FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2062435249> ?p ?o ?g. }

• W2062435249 endingPage "38070" @default.
• W2062435249 startingPage "38061" @default.
• W2062435249 abstract "Iron transport across the plasma membrane appears to be a unidirectional process whereby iron uptake is essentially irreversible. One of the major sequestration sites for iron is the vacuole that stores a variety of metals, either as a mechanism to detoxify the cell or as a reservoir of metal to enable the cell to grow when challenged by a low iron environment. Exactly how the vacuole contributes to the overall iron metabolism of the cell is unclear because mutations that affect vacuolar function also perturb the assembly of the plasma membrane high affinity transport system composed of a copper-containing iron oxidase, Fet3p, and an Fe3+-specific iron transporter, Ftr1p. Here, we characterize the iron transporter homologue Fth1p, which is similar to the high affinity plasma membrane iron transporter Ftr1p. We found that Fth1p was localized to the vacuolar surface and, like other proteins that function on the vacuole, did not undergo Pep4-dependent degradation. Co-immunoprecipitation experiments showed that Fth1p also associates with the Fet3p oxidase homologue, Fet5p; and disruption of the FET5 gene results in the accumulation of Fth1p in the endoplasmic reticulum. We also found that loss of this protein complex leads to elevated transcriptional activity of the FET3 gene and compromises the ability of the cell to switch from fermentative metabolism to respiratory metabolism. Because the Fet5 protein is oriented such that the oxidase domain of Fet5p is lumenal, this complex may be responsible for mobilizing intravacuolar stores of iron. Iron transport across the plasma membrane appears to be a unidirectional process whereby iron uptake is essentially irreversible. One of the major sequestration sites for iron is the vacuole that stores a variety of metals, either as a mechanism to detoxify the cell or as a reservoir of metal to enable the cell to grow when challenged by a low iron environment. Exactly how the vacuole contributes to the overall iron metabolism of the cell is unclear because mutations that affect vacuolar function also perturb the assembly of the plasma membrane high affinity transport system composed of a copper-containing iron oxidase, Fet3p, and an Fe3+-specific iron transporter, Ftr1p. Here, we characterize the iron transporter homologue Fth1p, which is similar to the high affinity plasma membrane iron transporter Ftr1p. We found that Fth1p was localized to the vacuolar surface and, like other proteins that function on the vacuole, did not undergo Pep4-dependent degradation. Co-immunoprecipitation experiments showed that Fth1p also associates with the Fet3p oxidase homologue, Fet5p; and disruption of the FET5 gene results in the accumulation of Fth1p in the endoplasmic reticulum. We also found that loss of this protein complex leads to elevated transcriptional activity of the FET3 gene and compromises the ability of the cell to switch from fermentative metabolism to respiratory metabolism. Because the Fet5 protein is oriented such that the oxidase domain of Fet5p is lumenal, this complex may be responsible for mobilizing intravacuolar stores of iron. endoplasmic reticulum bathophenathroline disulfonic acid base pair(s) polymerase chain reaction green fluorescent protein glutathione S-transferase 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid 4,6-diamidino-2-phenylindole alkaline phosphatase red green blue synthetic medium with dextrose The mechanism by which iron is transported across the plasma membrane in yeast has been intensively studied (1Askwith C. Eide D. Van Ho D. Bernard P.S. Li L. Davis-Kaplan S. Sipe D.M. Kaplan J. Cell. 1994; 76: 403-410Abstract Full Text PDF PubMed Scopus (588) Google Scholar, 2Eide D. Annu. Rev. Nutr. 1998; 18: 441-469Crossref PubMed Scopus (244) Google Scholar). High affinity transport is catalyzed by a complex of proteins that comprise the gene products of FET3 and FTR1 (3Askwith C. Kaplan J. Trends Biochem. Sci. 1998; 23: 135-138Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar, 4Stearman R. Yuan D.S. Yamaguchi-Iwai Y. Klausner R.D. Dancis A. Science. 