). A total of 200 cells were counted, and percent cells with VDR distributed between nucleus and cytoplasm was determined and expressed in the form of a table. RNA Isolation and Northern Hybridization—Total RNA was isolated from MG-63 and MC3T3-E1 cells using TRIzol (Invitrogen Life Technologies). Twenty micrograms of total RNA was separated by 6.65% formaldehyde-1% agarose gel electrophoresis transferred to a nylon membrane (Hybond N+, Amersham Biosciences), ultraviolet cross-linked, and then hybridized to labeled DNA probes for collagen I-α1 (from the ATCC). Denatured probes were labeled with [32P]dCTP (Amersham Biosciences) at 37 °C for 15 min using a Random Prime Labeling kit (Roche Applied Science). The membranes were prehybridized for 3 h at 65 °C and hybridized with the prepared probe overnight at 65 °C in Church hybridization solution (7% SDS, 1% BSA, 0.001 m EDTA, and 0.5 m sodium phosphate, pH 7). The blots were washed for 30 min each twice at 37 °C, once at 65 °C for 30 min with wash buffer (1% SDS, 0.05 m sodium phosphate, pH 7, 0.01 m EDTA), and then exposed to film. The message levels were quantified using a Storm 860 PhosphorImager equipped with Imagequant software (Molecular Dynamics, Piscataway, NJ). Real Time Reverse Transcriptase PCR Analysis—The RNA from MG-63 cells was diluted 100-fold for 24-hydroxylase RT-PCR. Since 24-hydroxylase expression was very low in MC3T3-E1 cells, the RNA from MC3T3-E1 cells was used directly without dilution. RNA from MG-63 and MC3T3-E1 cells were diluted 1500-fold for 18 S ribosomal RNA detection. The message was analyzed using real time-PCR (ABI PRISM 7700 sequence detector, Applied Biosystems, Foster City, CA) using one step real time RT-PCR mix (Applied Biosystems) with TaqMan primers and probes for 24-hydroxylase (human 24-hydroxylase: forward primer, CCCAGCGGCTGGAGATC; reverse primer, CCGTAGCCTTCTTTGCGG; probe, AACCGTGGAAGGCCTATCGCGACT; mouse 24-hydroxylase: forward primer, TCATTGCGGCCATCAAAAC; reverse primer, TTGGTGTTGAGGCGCTTGT; probe, ATGAGCACATTTGGGAAGATGATGGTGA from BIOSOURCE International, Denver, CO), and a Taqman primer probe set for 18 S rRNA from Applied Biosystems. The RT-PCR was performed under the conditions of 48 °C for 30 min, 95 °C for 10 min, and 40 cycles of 60 °C for 1 min. All experiments were performed at least three times. The ALP and transient transfection assays were performed in triplicate each time. The ALP, collagen I-α1, and 24-hydroxylase levels were statistically analyzed by one-way analysis of variance and when significance was revealed (p < 0.05), a Holm Sidak post-hoc test was done to identify differences between the groups using Sigma" @default.
• W2061935675 created "2016-06-24" @default.
• W2061935675 creator A5004137464 @default.
• W2061935675 creator A5061725261 @default.
• W2061935675 creator A5067304169 @default.
• W2061935675 creator A5067659573 @default.
• W2061935675 date "2004-11-01" @default.
• W2061935675 modified "2023-10-06" @default.
• W2061935675 title "The Functional Consequences of Cross-talk between the Vitamin D Receptor and ERK Signaling Pathways Are Cell-specific" @default.
• W2061935675 cites W1481038980 @default.
• W2061935675 cites W1584519687 @default.
• W2061935675 cites W1598637664 @default.
• W2061935675 cites W1619161113 @default.
• W2061935675 cites W1628490849 @default.
• W2061935675 cites W1790580730 @default.
• W2061935675 cites W1915833704 @default.
• W2061935675 cites W1934005039 @default.
• W2061935675 cites W1967119334 @default.
• W2061935675 cites W1976386179 @default.
• W2061935675 cites W1979037868 @default.
• W2061935675 cites W1981084963 @default.
