FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2062584615> ?p ?o ?g. }

• W2062584615 endingPage "10063" @default.
• W2062584615 startingPage "10053" @default.
• W2062584615 abstract "Stathmin is an important microtubule (MT)-destabilizing protein, and its activity is differently attenuated by phosphorylation at one or more of its four phosphorylatable serine residues (Ser-16, Ser-25, Ser-38, and Ser-63). This phosphorylation of stathmin plays important roles in mitotic spindle formation. We observed increasing levels of phosphorylated stathmin in Epstein-Barr virus (EBV)-harboring lymphoblastoid cell lines (LCLs) and nasopharyngeal carcinoma (NPC) cell lines during the EBV lytic cycle. These suggest that EBV lytic products may be involved in the regulation of stathmin phosphorylation. BGLF4 is an EBV-encoded kinase and has similar kinase activity to cdc2, an important kinase that phosphorylates serine residues 25 and 38 of stathmin during mitosis. Using an siRNA approach, we demonstrated that BGLF4 contributes to the phosphorylation of stathmin in EBV-harboring NPC. Moreover, we confirmed that BGLF4 interacts with and phosphorylates stathmin using an in vitro kinase assay and an in vivo two-dimensional electrophoresis assay. Interestingly, unlike cdc2, BGLF4 was shown to phosphorylate non-proline directed serine residues of stathmin (Ser-16) and it mediated phosphorylation of stathmin predominantly at serines 16, 25, and 38, indicating that BGLF4 can down-regulate the activity of stathmin. Finally, we demonstrated that the pattern of MT organization was changed in BGLF4-expressing cells, possibly through phosphorylation of stathmin. In conclusion, we have shown that a viral Ser/Thr kinase can directly modulate the activity of stathmin and this contributes to alteration of cellular MT dynamics and then may modulate the associated cellular processes. Stathmin is an important microtubule (MT)-destabilizing protein, and its activity is differently attenuated by phosphorylation at one or more of its four phosphorylatable serine residues (Ser-16, Ser-25, Ser-38, and Ser-63). This phosphorylation of stathmin plays important roles in mitotic spindle formation. We observed increasing levels of phosphorylated stathmin in Epstein-Barr virus (EBV)-harboring lymphoblastoid cell lines (LCLs) and nasopharyngeal carcinoma (NPC) cell lines during the EBV lytic cycle. These suggest that EBV lytic products may be involved in the regulation of stathmin phosphorylation. BGLF4 is an EBV-encoded kinase and has similar kinase activity to cdc2, an important kinase that phosphorylates serine residues 25 and 38 of stathmin during mitosis. Using an siRNA approach, we demonstrated that BGLF4 contributes to the phosphorylation of stathmin in EBV-harboring NPC. Moreover, we confirmed that BGLF4 interacts with and phosphorylates stathmin using an in vitro kinase assay and an in vivo two-dimensional electrophoresis assay. Interestingly, unlike cdc2, BGLF4 was shown to phosphorylate non-proline directed serine residues of stathmin (Ser-16) and it mediated phosphorylation of stathmin predominantly at serines 16, 25, and 38, indicating that BGLF4 can down-regulate the activity of stathmin. Finally, we demonstrated that the pattern of MT organization was changed in BGLF4-expressing cells, possibly through phosphorylation of stathmin. In conclusion, we have shown that a viral Ser/Thr kinase can directly modulate the activity of stathmin and this contributes to alteration of cellular MT dynamics and then may modulate the associated cellular processes. The microtubule (MT) 2The abbreviations used are: MTmicrotubuleEBVEpstein-Barr virusMAPmicrotubule-associated proteinLCLlymphoblastoid cell linesNPCnasopharyngeal carcinomaKSHVKaposi's sarcoma-associated herpesvirusCHPKconserved herpesviral protein kinasesGSTglutathione S-transferaseKDkinase dead. cytoskeleton is composed of tubulin heterodimers and is involved in a variety of cellular processes, such as maintaining cell polarity, supporting cell structures, segregation of chromosomes during mitosis, vesicular transportation, and cell motility. MTs undergo rapid transition between polymerized and depolymerized states and this is termed dynamic instability (1.Desai A. Mitchison T.J. Annu. Rev. Cell Dev. Biol. 1997; 13: 83-117Crossref PubMed Scopus (1954) Google Scholar, 2.Mitchison T. Kirschner M. Nature. 