1996; 271: 1552-1557Crossref PubMed Scopus (582) Google Scholar). FET3encodes a multicopper iron oxidase, whereas FTR1 encodes a polytopic membrane protein that is thought to be a Fe3+-specific transporter. Together, Fet3p and Ftr1p are responsible for the transport of Fe2+ across the plasma membrane; the observation that a functional FET3 is required for Ftr1p to exit the endoplasmic reticulum (ER)1 strongly indicates that this complex assembles in the ER prior to moving to the plasma membrane (4Stearman R. Yuan D.S. Yamaguchi-Iwai Y. Klausner R.D. Dancis A. Science. 1996; 271: 1552-1557Crossref PubMed Scopus (582) Google Scholar). The coupling between the iron oxidase and the Fe3+-specific transporter may ensure the specificity of this transport system (1Askwith C. Eide D. Van Ho D. Bernard P.S. Li L. Davis-Kaplan S. Sipe D.M. Kaplan J. Cell. 1994; 76: 403-410Abstract Full Text PDF PubMed Scopus (588) Google Scholar, 2Eide D. Annu. Rev. Nutr. 1998; 18: 441-469Crossref PubMed Scopus (244) Google Scholar). The assembly of a functional Ftr1p-Fet3p complex is dependent on copper, which is supplied to the Fet3 protein by the copper-specific P-type ATPase Ccc2p and the copper-specific chaperone Atx1p. Loading of Fet3p with copper also requires a functional V-ATPase as well as the chloride channel Gef1p (5Eide D. Bridgham J.T. Zhao Z. Mattoon J.R. Mol. Gen. Genet. 1993; 241: 447-456Crossref PubMed Scopus (82) Google Scholar, 6Greene J.R. Brown N.H. DiDomenico B.J. Kaplan J. Eide D.J. Mol. Gen. Genet. 1993; 241: 542-553Crossref PubMed Scopus (105) Google Scholar) and may take place in the Golgi apparatus or in some yet uncharacterized post-Golgi compartment. This model is based on the observations that Ccc2p and Gef1p are localized to such compartments and that perturbations in the function of the post-Golgi endocytic system lead to a defect in copper loading of Fet3p (5Eide D. Bridgham J.T. Zhao Z. Mattoon J.R. Mol. Gen. Genet. 1993; 241: 447-456Crossref PubMed Scopus (82) Google Scholar, 6Greene J.R. Brown N.H. DiDomenico B.J. Kaplan J. Eide D.J. Mol. Gen. Genet. 1993; 241: 542-553Crossref PubMed Scopus (105) Google Scholar, 7Davis-Kaplan S.R. Askwith C.C. Bengtzen A.C. Radisky D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13641-13645Crossref PubMed Scopus (112) Google Scholar, 8Gaxiola R.A. Yuan D.S. Klausner R.D. Fink G.R. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 4046-4050Crossref PubMed Scopus (151) Google Scholar, 9Radisky D.C. Snyder W.B. Emr S.D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 5662-5666Crossref PubMed Scopus (78) Google Scholar, 10Schwappach B. Stobrawa S. Hechenberger M. Steinmeyer K. Jentsch T.J. J Biol. Chem. 1998; 273: 15110-15118Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar, 11Yuan D.S. Dancis A. Klausner R.D. J. Biol. Chem. 1997; 272: 25787-25793Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). In the absence of the Ftr1p-Fet3p complex, other transporters such as the Fet4 protein are up-regulated (12Dix D. Bridgham J. Broderius M. Byersdorfer C.A. Eide D. J. Biol. Chem. 1994; 269: 26092-26099Abstract Full Text PDF PubMed Google Scholar, 13Dix D. Bridgham J. Broderius M. Eide D. J. Biol. Chem. 1997; 272: 11770-11777Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar). Fet4p is a broad specificity transporter that has been shown to transport iron across the plasma membrane and is the major transporter responsible for low affinity iron uptake (12Dix D. Bridgham J. Broderius M. Byersdorfer C.A. Eide D. J. Biol. Chem. 1994; 269: 26092-26099Abstract Full Text PDF PubMed Google Scholar, 13Dix D. Bridgham J. Broderius M. Eide D. J. Biol. Chem. 1997; 272: 11770-11777Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar), whereas other transporters such as Smf1p/Smf2p may also contribute to nonselective uptake of iron (14Li L. Kaplan J. J. Biol. Chem. 1998; 273: 22181-22187Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar, 15Liu X.F. Culotta C.V. J. Biol. Chem. 1999; 274: 4863-4868Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar, 16Pinner E. Gruenheid S. Raymond M. Gros P. J. Biol. Chem. 1997; 272: 28933-28938Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). Iron transport across the plasma membrane in living yeast appears to be a unidirectional process whereby iron uptake and sequestration is essentially irreversible even when iron chelators are added to the exogenous medium (17Eide D. Davis-Kaplan S. Jordan I. Sipe D. Kaplan J. J. Biol. Chem. 1992; 267: 20774-20781Abstract Full Text PDF PubMed Google Scholar). One of the major sequestration sites for iron is the vacuole that stores a variety of metals either as a mechanism to detoxify the cell or as a reservoir of metal to enable the cell to grow when challenged by a low iron environment (21Cormack BP Microbiology. 