• W2061935675 cites W1986038688 @default.
• W2061935675 cites W1988290071 @default.
• W2061935675 cites W1988679331 @default.
• W2061935675 cites W1990511681 @default.
• W2061935675 cites W1996168740 @default.
• W2061935675 cites W1998808428 @default.
• W2061935675 cites W2000956764 @default.
• W2061935675 cites W2015046572 @default.
• W2061935675 cites W2017015835 @default.
• W2061935675 cites W2020510672 @default.
• W2061935675 cites W2024160556 @default.
• W2061935675 cites W2029923092 @default.
• W2061935675 cites W2031873963 @default.
• W2061935675 cites W2031981194 @default.
• W2061935675 cites W2042432961 @default.
• W2061935675 cites W2048308258 @default.
• W2061935675 cites W2050145162 @default.
• W2061935675 cites W2050235370 @default.
• W2061935675 cites W2051287526 @default.
• W2061935675 cites W2052629350 @default.
• W2061935675 cites W2061344802 @default.
• W2061935675 cites W2061762379 @default.
• W2061935675 cites W2064992165 @default.
• W2061935675 cites W2066419081 @default.
• W2061935675 cites W2072423174 @default.
• W2061935675 cites W2073144105 @default.
• W2061935675 cites W2074591194 @default.
• W2061935675 cites W2077848445 @default.
• W2061935675 cites W2078802143 @default.
• W2061935675 cites W2079688281 @default.
• W2061935675 cites W2086262311 @default.
• W2061935675 cites W2087100948 @default.
• W2061935675 cites W2097808377 @default.
• W2061935675 cites W2100228842 @default.
• W2061935675 cites W2118246237 @default.
• W2061935675 cites W2119953207 @default.
• W2061935675 cites W2122014103 @default.
• W2061935675 cites W2122536100 @default.
• W2061935675 cites W2127150495 @default.
• W2061935675 cites W2138699737 @default.
• W2061935675 cites W2141466699 @default.
• W2061935675 cites W2147868370 @default.
• W2061935675 cites W2151463503 @default.
• W2061935675 cites W2159092431 @default.
• W2061935675 cites W2164574768 @default.
• W2061935675 cites W2410553617 @default.
• W2061935675 cites W4298135253 @default.
• W2061935675 doi "https://doi.org/10.1074/jbc.m404101200" @default.
• W2061935675 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15331595" @default.
• W2061935675 hasPublicationYear "2004" @default.
• W2061935675 type Work @default.
• W2061935675 sameAs 2061935675 @default.
• W2061935675 citedByCount "53" @default.
• W2061935675 countsByYear W20619356752012 @default.
• W2061935675 countsByYear W20619356752014 @default.
• W2061935675 countsByYear W20619356752015 @default.
• W2061935675 countsByYear W20619356752016 @default.
• W2061935675 countsByYear W20619356752017 @default.
• W2061935675 countsByYear W20619356752018 @default.
• W2061935675 countsByYear W20619356752019 @default.
• W2061935675 countsByYear W20619356752021 @default.
• W2061935675 countsByYear W20619356752023 @default.
• W2061935675 crossrefType "journal-article" @default.
• W2061935675 hasAuthorship W2061935675A5004137464 @default.
• W2061935675 hasAuthorship W2061935675A5061725261 @default.
• W2061935675 hasAuthorship W2061935675A5067304169 @default.
• W2061935675 hasAuthorship W2061935675A5067659573 @default.
• W2061935675 hasBestOaLocation W20619356751 @default.
• W2061935675 hasConcept C185592680 @default.
• W2061935675 hasConcept C55493867 @default.
• W2061935675 hasConcept C57074206 @default.
• W2061935675 hasConcept C62478195 @default.
• W2061935675 hasConcept C86803240 @default.
• W2061935675 hasConcept C95444343 @default.
• W2061935675 hasConceptScore W2061935675C185592680 @default.
• W2061935675 hasConceptScore W2061935675C55493867 @default.
• W2061935675 hasConceptScore W2061935675C57074206 @default.

• next