1984; 312: 237-242Crossref PubMed Scopus (2334) Google Scholar, 3.Schulze E. Kirschner M. Nature. 1988; 334: 356-359Crossref PubMed Scopus (145) Google Scholar). Polymerization of MT is regulated by the MT-stabilizing proteins, a classic superfamily of microtubule-associated proteins (MAPs) (4.Andersen S.S. Trends Cell Biol. 2000; 10: 261-267Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar, 5.Cassimeris L. Curr. Opin. Cell Biol. 1999; 11: 134-141Crossref PubMed Scopus (161) Google Scholar), and depolymerization of MT is regulated by two different families: the KinI family of kinesin-related-proteins (a family of MT motors) (6.Desai A. Verma S. Mitchison T.J. Walczak C.E. Cell. 1999; 96: 69-78Abstract Full Text Full Text PDF PubMed Scopus (582) Google Scholar, 7.Joshi H.C. Curr. Opin. Cell Biol. 1998; 10: 35-44Crossref PubMed Scopus (118) Google Scholar) and the MT-destabilizing proteins (a family of oncoprotein 18/stathmin proteins) (4.Andersen S.S. Trends Cell Biol. 2000; 10: 261-267Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar, 8.Belmont L.D. Mitchison T.J. Cell. 1996; 84: 623-631Abstract Full Text Full Text PDF PubMed Scopus (587) Google Scholar). Stathmin is a ubiquitous cytosolic protein and is highly conserved in vertebrates (9.Koppel J. Boutterin M.C. Doye V. Peyro-Saint-Paul H. Sobel A. J. Biol. Chem. 1990; 265: 3703-3707Abstract Full Text PDF PubMed Google Scholar, 10.Maucuer A. Moreau J. Méchali M. Sobel A. J. Biol. Chem. 1993; 268: 16420-16429Abstract Full Text PDF PubMed Google Scholar). It acts by promoting MT catastrophe (8.Belmont L.D. Mitchison T.J. Cell. 1996; 84: 623-631Abstract Full Text Full Text PDF PubMed Scopus (587) Google Scholar) or by sequestering free tubulin heterodimers (11.Howell B. Larsson N. Gullberg M. Cassimeris L. Mol. Biol. Cell. 1999; 10: 105-118Crossref PubMed Scopus (158) Google Scholar). Moreover, all above actions lead to depolymerization of MT. Phosphorylation of one to four of its N-terminal phosphorylatable residues has negative effects on stathmin (12.Lawler S. Curr. Biol. 1998; 8: R212-R214Abstract Full Text Full Text PDF PubMed Google Scholar, 13.Marklund U. Larsson N. Gradin H.M. Brattsand G. Gullberg M. EMBO J. 1996; 15: 5290-5298Crossref PubMed Scopus (248) Google Scholar, 14.Di Paolo G. Antonsson B. Kassel D. Riederer B.M. Grenningloh G. FEBS Lett. 1997; 416: 149-152Crossref PubMed Scopus (78) Google Scholar, 15.Holmfeldt P. Larsson N. Segerman B. Howell B. Morabito J. Cassimeris L. Gullberg M. Mol. Biol. Cell. 2001; 12: 73-83Crossref PubMed Scopus (56) Google Scholar) and contributes to correct assembly of the mitotic spindle and cell cycle progression during mitosis (13.Marklund U. Larsson N. Gradin H.M. Brattsand G. Gullberg M. EMBO J. 1996; 15: 5290-5298Crossref PubMed Scopus (248) Google Scholar, 16.Larsson N. Melander H. Marklund U. Osterman O. Gullberg M. J. Biol. Chem. 1995; 270: 14175-14183Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 17.Larsson N. Marklund U. Gradin H.M. Brattsand G. Gullberg M. Mol. Cell. Biol. 1997; 17: 5530-5539Crossref PubMed Scopus (169) Google Scholar, 18.Rubin C.I. Atweh G.F. J. Cell. Biochem. 2004; 93: 242-250Crossref PubMed Scopus (311) Google Scholar, 19.Holmfeldt P. Brännström K. Stenmark S. Gullberg M. Mol. Biol. Cell. 2006; 17: 2921-2930Crossref PubMed Scopus (29) Google Scholar). microtubule Epstein-Barr virus microtubule-associated protein lymphoblastoid cell lines nasopharyngeal carcinoma Kaposi's sarcoma-associated herpesvirus conserved herpesviral protein kinases glutathione S-transferase kinase dead. It is known that some viruses rely on the host cell cytoskeleton for transportation to the site of replication or to the egress progeny virions to the extracellular environment, indicating that this trafficking is essential for their infection (20.Sodeik B. Trends Microbiol. 2000; 8: 465-472Abstract Full Text Full Text PDF PubMed Scopus (251) Google Scholar, 21.Ploubidou A. Way M. Curr. Opin. Cell Biol. 2001; 13: 97-105Crossref PubMed Scopus (115) Google Scholar). Accordingly, a variety of viruses have been found to use diverse approaches to regulate cellular MTs or actin cytoskeletons (21.Ploubidou A. Way M. Curr. Opin. Cell Biol. 2001; 13: 97-105Crossref PubMed Scopus (115) Google Scholar, 22.Cudmore S. Reckmann I. Way M. Trends Microbiol. 