1997; 143: 303-311Crossref PubMed Scopus (502) Google Scholar). Exactly how the vacuole may contribute to the overall iron metabolism of the cell is unclear. Mutations in the vacuolar ATPase cause a defect for growth under iron-limiting conditions (5Eide D. Bridgham J.T. Zhao Z. Mattoon J.R. Mol. Gen. Genet. 1993; 241: 447-456Crossref PubMed Scopus (82) Google Scholar, 6Greene J.R. Brown N.H. DiDomenico B.J. Kaplan J. Eide D.J. Mol. Gen. Genet. 1993; 241: 542-553Crossref PubMed Scopus (105) Google Scholar). Also, mutations that disrupt vacuolar biogenesis result in similar defects (14Li L. Kaplan J. J. Biol. Chem. 1998; 273: 22181-22187Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar). The explanation for this effect is that these mutations alter the function or localization of the P-type ATPase Ccc2p, which in turn compromise the copper-dependent activation of Fet3p (7Davis-Kaplan S.R. Askwith C.C. Bengtzen A.C. Radisky D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13641-13645Crossref PubMed Scopus (112) Google Scholar, 8Gaxiola R.A. Yuan D.S. Klausner R.D. Fink G.R. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 4046-4050Crossref PubMed Scopus (151) Google Scholar, 14Li L. Kaplan J. J. Biol. Chem. 1998; 273: 22181-22187Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar). However, how much these mutations would affect the capacity of the vacuole to store iron has not been examined directly, thus providing the possibility that these mutations may also perturb vacuolar storage function. Because the vacuole stores iron, we surmised that the vacuole may have a specific iron transport system. Here, we characterize the iron (Fe) transporter homologue, Fth1p, which is similar to the high affinity plasma membrane iron transporter Ftr1p (4Stearman R. Yuan D.S. Yamaguchi-Iwai Y. Klausner R.D. Dancis A. Science. 1996; 271: 1552-1557Crossref PubMed Scopus (582) Google Scholar). We found that Fth1p is localized to the vacuolar surface, and like other proteins that function on the vacuole, it does not undergo PEP4-dependent degradation. Fth1p also appears to associate with the Fet3p oxidase homologue, Fet5p, as disruption of the FET5 gene results in the accumulation of Fth1p in the ER. Furthermore, immunoprecipitation experiments show that Fet5p associates with Fth1p in detergent lysates. Finally, we find that disruption of the Fth1p-Fet5p complex alters iron homeostasis and can inhibit the transition from fermentative to respiratory metabolism. Glutathione-agarose beads were purchased from Amersham Pharmacia Biotech. Yeast nitrogen base was purchased from DIFCO. Amino acid supplements were purchased from Bio101 (La Jolla, CA). Chemiluminescent developer was purchased from Pierce. Bathophenathroline disulfonic acid (BPS) was purchased from Sigma. Bathocuproinedisulfonic salt was purchased from Aldrich. All other chemicals were of high grade and were purchased from commercial sources. Oxyliticase was purchased from Ensogenetics (Corvallis, OR). Restriction enzymes were purchased from New England Biolabs (Beverly, MA). Protease inhibitor mixture (CompleteTM) was purchased from Roche Molecular Biochemicals. The yeast strains used in this study were SEY6210 (MATα ura3–52 leu2–3-112 his3-Δ200 trp1–901 lys2–801 suc2-Δ9) (19Robinson J.S. Klionsky D.J. Banta L.M. Emr S.D. Mol. Cell. Biol. 1988; 8: 4936-4948Crossref PubMed Scopus (739) Google Scholar). PLY1313 (MATα fet5Δ::HIS3 ura3–52 leu2–3-112 his3-Δ200 trp1–901 lys2–801 suc2-Δ9);PLY1546 (MATα fet5Δ::HIS3 fth1Δ::NEO ura3–52 leu2–3-112 his3-Δ200 trp1–901 lys2–801 suc2-Δ9); LWY5541 (MATα pep4Δ ura3–52 leu2–3-112 his3-Δ200 trp1–901 lys2–801 suc2-Δ9); SF838-9Da (MATα pep4–3 ura3–52 leu2–3-112 his4–519 gal2) (22Piper R.C. Whitters E.A. Stevens T.H. Eur. J. Cell Biol. 1994; 65: 305-318PubMed Google Scholar); and RPY10(MATα ura3–52 