1997; 5: 142-148Abstract Full Text PDF PubMed Scopus (135) Google Scholar). For example, adenovirus has been found to activate PKA and P38/MAPK pathways to boost MT-mediated targeting of the virus to the nucleus, and this can enhance virus infection (23.Suomalainen M. Nakano M.Y. Boucke K. Keller S. Greber U.F. EMBO J. 2001; 20: 1310-1319Crossref PubMed Scopus (198) Google Scholar). Additionally, vaccinia virus has been shown to induce the formation of actin tails and viral particles are propelled on the tips of the actin tails (24.Cudmore S. Cossart P. Griffiths G. Way M. Nature. 1995; 378: 636-638Crossref PubMed Scopus (372) Google Scholar). Moreover, several viruses encode MAP-like proteins which possess MT-stabilizing activity (25.Ploubidou A. Moreau V. Ashman K. Reckmann I. González C. Way M. EMBO J. 2000; 19: 3932-3944Crossref PubMed Scopus (147) Google Scholar, 26.Elliott G. O'Hare P. J. Virol. 1998; 72: 6448-6455Crossref PubMed Google Scholar). Apparently, various viruses exploit different strategies to target and modulate the cellular MT network during infection. However, the approaches used by Epstein-Barr virus (EBV) to regulate the MT dynamics are obscure. EBV, a human gammaherpesvirus, infects over 95% of the human population (27.Cohen J.I. N. Engl. J. Med. 2000; 343: 481-492Crossref PubMed Scopus (1292) Google Scholar, 28.Young L.S. Rickinson A.B. Nat. Rev. Cancer. 2004; 4: 757-768Crossref PubMed Scopus (1639) Google Scholar). The infection is associated with many types of malignances (27.Cohen J.I. N. Engl. J. Med. 2000; 343: 481-492Crossref PubMed Scopus (1292) Google Scholar, 28.Young L.S. Rickinson A.B. Nat. Rev. Cancer. 2004; 4: 757-768Crossref PubMed Scopus (1639) Google Scholar). Recently, increased levels of stathmin expression have been reported in EBV-infected primary B cells and in EBV transformed lymphoblastoid cell lines (LCLs) (29.Baik S.Y. Yun H.S. Lee H.J. Lee M.H. Jung S.E. Kim J.W. Jeon J.P. Shin Y.K. Rhee H.S. Kimm K.C. Han B.G. Cell Prolif. 2007; 40: 268-281Crossref PubMed Scopus (17) Google Scholar). Moreover, an EBV-encoded latent protein, LMP1, was shown to increase phosphorylation of stathmin in EBV-related nasopharyngeal carcinoma (NPC) (30.Lin X. Liu S. Luo X. Ma X. Guo L. Li L. Li Z. Tao Y. Cao Y. Int. J. Cancer. 2009; 124: 1020-1027Crossref PubMed Scopus (33) Google Scholar, 31.Yan G. Li L. Tao Y. Liu S. Liu Y. Luo W. Wu Y. Tang M. Dong Z. Cao Y. Proteomics. 2006; 6: 1810-1821Crossref PubMed Scopus (37) Google Scholar). However, the precise role of stathmin in EBV infection remains unclear. BGLF4 is the only kinase expressed by EBV during the lytic stage and it can phosphorylate a spectrum of viral and cellular factors (32.Zhu J. Liao G. Shan L. Zhang J. Chen M.R. Hayward G.S. Hayward S.D. Desai P. Zhu H. J. Virol. 2009; 83: 5219-5231Crossref PubMed Scopus (61) Google Scholar, 33.Gershburg E. Pagano J.S. Biochim. Biophys. Acta. 2008; 1784: 203-212Crossref PubMed Scopus (63) Google Scholar, 34.Kawaguchi Y. Kato K. Rev. Med. Virol. 2003; 13: 331-340Crossref PubMed Scopus (72) Google Scholar). In this study, we investigated the expression and roles of stathmin in EBV-positive cell lines. We demonstrate that BGLF4, an EBV-encoded Ser/Thr kinase, can phosphorylate and then attenuate the activity of stathmin to alter MT dynamics. EBV-positive B95.8 cells were cultured in complete RPMI 1640 medium and treated with 40 ng/ml tetradecanoyl phorbol acetate and 3 mm sodium butyrate for 72 h. Cell suspensions were centrifuged at 8,000 rpm for 30 min at 4 °C to remove the cell debris. The cell-free supernatant was ultracentrifuged at 15,000 rpm for 90 min at 4 °C. The pellet was resuspended in a volume of 1 ml of complete medium per 100 ml starting culture supernatant. The resuspended virus was then filtered through a 0.22-μm filter and stored at −80 °C until use. Peripheral blood mononuclear cells (PBMC) were isolated from blood by Ficoll-Hypaque density gradient centrifugation (Amersham Biosciences). PBMC were then cultured at 2 × 106 cells per well in 6-well plates in RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum (HyClone), 1 mml-glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin and infected with EBV B95.8 virus. P1, P7, P9, P13, P14, and P15 cell lines were LCLs established by EBV infection of PBMCs. The immortalized T lymphocyte cell line Jurkat was maintained in RPMI 1640 supplemented with 8% fetal calf serum. The HeLa cell line is derived from human cervical carcinoma, and cells are grown at 37 °C with 5% CO2 in Dulbecco's modified Eagle's medium (HyClone) supplemented with 8% fetal calf serum, 100 units/ml penicillin, and 100 μg/ml streptomycin (Invitrogen). Inducible human embryonic kidney 293 (HEK293) T-REx cells for BGLF4, BGLF4-KD, and vector expression were grown in Dulbecco's modified Eagle's medium with 8% tetracycline-free serum. These cells were derived by cloning the BGLF4 and BGLF4-KD open reading frames in pLenti4-CPO/V5/His (Invitrogen). The expression plasmids were transfected into HEK293 T-REx cells with Lipofectamine 2000 (Invitrogen) and selected in growth medium with 400 μg/ml zeocin and 5 μg/ml blasticidin, as reported previously (35.Sankar S. Chan H. Romanow W.J. Li J. Bates R.J. Cell Signal. 2006; 18: 982-993Crossref PubMed Scopus (44) Google Scholar). To induce protein expression, these cells were incubated with 10 ng/ml doxycycline (Invitrogen) for the times indicated in the figures. Expression lysates were collected in radioimmune precipitation assay buffer (RIPA, 50 mm Tris/HCl, pH 7.5, 150 mm NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with a complete protease inhibitor mixture (Roche Applied Science) and then subjected to immunoblotting. NA cells are an EBV harboring NPC cell line infected with a recombinant Akata-EBV strain carrying a neomycin-resistance gene (36.Chang Y. Tung C.H. Huang Y.T. Lu J. Chen J.Y. Tsai C.H. J. Virol. 1999; 73: 8857-8866Crossref PubMed Google Scholar). NA cells were seeded at 1 × 105 cells per well in 12-well plates and then co-transfected with pSG5-Rta (37.Chua H.H. Lee H.H. Chang S.S. Lu C.C. Yeh T.H. Hsu T.Y. Cheng T.H. Cheng J.T. Chen M.R. Tsai C.H. J. Virol. 2007; 81: 2459-2471Crossref PubMed Scopus (38) Google Scholar) and either si-BGLF4-1, si-BGLF4-2 or control siRNA fragments as described below. Cell lysates were harvested 36 h post-transfection. HeLa cells were seeded at a density of 3 × 105 cells per well in 6-well plates and transfected with 0.1, 0.3, 1, or 2.5 μg of pSG5-BGLF4 or PSG5-BGLF4-KD individually using Lipofectamine 2000. All cell lysates were harvested in RIPA buffer 24 h post-transfection. Flag-tagged expression plasmids of different UL13 homologues, such as pTAG-UL13 of herpes simplex virus type-1 (HSV-1), pTAG-UL97 of human cytomegalovirus (HCMV), and pTAG-36 of murine herpesvirus 68 (MHV68) were generated independently by cloning BamHI-KpnI viral kinase gene fragments into pTAG-attR-C1 (Invitrogen) and were kindly provided by Ren Sun (UCLA) (38.Lee C.P. Chen J.Y. Wang J.T. Kimura K. Takemoto A. Lu C.C. Chen M.R. J. Virol. 2007; 81: 5166-5180Crossref PubMed Scopus (61) Google Scholar). Flag-tagged ORF36 of Kaposi's sarcoma-associated herpesvirus (KSHV) was generated by cloning the Flag-KSHV ORF36 gene fragment into the RsrII site of pLenti4-V5 (Invitrogen) (39.Lee C.P. Huang Y.H. Lin S.F. Chang Y. Chang Y.H. Takada K. Chen M.R. J. Virol. 2008; 82: 11913-11926Crossref PubMed Scopus (95) Google Scholar). HeLa cells were seeded at a density of 3 × 105 cells per well in 6-well plates and transfected with 4 μg of either Flag-tagged plasmids of different UL13 homologues using Lipofectamine 2000 according to the manufacturer's instructions. All cell lysates were harvested in RIPA buffer 24 h post-transfection. pSG5-BGLF4 and pSG5-BGLF4-KD (K102I) are plasmids expressing wild-type BGLF4 and a BGLF4 kinase dead mutant, respectively (40.Wang J.T. Yang P.W. Lee C.P. Han C.H. Tsai C.H. Chen M.R. J. Virol. 2005; 86: 3215-3225Crossref Scopus (54) Google Scholar). The full-length stathmin cDNA, stathmin-4A, and stathmin-4E mutants, which were kindly provided by Dr. Martin Gullberg (19.Holmfeldt P. Brännström K. Stenmark S. Gullberg M. Mol. Biol. Cell. 2006; 17: 2921-2930Crossref PubMed Scopus (29) Google Scholar), were cloned in the pSG5 vector, generating pSG5-stathmin-Flag, pSG5-stathmin-4E-Flag, and pSG5-stathmin-4A-Flag. The plasmids expressing pSG5-stathmin-SAAA-Flag, pSG5-stathmin-ASAA-Flag, pSG5-stathmin-AASA-Flag, and pSG5-stathmin-AAAS-Flag were generated using a single primer-based in vitro mutagenesis strategy (41.Makarova O. Kamberov E. Margolis B. BioTechniques. 