leu2–3-112 his4–519 gal2) (22Piper R.C. Whitters E.A. Stevens T.H. Eur. J. Cell Biol. 1994; 65: 305-318PubMed Google Scholar). PLY1313 and LWY5541 are congenic with SEY6210. RPY10 is congenic with SF838-9Dα. A yeast strain (RGY3347) carrying a deletion of theFTH1 open reading frame (catalogue number 3347, BY4739-ybr207Δ: MATa fth1Δ::NEO leu2 lys2 ura3) was purchased from Research Genetics (Huntsville, AL). A fet5Δ disruption strain was made by amplifying theHIS3 gene from the plasmid pRS303 using the oligos: ATGTTGTTCTACTCGTTCGTGTGGTCTGTACTGGCCGCTAGTGTTGCTTTTTGTACTGAGAGTGCACCAT; GCCGCGAGAAACCTCTATTTCATTTTCAGCCAAGATTTCCCTTAACGTGTGGGTATTTCACACCGCATA. The resulting PCR fragment was transformed into SEY6210. Genomic DNA was prepared from His+ transformants by pelleting 1–2 optical density units of cells and incubating them in 300 μl of 50 mmTris, pH 8.0, 5 mm EDTA, 50 mmβ-mercaptoethanol, containing 10 μg/ml oxyliticase overnight to produce a cell lysate in which vacuolar proteases were allowed to digest cellular proteins. The cell lysate was then extracted with phenol-chloroform, and DNA was precipitated with the addition of ethanol and NaCl. Genomic DNA from putativefet5Δ::HIS3 mutants was then analyzed by PCR using oligos flanking the HIS3 gene insertion. Thefet5Δ::HIS3 deletion removes amino acids 17–620 from the FET5 open reading frame. A fet5Δ fth1Δ strain was made by amplifying the loci of the FTH1 gene from RGY3347 using oligos that hybridized 400 bp outside of either end of the FTH1 open reading frame. This PCR product (containing the KanMX4 neomycin resistance gene surrounded by a 400-bp sequence homologous to the 5′ and 3′ untranslated regions of FTH1) was transformed into PLY1313. Neo+ colonies were confirmed for thefth1Δ::NEO disruption by PCR amplification of the genomic DNA. For metabolic shift experiments, cells were cultured in SD medium until they had reached mid-log phase (A 600 = 1). Cells were centrifuged and resuspended in SD medium containing 200 μm BPS and cultured for an additional 12 h. Cells were then washed with water, and 5 μl of a 1:10 serial dilution of each cell type was then plated onto minimal plates containing 10 μm BPS and 500 μm FeSO4 with either glucose or ethanol/glycerol (2:4%). Cells transformed with promoter-lacz fusion plasmids were grown in SD medium lacking uracil overnight to A 600 = 2.5. Cells were then diluted to an A 600 of 0.05 in SD-Ura medium containing supplements and grown for an additional 10 h. Cells were collected by centrifugation, and cell pellets were frozen at −20 °C. Cells were then resuspended in 1 ml of Z buffer (60 mm Na2PO4, 40 mmNaH2PO4, 10 mm KCl, 1 mm MgSO4, and 0.27% (v/v) 2-mercaptoethanol). 30 μl of CHCl3 and 20 μl of 10% SDS were added, and cells were vortexed and adjusted to 0.8 mg/mlo-nitrophenyl-β-d-galactosidase. Cell suspensions were incubated for 10 min at 22 °C. Reactions were stopped by the addition of 500 μl of 1 mNa2CO3, pH 11.0. Cells were pelleted, and supernatants were measured for absorbance at 405 nm. Each condition was measured in triplicate using three separate cultures derived from separate transformants for each plasmid. Immunofluorescence microscopy using anti-HA, anti-Vma2p, and anti-Kar2p was performed essentially as previously described (19Robinson J.S. Klionsky D.J. Banta L.M. Emr S.D. Mol. Cell. Biol. 1988; 8: 4936-4948Crossref PubMed Scopus (739) Google Scholar). Briefly, cells were grown in selective SD medium and adjusted to 3.7% formaldehyde. After 30 min, cells were then resuspended and incubated in 4% fresh paraformaldehyde containing 50 mm KPO4 for 12 h. Cells were washed in 200 mm Tris, pH 8.0, + 20 mm EDTA + 1% β-mercaptoethanol, and then spheroplasted in 1.2 msorbitol, 50 mm Tris, pH 8.0, containing 10 μg/ml oxyliticase for 30 min. Cells were then washed in 1.2 msorbitol, permeabilized for 60 s in 1% SDS, 1.2 msorbitol, and washed three times in 1.2 m sorbitol. Cells were then adhered to polylysine-coated glass slides prior to immunolabeling. For labeling with FM4-64 (Molecular Probes, Eugene, OR), cells were labeled for 30 min at 30 °C in 500 nm FM4-64 in SD medium containing 50 mm KPO4, pH 7.5. Cells were then washed in water and cultured in unbuffered SD medium or yeast extract-peptone-dextrose for 30 min. Yeast cells harboring GFP-expressing plasmids were grown in SD medium to a density of 0.8–1.2. An 0.5 volume of GFP-KILL buffer (1 m Tris, pH 8.0, 5.0% sodium azide) was added to ensure that membrane traffic had ceased and that the GFP protein was kept at the optimal pH level for fluorescence detection. For some experiments, 10 μm DAPI was included in the GFP-KILL buffer. GFP fusion proteins were imaged using a 470-nm excitation filter, 495-nm dichroic mirror, and 525-nm emission filter. Images were captured with a Hammamatsu ORCA CCD camera mounted on an Olympus BX-60 microscope equipped with a 100× oil objective. Image sets were processed and overlaid using Adobe PhotoshopTM. Plasmid pJLU54 was transformed into MC1061Escherichia coli, which were then induced with isopropyl-1-thio-β-d-galactopyranoside as described previously (22Piper R.C. Whitters E.A. Stevens T.H. Eur. J. Cell Biol. 1994; 65: 305-318PubMed Google Scholar, 23Smith D.B. Johnson K.S. Gene. 1998; 67: 31-40Crossref Scopus (5047) Google Scholar). The resulting recombinant GST-GFP fusion protein was purified over glutathione-agarose, dialyzed against phosphate-buffered saline, and used to immunize rabbits. Anti-GFP antibodies were affinity purified over an Affi-Gel 10/15 column to which was attached the GST-GFP fusion protein according to manufacturer's directions (Bio-Rad). Polyclonal anti-GST antibodies were purified from serum from rabbits immunized with irrelevant GST fusion proteins over an Affi-Gel 10/15 column to which was attached the GST protein alone. The mouse anti-Vma2p (13D11) and anti-ALP (Pho8p; 1D3) monoclonal antibodies were purchased from Molecular Probes. The polyclonal anti-HA antibody was a kind gift of Kathryn Hill and Tom Stevens (University of Oregon, Eugene, OR). The monoclonal anti-HA antibody 16B12 and the monoclonal anti-6xHis antibody, which recognizes an epitope composed of six tandem histidine residues, was purchased from Babco (Berkeley, CA). Rabbit polyclonal anti-Kar2p was a kind gift of Mark Rose (Princeton University). Texas Red-labeled secondary antibodies were purchased from Molecular Probes. Horseradish peroxidase-conjugated secondary antibodies were purchased from Amersham Pharmacia Biotech. Digoxin labeling of antibodies was performed according to the manufacturer's instructions using a digoxin labeling kit (Roche Molecular Biochemicals). Whole cell lysates from growing cultures of yeast cells were made by pelleting yeast, washing the pellet once with water, and resuspending it in 50 mm Tris, pH 6.5, 8m urea, 2% SDS. Glass beads (150–200 μm) were added, and the sample was vortexed for 2 min. Samples were then adjusted to 1× Laemmli sample buffer (20Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar). For screening for the presence of the HA epitope, colonies were transferred into wells of a 96-well microtiter plate containing 50 mm Tris, pH 6.5, 5% SDS, 8m urea, and 10% β-mercaptoethanol. The dish was then incubated at 65 °C for 5 min prior to loading the resulting samples. To make whole membrane fractions, yeast cells were washed in water and resuspended in 200 mm Tris, pH 9.0, 0.05% sodium azide, containing 10 mm dithiothreitol, and incubated for 5 min at 25 °C. Cells were then pelleted and resuspended in 10 ml of 1.2m sorbitol, 50 mm KPO4, containing 10 μg/ml oxyliticase, and incubated for 30 min at 30 °C. The spheroplasts were then layered onto a sucrose cushion (1.2m sucrose, 20 mm HEPEPS, pH 7.2, 2 mm EDTA) and collected as a pellet after centrifugation at 7,000 × g for 20 min. Cells were lysed in 700 mm sorbitol, 20 mm HEPES, pH 7.2, and 2 mm EDTA. Postnuclear supernatants were generated by centrifugation at 1,000 × g for 5 min, and the membranes were isolated by centrifuging the postnuclear supernatants at 40,000 × g for 30 min in a Beckman TLA-45 rotor. Yeast spheroplasts were made from 100 ml of yeast culture grown in minimal medium toA 600 = 1.0 as described above. The spheroplast pellet was resuspended in phosphate-buffered saline, 1 mmEDTA, 1% Triton X-100, and protease inhibitor mixture (CompleteTM, Roche Molecular Biochemicals). Cell lysates were then centrifuged at 15,000 × g for 15 min, and the supernatant was removed and added to tubes containing affinity-purified anti-GFP antibody, affinity-purified anti-GST antibody, anti-HA monoclonal antibody 