2000; 29: 970-972Crossref PubMed Scopus (196) Google Scholar) with primers primer-SASS gcttttgagctgattctcgcccctcggtcaaaagaa, primer-SSAS tccagaattcccccttgcccctccaaa gaagaa, primer-SAAA ctggagaagcgtgcctcaggccaggcttttg and primer AAAS gaagaaagacgcaagtcccatgaagctgagg. The plasmids generated are pSG5-stathmin-SAAA-Flag (Ser-25, -38, and -63 were replaced by alanine), pSG5-stathmin-ASAA-Flag (Ser-16, -38, and -63 were replaced by alanine), pSG5-stathmin-AASA-Flag (Ser-16, -25, and -63 were replaced by alanine) and pSG5-stathmin-AAAS-Flag (Ser-16, -25, and -38 were replaced by alanine). To purify GST-tagged stathmin and its mutants, the cDNAs from pSG5-stathmin-Flag and pSG5-stathmin mutants were further subcloned to the Escherichia coli expression plasmid, pGEX-4T-1, with an N-terminal GST tag. The plasmids generated are pGEX-4T1-stathmin-Flag, pGEX-4T1-stathmin-SAAA-Flag, pGEX-4T1-stathmin-ASAA-Flag, pGEX-4T1-stathmin-AASA-Flag, and pGEX-4T1-stathmin-AAAS-Flag. The RNA fragments targeting the expression of BGLF4 were purchased from Invitrogen, including si-BGLF4-1 (5′-CCCUCUAUGUAAAGCUGCCGGAGAA), si-BGLF4-2 (5′-UGGGUAGGCUGGUCCUGACUGAUUA) and a control siRNA fragment (5′-CCCGUAUAAAUGUCGGGCCACUGAA) (42.Wang J.T. Doong S.L. Teng S.C. Lee C.P. Tsai C.H. Chen M.R. J. Virol. 2009; 83: 1856-1869Crossref PubMed Scopus (100) Google Scholar). HeLa cells were seeded at a density of 90% in 10-cm Petri dishes and co-transfected with 7 μg of pSG5-BGLF4 and 7 μg of pSG5-stathmin-Flag with Lipofectamine 2000. At 18 h post-transfection, cell lysates were collected in Nonidet P-40 lysis buffer 50 mm Tris, pH 8.0, 150 mm NaCl, 2 mm EDTA, and 1 mm Na3VO4). Cell lysates were centrifuged at 16,000 × g for 20 min at 4 °C, and then the supernatant was precleared with 200 μl of 20% protein G-Sepharose beads (Amersham Biosciences) with rotation for 1 h at 4 °C. After centrifugation, the precleared supernatant was incubated with 3 μg of anti-BGLF4 (40.Wang J.T. Yang P.W. Lee C.P. Han C.H. Tsai C.H. Chen M.R. J. Virol. 2005; 86: 3215-3225Crossref Scopus (54) Google Scholar), anti-Flag M2 mAb (Sigma), or irrelevant control antibodies (mIgG) at 4 °C for 1 h and then 250 μl of protein G-Sepharose beads were added to precipitate the immunocomplexes with rotation for 1 h at 4 °C. The recovered immunocomplexes were washed extensively in cold phosphate-buffered saline and resolved with sodium dodecyl sulfate (SDS) sample buffer, and subjected to immunoblotting analysis. HeLa cells were also transfected with 10 μg of pSG5-BGLF4, and lysates were subjected to co-immunoprecipitation as described above. The anti-stathmin polyclonal Ab (Santa Cruz Biotechnology) was used to precipitate the endogenous stathmin. Cell lysates were resolved by SDS-polyacrylamide gel electrophoresis and further transferred to Hybond-C Extra membranes (Amersham Biosciences). The membranes were incubated with 5% nonfat dry milk and the primary antibodies (Abs) used were anti-BGLF4 (2224 or 2216 clones) mAbs (40.Wang J.T. Yang P.W. Lee C.P. Han C.H. Tsai C.H. Chen M.R. J. Virol. 2005; 86: 3215-3225Crossref Scopus (54) Google Scholar), anti-EBNA2 mAb (43.Young L. Alfieri C. Hennessy K. Evans H. O'Hara C. Anderson K.C. Ritz J. Shapiro R.S. Rickinson A. Kieff E. N. Engl. J. Med. 1989; 321: 1080-1085Crossref PubMed Scopus (609) Google Scholar), anti-GAPDH mAb (Biodesign), anti-stathmin polyclonal Ab (Calbiochem), anti-phosphorylated Ser-16 stathmin polyclonal Ab (Santa Cruz Biotechnology), anti-Flag M2 mAb (Sigma), anti-Zta mAb (44.Tsai C.H. Liu M.T. Chen M.R. Lu J. Yang H.L. Chen J.Y. Yang C.S. J. Biomed. Sci. 1997; 4: 69-77Crossref PubMed Scopus (39) Google Scholar), and anti-Rta mAb (45.Hsu T.Y. Chang Y. Wang P.W. Liu M.Y. Chen M.R. Chen J.Y. Tsai C.H. J. Virol. 2005; 86: 317-322Crossref Scopus (26) Google Scholar). After hybridization with secondary antibodies, the membranes were developed using an enhanced chemiluminescence kit (Amersham Biosciences). ImageQuant software was used to quantify the expression levels of the proteins detected by immunoblotting. Briefly, the value of the band density was quantified and then normalized to its corresponding internal control. Then, the results were shown relative to vector transfectant or cell line of interest. BGLF4, BGLF4-KD and vector control inducible HEK 293 T-REx cells were grown in Dulbecco's modified Eagle's medium with 8% tetracycline-free serum and protein expression was induced by incubation with 10 ng/ml doxycycline for 24 h. Total lysates from BGLF4, BGLF4-KD or vector control cells were collected in two-dimensional lysis buffer (40 mm Tris, 7 m urea, 2 m thiourea, 4% CHAOS, pH 9) and subjected to two-dimensional PAGE according to the manufacturer's instructions. Briefly, isoelectric focusing was carried out using pH 3–10 carrier ampholytes and separated in 12.5% polyacrylamide gels. After electrophoresis, proteins were transferred to polyvinylidene difluoride membranes (Millipore) and probed with anti-stathmin polyclonal Ab or anti-phosphorylated Ser-16 stathmin polyclonal Ab. After hybridization with secondary antibodies, the membranes were developed using an enhanced chemiluminescence kit (Amersham Biosciences). Wild-type stathmin (pGEX-4T1-stathmin-Flag) and stathmin mutated at specific serine residues (pGEX-4T1-stathmin-SAAA-Flag, pGEX-4T1-stathmin-ASAA-Flag, pGEX-4T1-stathmin-AASA-Flag, and pGEX-4T1-stathmin-AAAS-Flag) were transformed to E. coli and then treated with isopropylthio-β-d-galactoside (IPTG) to induce recombinant protein expression. The recombinant proteins were purified with glutathione-Sepharose according to the manufacturer's instructions (Amersham Biosciences). BGLF4 kinase assay was performed according to a previous report (38.Lee C.P. Chen J.Y. Wang J.T. Kimura K. Takemoto A. Lu C.C. Chen M.R. J. Virol. 2007; 81: 5166-5180Crossref PubMed Scopus (61) Google Scholar). For in vitro kinase assays, immunoprecipitates of BGLF4 or BGLF4-KD were incubated in 30 μl of kinase buffer containing 25 μm ATP, 2.5 μCi of [γ-32P]ATP, and 2 μg of GST-stathmin-Flag. All mixtures were incubated at 30 °C for 30 min and then the reactions stopped by adding 10 μl of sample buffer (50 mm Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 1% β-mercaptoethanol, 12.5 mm EDTA, and 0.02% bromphenol blue) and heating at 95 °C for 5 min. Thereafter, all samples were subjected to immunoblotting and autoradiography. The other stathmin mutants, as well as the positive control protein, Histone H1, and negative control protein, GST protein, were used as substrates in similar experiments to those described above. Slide-cultured HeLa cells were transfected with 5 μg or 10 μg of pSG5 vector, pSG5-BGLF4, pSG5-BGLF4-KD, pSG5-stathmin-4E-Flag, pSG5-stathmin-4A-Flag, or pSG5-stathmin-Flag using Lipofectamine 2000. Twenty-four hours after transfection, cells were fixed in 4% paraformaldehyde at room temperature for 20 min. Fixed slides were washed in phosphate-buffered saline (145 mm NaCl, 1.56 mm Na2HPO4, 1 mm KH2PO4, pH 7.2) and then permeabilized by 0.1% Triton X-100 at room temperature for 5 min. Fixed cells were then stained with rabbit anti-BGLF4 polyclonal Ab (1:100) (40.Wang J.T. Yang P.W. Lee C.P. Han C.H. Tsai C.H. Chen M.R. J. Virol. 2005; 86: 3215-3225Crossref Scopus (54) Google Scholar), mouse anti-Flag M2 Ab (1:250) or rabbit polyclonal to beta tubulin Ab (1:200) (Abcam) at 37 °C for 1.5 h. After washing with phosphate-buffered saline three times, slides were incubated with rhodamine-conjugated or fluorescein isothiocyanate (FITC)-conjugated anti-rabbit IgG (Cappel) or anti-mouse IgG antibodies (Cappel) at 37 °C for 1 h. DNA was stained by Hoechst 33258 at room temperature for 90 s, and slides were observed by fluorescence microscopy (Zeiss). Statistical analyses employed the correlation coefficient, Student's t test, and 2 × 2 Contingency Table of chi-squared test using Microsoft EXCEL. Briefly, the expression levels of BGLF4, phosphorylated and nonphosphorylated stathmin in twenty LCLs were quantified as described above. The correlation coefficients between levels of BGLF4 and stathmin (either phosphorylated or nonphosphorylated) were calculated separately. Student's t test was used to compare the treated samples with the corresponding controls. To test whether any EBV products affect the activity of stathmin, we compared the results from LCL cells with and without spontaneous lytic cycle progression. Six representative LCLs are shown