16B12, or the monoclonal anti-6xHis antibody. Extracts were incubated on ice for 2 h after which 50 μl of protein G-coupled Sepharose was added (Santa Cruz Biotechnology, Santa Cruz, CA). After 60 min, beads were washed three times in phosphate-buffered saline, 1 mm EDTA, 0.5% Triton X-100. Samples were then solubilized in Laemmli sample buffer and analyzed by immunoblotting using a mouse monoclonal anti-HA antibody or digoxin-labeled rabbit anti-GFP antibody to assess the amount of HA- and GFP-tagged protein immunoprecipitated by the rabbit polyclonal antibodies. A polyclonal anti-HA was used to assess the amount of HA-tagged protein precipitated with the monoclonal anti-HA antibody. All PCR amplifications performed to obtain gene fragments were done using genomic DNA prepared from SEY6210. All PCR fragments were generated using the High Fidelity PCR kit (Roche Molecular Biochemicals). The plasmid pALP-GFP3–3′UT1 (pPL650) consisting of a NotI/BamHI fragment composed of bp-(440–1698) of PHO8, aBamHI/EcoRI fragment of mutant 3 GFP (21Cormack BP Microbiology. 1997; 143: 303-311Crossref PubMed Scopus (502) Google Scholar) bp-(1–714), and an EcoRI/KpnI fragment of the 3′UT of the PHO8 gene (bp-(1701–3530)) in the polylinker of pRS316 was used as the vector for tagging various open reading frames with GFP. The plasmid was made by serially subcloning PCR fragments generated with High Fidelity polymerase using the oligos: CACGCGGCCGCACAAGGGAAGCAGGCCTCTTGC; CACGGATCCTGGTCAACTCATGGTAGTATTC; CACGGATCCTGTCTAAAGGTGAAGGAATTATTC; GAAGAATTCTTATTTGTACAATTCATCCAT; CACGAATTCACGAATTCCCTATCTAAGTGTCCCTCTTTTTTC; and TCCAGGGATATCGAAAAAATC. pJLU34, which encodes a Ste3-GFP fusion protein, was made by subcloning a PCR fragment composed of bp-(368–1411) of STE3 into theNotI/BamHI sites of pPL650 using the oligonucleotides CAGCGCGGCCGCGGTTAGAAGCGCTGGTACAATTTTCTCT and CCTGGATCCTAGGGCCTGCAGTATTTTCTGAACTA. pJLU36, which encodes a Fet4-GFP fusion protein, was made by subcloning a PCR fragment composed of bp-(495–1656) of FET4 into theNotI/BamHI sites of pPL650 using the oligonucleotides CAGCGCGGCCGCGTTGAGCCTTATTGGGGCGTAAATCA and CCTGGATCCTTTTTTCCAACATCATAACCTCTGGGAA. pJLU40, which encodes a Vph1-GFP fusion protein, was made by subcloning a PCR fragment composed of bp-(346–2521) of VPH1 into theNotI/BamHI sites of pPL650 using the oligonucleotides CAGCGCGGCCGCGGTTGCAGATTGAAATGTCATCACG and CCTGGATCCTGCTTGAAGCGGAAGAGCTTGCACTAGC. pJLU50, which encodes a Fth1-GFP fusion protein, was made by subcloning a PCR fragment composed of bp-(345–1396) of FTH1 into theNotI/BamHI sites of pPL650 using the oligonucleotides CAGCGCGGCCGCGTCAGCAGGAAATTACAAGCTTCCACC and CTCGAGGATCCAATTTGCTGAACCACTGCTATCAATTAT. pJLU38, which encodes a Fet5-GFP fusion protein, was made by subcloning a PCR fragment composed of bp-(232–1866) of FET5 into theNotI/BamHI sites of pPL650 using the oligonucleotides CAGCGCGGCCGCGATTCGAGTCCTCAGGTACTCAAAAGA and CCTGGATCCTGCCGCGAGAAACCTCTATTTCATTTTCAG. pJLU73, which carries the FTH1-GFP fusion gene in aLEU2-containing, centromere-based vector, was made by cotransforming pJLU50, which had been cut with PvuII along with pRS315, which had been linearized. Yeast colonies that contained the correct recombinant plasmid were identified by screening Leu+ Ura+ transformants for the presence of GFP by fluorescence microscopy. The plasmid was then rescued by selecting for ampicillin resistant E. coli transformed with genomic DNA prepared from the respective Leu+ Ura+ GFP+ yeast. pJLU61 was made by generating a PCR fragment containing a 6X-HA epitope that also had ends that overlapped the insertion site of GFP within pJLU38. This fragment was generated using the template pRCP48 (22Piper R.C. Whitters E.A. Stevens T.H. Eur. J. Cell Biol. 1994; 65: 305-318PubMed Google Scholar) with the oligos: CCACACGTTAAGGGAAATCTTGGCTGAAAATGAAATAGAGGTTTCTCGCGGCATGGATTCTATTAGATCT and AAATTATAACGTATTAAATAATATGTGAAAAAAGAGGGACACTTAGATAGGGCATGCACATAGAAGGATC. The fragment was then cotransformed with pJLU38 in which the GFP had been excised by cutting with BamHI and EcoRI. Ura+ GFP− transformants were then screened for the presence of the HA epitope by immunoblot. This procedure resulted in a plasmid, pJLU61, that encoded a Fet5 fusion protein containing the following additional amino acids prior to the stop codon: DSIRSADLGRIF (YPYDVPDYAG)3AAQCGPDLGRIF(YPYDVPDYAG)3 AAQCGPD. The predicted amino acid sequences of the Fth1-GFP, Pho8-GFP, and Fet5-HA fusion proteins were confirmed by DNA sequencing of the respective plasmids. pJLU54 was made by subcloning theBamHI/EcoRI fragment from pPL650 (encoding mutant 3 GFP) into the BamHI/EcoRI site of pGEX-3X (22Piper R.C. Whitters E.A. Stevens T.H. Eur. J. Cell Biol. 1994; 65: 305-318PubMed Google Scholar). The β-galactosidase promoter fusion constructs (pJLU65, pJLU62, pJLU68) were made by subcloning anEcoRI/BamHI-restricted PCR fragment containing the start codon and 500 bp upstream of the FTH1,FET3, and FET4 genes, respectively, into the β-galactosidase vector pSEYC102. To ensure the sequence of FTH1 was correct, we fully sequenced the FTH1 plasmid (pJLU47) and a duplicate clone (pJLU48), as well as a full-length PCR product amplified and analyzed independently. Several changes from the original sequence were noted and submitted to GenBankTM (accession number AF177330). We validated the authenticity of the various GFP constructs by complementation: Vph1-GFP could restore vacuolar acidification to avph1Δ mutant; Ste3-GFP could restore mating efficiency to a ste3Δ mutant; and GFP-PHO8 was found to traffic appropriately to the vacuole in anAPM3-dependent manner. 2J. Urbanowski, D. Swartz, and R. C. Piper, unpublished data. We tagged Fth1p with the green fluorescent protein as part of a separate study to find membrane protein markers of different subcellular compartments. Surprisingly, we found Fth1p localized to the vacuole and went on to characterize this protein further. Using a set of GFP-tagged constructs, we found that Fth1p tagged with GFP at the C terminus was clearly localized to the limiting membrane of the vacuole, where it colocalized with the endocytic tracer FM4-64 that was allowed to transit to the vacuole for 1 h (Fig. 1). Despite localization to the vacuole, these data did not necessarily indicate that Fth1p functions at the vacuole. Indeed, overexpression of many membrane proteins that function elsewhere, such as the Golgi apparatus or plasma membrane, can accumulate within the vacuole upon overexpression or upon deletion of Golgi-targeting motifs. This phenomenon is most apparent in cells lacking the vacuole proteases that allow these proteins to accumulate without degradation. Recently, it has been found that membrane proteins destined for degradation in the vacuole actually localize within the lumen of the vacuole, whereas other proteins that function at the vacuole are localized to the vacuole surface (24Ordorizzi G. Babst M. Emr S.D. Cell. 1998; 95: 847-858Abstract Full Text Full Text PDF PubMed Scopus (556) Google Scholar). Other examples of this type of intravacuolar localization of proteins destined for degradation have been found previously (25Berkower C. Loayza D. Michaelis S. Mol. Biol. Cell. 1994; 5: 1185-1198Crossref PubMed Scopus (88) Google Scholar, 26Cooper A. Bussey H. Mol. Cell. Biol. 1989; 9: 2706-2714Crossref PubMed Scopus (60) Google Scholar, 27Davis N.G. Horecka J.L. Sprague Jr., G.F. J. Cell Biol. 1993; 122: 53-65Crossref PubMed Scopus (194) Google Scholar, 28Nothwehr S.F. Roberts C.J. Stevens T.H. J. Cell Biol. 1993; 121: 1197-1209Crossref PubMed Scopus (117) Google Scholar, 29Stefan C.J. Blumer K.J. J. Biol. Chem. 1999; 274: 1835-1841Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 30Wilcox C.A. Redding K. Wright R. Fuller R.S. Mol. Biol. Cell. 1992; 3: 1371-1653Crossref Scopus (166) Google Scholar). Thus, to further examine the subcellular distribution of Fth1p, we compared the labeling pattern of Fth1-GFP to a panel of GFP fusion proteins made with either proteins known to function at the vacuole or proteins known to undergoPEP4-dependent degradation in the vacuole. This analysis was performed in a pep4 mutant strain that lacked vacuole proteases to ensure that proteins localized to the interior of the vacuole could be visualized. In the case of Fth1p, Fth1-GFP could clearly be seen on the vacuole surface in Pep+ andpep4 mutant cells, indi" @default.
• W2062435249 created "2016-06-24" @default.
• W2062435249 creator A5004382546 @default.
• W2062435249 creator A5038996626 @default.
• W2062435249 date "1999-12-01" @default.
• W2062435249 modified "2023-10-16" @default.