in Fig. 1A. All LCL lines expressed the EBV latent protein, EBNA2. In addition, expression of the EBV lytic kinase BGLF4 was observed clearly in Zta-expressing LCLs, including P1, P9, P13, and P14, but not in P15 or P7. Based on the relative density of total phosphorylated stathmin, levels of phosphorylated stathmin were apparently correlated with viral lytic protein expression, compared with lower or non-lytic protein-expressing cell lines (P15 and P7 cells). This suggests that stathmin phosphorylation might be regulated by EBV-lytic products. BGLF4 is the only EBV-encoded serine/threonine kinase and has a similar biological function to the cellular cdc2 kinase (33.Gershburg E. Pagano J.S. Biochim. Biophys. Acta. 2008; 1784: 203-212Crossref PubMed Scopus (63) Google Scholar, 34.Kawaguchi Y. Kato K. Rev. Med. Virol. 2003; 13: 331-340Crossref PubMed Scopus (72) Google Scholar), which is a protein kinase for stathmin (46.Luo X.N. Mookerjee B. Ferrari A. Mistry S. Atweh G.F. J. Biol. Chem. 1994; 269: 10312-10318Abstract Full Text PDF PubMed Google Scholar, 47.Marklund U. Osterman O. Melander H. Bergh A. Gullberg M. J. Biol. Chem. 1994; 269: 30626-30635Abstract Full Text PDF PubMed Google Scholar). Thus, the correlation coefficient was calculated between levels of BGLF4 and phosphorylated and nonphosphorylated stathmin from twenty LCLs in total (data not shown). Levels of BGLF4 and phosphorylated stathmin are positively correlated (the correlation coefficient is 0.59); whereas levels of BGLF4 and nonphosphorylated stathmin are not correlated (the correlation coefficient is 0.12). To determine whether stathmin is hyper-phosphorylated and can act as a substrate of BGLF4, an IFA was performed in P1, P7, and P13 cells. In Fig. 1B, increasing fluorescent intensity of phosphorylated stathmin was observed in BGLF4-positive cells, compared with BGLF4-negative cells. To verify the importance of BGLF4 presence for stathmin phosphorylation, especially in reactivated EBV-positive cells, BGLF4 expression was knocked down in Rta-induced EBV-harboring NA cells. In Fig. 1C, the phosphorylation of stathmin was increased in NA cells with EB viral lytic cycle progression (lanes 1 and 2). However, the phosphorylation was abolished when BGLF4 expression was knocked down by siRNA (Fig. 1C, lanes 3 and 4). These data indicate that BGLF4 could be the protein responsible for stathmin phosphorylation during viral lytic cycle. As mentioned above, BGLF4 contributes to stathmin phosphorylation during EBV lytic cycle. Next, we used doxycycline-induced BGLF4-expressing 293 cells to confirm the effects of BGLF4 on phosphorylation of stathmin. In Fig. 2A, increasing phosphorylation of stathmin was clearly observed by following BGLF4 expression at 18, 24, 30, and 48 h, compared with the non-induction controls. In contrast, expression of BGLF4-kinase dead (KD) protein, which has a point mutation in the kinase domain of BGLF4, did not increase the phosphorylation of stathmin (Fig. 2B). Thus, this experiment demonstrated that BGLF4 expression is associated with stathmin phosphorylation. Moreover, comparing non-doxycycline-treated cells across all the time points for the level of phosphorylated stathmin (Fig. 2, A and B), we found a cell-cycle dependent increase in stathmin phosphorylation. This finding is reasonable because stathmin is known to be cell cycle-regulated (16.Larsson N. Melander H. Marklund U. Osterman O. Gullberg M. J. Biol. Chem. 1995; 270: 14175-14183Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 46.Luo X.N. Mookerjee B. Ferrari A. Mistry S. Atweh G.F. J. Biol. Chem. 1994; 269: 10312-10318Abstract Full Text PDF PubMed Google Scholar, 48.Brattsand G. Marklund U. Nylander K. Roos G. Gullberg M. Eur. J. Biochem./FEBS. 1994; 220: 359-368Crossref PubMed Scopus (100) Google Scholar). Further, as shown in Fig. 2C, phosphorylation of stathmin increased with BGLF4 expression in a dose-dependent manner. Again, BGLF4-KD expression did not affect the phosphorylation of stathmin (Fig. 2D). Taken together, the EBV-encoded BGLF4 kinase can mediate stathmin phosphorylation in vivo. Based on the kinase dead data above and the fact that several cellular proteins are the" @default.
• W2062584615 created "2016-06-24" @default.
• W2062584615 creator A5000016808 @default.