• W2062435249 title "The Iron Transporter Fth1p Forms a Complex with the Fet5 Iron Oxidase and Resides on the Vacuolar Membrane" @default.
• W2062435249 cites W1563689661 @default.
• W2062435249 cites W1588727306 @default.
• W2062435249 cites W1965476757 @default.
• W2062435249 cites W1969060808 @default.
• W2062435249 cites W1975190250 @default.
• W2062435249 cites W1975732513 @default.
• W2062435249 cites W1991313744 @default.
• W2062435249 cites W1996872353 @default.
• W2062435249 cites W2001818765 @default.
• W2062435249 cites W2005806732 @default.
• W2062435249 cites W2011606440 @default.
• W2062435249 cites W2012531467 @default.
• W2062435249 cites W2016067359 @default.
• W2062435249 cites W2019215631 @default.
• W2062435249 cites W2035632812 @default.
• W2062435249 cites W2038142268 @default.
• W2062435249 cites W2039192785 @default.
• W2062435249 cites W2058974266 @default.
• W2062435249 cites W2066456671 @default.
• W2062435249 cites W2068446924 @default.
• W2062435249 cites W2069044991 @default.
• W2062435249 cites W2069624943 @default.
• W2062435249 cites W2084163699 @default.
• W2062435249 cites W2088152932 @default.
• W2062435249 cites W2090401018 @default.
• W2062435249 cites W2100837269 @default.
• W2062435249 cites W2105404023 @default.
• W2062435249 cites W2105568529 @default.
• W2062435249 cites W2106392025 @default.
• W2062435249 cites W2130652548 @default.
• W2062435249 cites W2134830857 @default.
• W2062435249 cites W2319504481 @default.
• W2062435249 cites W2616345050 @default.
• W2062435249 doi "https://doi.org/10.1074/jbc.274.53.38061" @default.
• W2062435249 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10608875" @default.
• W2062435249 hasPublicationYear "1999" @default.
• W2062435249 type Work @default.
• W2062435249 sameAs 2062435249 @default.
• W2062435249 citedByCount "171" @default.
• W2062435249 countsByYear W20624352492012 @default.
• W2062435249 countsByYear W20624352492013 @default.
• W2062435249 countsByYear W20624352492014 @default.
• W2062435249 countsByYear W20624352492015 @default.
• W2062435249 countsByYear W20624352492016 @default.
• W2062435249 countsByYear W20624352492017 @default.
• W2062435249 countsByYear W20624352492018 @default.
• W2062435249 countsByYear W20624352492019 @default.
• W2062435249 countsByYear W20624352492020 @default.
• W2062435249 countsByYear W20624352492021 @default.
• W2062435249 countsByYear W20624352492022 @default.
• W2062435249 countsByYear W20624352492023 @default.
• W2062435249 crossrefType "journal-article" @default.
• W2062435249 hasAuthorship W2062435249A5004382546 @default.
• W2062435249 hasAuthorship W2062435249A5038996626 @default.
• W2062435249 hasBestOaLocation W20624352491 @default.
• W2062435249 hasConcept C104317684 @default.
• W2062435249 hasConcept C149011108 @default.
• W2062435249 hasConcept C181199279 @default.
• W2062435249 hasConcept C185592680 @default.
• W2062435249 hasConcept C38485361 @default.
• W2062435249 hasConcept C55493867 @default.
• W2062435249 hasConceptScore W2062435249C104317684 @default.
• W2062435249 hasConceptScore W2062435249C149011108 @default.
• W2062435249 hasConceptScore W2062435249C181199279 @default.
• W2062435249 hasConceptScore W2062435249C185592680 @default.
• W2062435249 hasConceptScore W2062435249C38485361 @default.
• W2062435249 hasConceptScore W2062435249C55493867 @default.
• W2062435249 hasIssue "53" @default.
• W2062435249 hasLocation W20624352491 @default.
• W2062435249 hasOpenAccess W2062435249 @default.
• W2062435249 hasPrimaryLocation W20624352491 @default.
• W2062435249 hasRelatedWork W1531601525 @default.
• W2062435249 hasRelatedWork W2319480705 @default.
• W2062435249 hasRelatedWork W2384464875 @default.
• W2062435249 hasRelatedWork W2606230654 @default.
• W2062435249 hasRelatedWork W2607424097 @default.
• W2062435249 hasRelatedWork W2748952813 @default.
• W2062435249 hasRelatedWork W2899084033 @default.
• W2062435249 hasRelatedWork W2948807893 @default.
• W2062435249 hasRelatedWork W4387497383 @default.
• W2062435249 hasRelatedWork W2778153218 @default.
• W2062435249 hasVolume "274" @default.
• W2062435249 isParatext "false" @default.
• W2062435249 isRetracted "false" @default.
• W2062435249 magId "2062435249" @default.
• W2062435249 workType "article" @default.