• W2062584615 creator A5003872931 @default.
• W2062584615 creator A5021070959 @default.
• W2062584615 creator A5036375505 @default.
• W2062584615 creator A5054338507 @default.
• W2062584615 creator A5076128300 @default.
• W2062584615 creator A5081352628 @default.
• W2062584615 creator A5087224613 @default.
• W2062584615 date "2010-03-01" @default.
• W2062584615 modified "2023-10-17" @default.
• W2062584615 title "Regulation of Microtubule Dynamics through Phosphorylation on Stathmin by Epstein-Barr Virus Kinase BGLF4" @default.
• W2062584615 cites W10039931 @default.
• W2062584615 cites W1494730114 @default.
• W2062584615 cites W1523498832 @default.
• W2062584615 cites W1533239574 @default.
• W2062584615 cites W1570207075 @default.
• W2062584615 cites W1578954095 @default.
• W2062584615 cites W1650752673 @default.
• W2062584615 cites W169449544 @default.
• W2062584615 cites W1720083525 @default.
• W2062584615 cites W1788328870 @default.
• W2062584615 cites W1965404941 @default.
• W2062584615 cites W1974007194 @default.
• W2062584615 cites W1974817469 @default.
• W2062584615 cites W1978811057 @default.
• W2062584615 cites W1979073036 @default.
• W2062584615 cites W1983429157 @default.
• W2062584615 cites W1986393243 @default.
• W2062584615 cites W1994737830 @default.
• W2062584615 cites W1997058261 @default.
• W2062584615 cites W1997868773 @default.
• W2062584615 cites W2004668555 @default.
• W2062584615 cites W2009785870 @default.
• W2062584615 cites W2016548488 @default.
• W2062584615 cites W2019395700 @default.
• W2062584615 cites W2021275530 @default.
• W2062584615 cites W2022088323 @default.
• W2062584615 cites W2032432138 @default.
• W2062584615 cites W2032733101 @default.
• W2062584615 cites W2036105845 @default.
• W2062584615 cites W2041770125 @default.
• W2062584615 cites W2041884525 @default.
• W2062584615 cites W2041931901 @default.
• W2062584615 cites W2042325333 @default.
• W2062584615 cites W2052824237 @default.
• W2062584615 cites W2054118753 @default.
• W2062584615 cites W2054971075 @default.
• W2062584615 cites W2062729499 @default.
• W2062584615 cites W2072240684 @default.
• W2062584615 cites W2072945014 @default.
• W2062584615 cites W2073057352 @default.
• W2062584615 cites W2075461209 @default.
• W2062584615 cites W2091745161 @default.
• W2062584615 cites W2104063044 @default.
• W2062584615 cites W2110609296 @default.
• W2062584615 cites W2121353617 @default.
• W2062584615 cites W2121384249 @default.
• W2062584615 cites W2122397436 @default.
• W2062584615 cites W2122883736 @default.
• W2062584615 cites W2125058717 @default.
• W2062584615 cites W2133857016 @default.
• W2062584615 cites W2135329719 @default.
• W2062584615 cites W2135718396 @default.
• W2062584615 cites W2152552596 @default.
• W2062584615 cites W2157319245 @default.
• W2062584615 cites W2157711753 @default.
• W2062584615 cites W2162530599 @default.
• W2062584615 cites W2163591703 @default.
• W2062584615 cites W2170986289 @default.
• W2062584615 cites W2522939951 @default.
• W2062584615 cites W6664855 @default.
• W2062584615 doi "https://doi.org/10.1074/jbc.m109.044420" @default.
• W2062584615 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2843168" @default.
• W2062584615 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/20110360" @default.
• W2062584615 hasPublicationYear "2010" @default.
• W2062584615 type Work @default.
• W2062584615 sameAs 2062584615 @default.
• W2062584615 citedByCount "30" @default.
• W2062584615 countsByYear W20625846152012 @default.
• W2062584615 countsByYear W20625846152013 @default.
• W2062584615 countsByYear W20625846152014 @default.
• W2062584615 countsByYear W20625846152015 @default.
• W2062584615 countsByYear W20625846152016 @default.
• W2062584615 countsByYear W20625846152017 @default.
• W2062584615 countsByYear W20625846152018 @default.
• W2062584615 countsByYear W20625846152019 @default.
• W2062584615 countsByYear W20625846152021 @default.
• W2062584615 countsByYear W20625846152023 @default.
• W2062584615 crossrefType "journal-article" @default.
• W2062584615 hasAuthorship W2062584615A5000016808 @default.
• W2062584615 hasAuthorship W2062584615A5003872931 @default.
• W2062584615 hasAuthorship W2062584615A5021070959 @default.
• W2062584615 hasAuthorship W2062584615A5036375505 @default.
• W2062584615 hasAuthorship W2062584615A5054338507 @default.
• W2062584615 hasAuthorship W2062584615A5076128300 @default.
• W2062584615 hasAuthorship W2062584615A5081352628 @default.

• next