SemOpenAlex |

SemOpenAlex

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2062972082> ?p ?o ?g. }

Showing items 1 to 86 of 86 with 100 items per page.

W2062972082 endingPage "12082" @default.
W2062972082 startingPage "12076" @default.
W2062972082 abstract "Transcription of the gene encoding for the nuclear autoantigen La resulted in La mRNA isoforms. A promoter switching combined with an alternative splicing pathway replaced the exon 1 with the exon 1′. The exon 1′ contained GC-rich regions and an oligo(U) tail of 23 uridine residues. Moreover, it encoded for three open reading frames upstream of the La protein reading frame. Despite this unusual structure, when exon 1′ La mRNAs were expressed in transfected cells, both exon 1 and 1′ La mRNAs were translated to La protein, whereas the upstream open reading frames of the exon 1′ were not translated. In addition to full-length exon 1′ La mRNAs 5′-shortened exon 1′ La mRNAs were detected. The exon 1′ 5′-starts varied in dependence on the analyzed tissues. Like the full-length exon 1′ La mRNA a 5′-shortened exon 1′ construct starting downstream of the oligo(U) tail but upstream of the open reading frames 2 and 3 was also well translated when transfected in mouse cells. Thus all La mRNA forms represent functional La mRNAs. Transcription of the gene encoding for the nuclear autoantigen La resulted in La mRNA isoforms. A promoter switching combined with an alternative splicing pathway replaced the exon 1 with the exon 1′. The exon 1′ contained GC-rich regions and an oligo(U) tail of 23 uridine residues. Moreover, it encoded for three open reading frames upstream of the La protein reading frame. Despite this unusual structure, when exon 1′ La mRNAs were expressed in transfected cells, both exon 1 and 1′ La mRNAs were translated to La protein, whereas the upstream open reading frames of the exon 1′ were not translated. In addition to full-length exon 1′ La mRNAs 5′-shortened exon 1′ La mRNAs were detected. The exon 1′ 5′-starts varied in dependence on the analyzed tissues. Like the full-length exon 1′ La mRNA a 5′-shortened exon 1′ construct starting downstream of the oligo(U) tail but upstream of the open reading frames 2 and 3 was also well translated when transfected in mouse cells. Thus all La mRNA forms represent functional La mRNAs. One of the target antigens of sera suffered from autoimmune patients with rheumatoid diseases such as systemic lupus erythematosus or primary Sjögren's syndrome (pSS) 1The abbreviations used are: pSS, primary Sjögren's syndrome; PBL, peripheral blood lymphocyte; ORF, open reading frame; DMEM, Dulbecco's modified Eagle's medium; mAb, monoclonal antibody; PCR, polymerase chain reaction; RACE, rapid amplification of cDNA ends; UAP, universal amplification primer; FCS, fetal calf serum; PBS, phosphate-buffered saline; cLSM, confocal laser scanning microscopy; PAGE, polyacrylamide gel electrophoresis; GST, glutathione S-transferase. is the nuclear autoantigen La (SS-B) (1Tan E.M. Adv. Immunol. 1989; 44: 93-151Google Scholar). The La protein was described to associate at least transiently with all primary RNA polymerase III transcripts including precursor molecules of ribosomal 5 S RNA, tRNAs, and some 4.5 S RNAs, as well as a portion of the uridine-rich small nuclear RNAs U1 and U6 (2Hendrick J.P. Wolin S. Rinke J. Lerner M. Steitz J. Mol. Cell. Biol. 1981; 12: 1138-1149Google Scholar, 3Madore S.J. Wieben E.D. Pederson T. J. Biol. Chem. 1984; 259: 1929-1933Google Scholar, 4Rinke J. Steitz J.A. Nucleic Acids Res. 1985; 13: 2617-2629Google Scholar, 5Stefano J.E. Cell. 1984; 36: 145-154Google Scholar). Common to all primary RNA polymerase III transcripts is their 3′-terminal oligo(U) tail, which is transcribed during the transcription termination step. These oligo(U) tails were shown to be a binding site for the La protein (6Pruijn G.J.M. Slobbe R.L. van Venrooij W.J. Mol. Biol. Rep. 1990; 14: 43-48Google Scholar). In addition to the oligouridylated RNA polymerase III transcripts, an association of the La protein with some nonoligouridylated RNAs has been reported especially for some viral RNAs including the leader RNAs of the vesicular stomatitis virus and rabies virus (7Wilusz J. Kurilla M.G. Keene J.D. Proc. Natl. Acad. Sci. U. S. A. 1983; 80: 5827-5831Google Scholar, 8Kurilla M.G. Cabradilla C.D. Holloway B.P. Keene J.D. J. Virol. 1984; 50: 773-778Google Scholar). The La protein is assumed to be involved in transcription termination of RNA polymerase III and internal initiation of translation of at least the poliovirus mRNA (9Gottlieb E. Steitz J.A. EMBO J. 1989; 8: 841-850Google Scholar, 10Gottlieb E. Steitz J.A. EMBO J. 1989; 8: 851-861Google Scholar, 11Meerovitch K. Svitkin Y.V. Lee H.S. Leibkowicz F. Kenan D. Chan E.K.L. Agol V.I. Keene J.D. Sonenberg N.J. J. Virol. 1993; 67: 3798-3807Google Scholar, 12Bachmann M. Pfeifer K. Schröder H.C. Müller W.E.G. Cell. 1990; 60: 85-93Google Scholar). Most recently five La cDNAs were isolated when a cDNA library made from peripheral blood lymphocytes (PBLs) of a patient with pSS was screened with her own anti-La serum (13Tröster H. Metzger T.E. Semsei I. Schwemmle M. Winterpacht A. Zabel B. Bachmann M. J. Exp. Med. 1994; 180: 2059-2067Google Scholar). In two of these five La cDNAs the exon 1 was replaced with an alternative 5′-end. Genomic analysis revealed that these La cDNAs represented alternatively spliced transcripts of the La gene. An additional promoter site was identified in the intron between exons 1 and 2, which served as initiation site for transcription of the alternative exon 1′. The exon 1′ La mRNA form had an unusual 5′ terminus. It contained GC-rich regions and an oligo(U) tail of 23 uridine residues and encoded for three upstream open reading frames (ORF1 to 3). The ORF1 encoded for a putative peptide of 5.4 kDa. It was interrupted from the La protein reading frame by two stop codons. The ORF2 and ORF3 were not in the reading frame of the La protein. Qualitative and quantitative analysis of expression of the exon 1 and exon 1′ La mRNAs showed that both La mRNA forms represented finally processed abundant cytoplasmic mRNAs. Exon 1 to exon 1′ La mRNAs were expressed at ratios between 1:1 and 1:5 (15Hilker M. Tröster H. Grölz D. Hake U. Bachmann M. Cell Tissue Res. 1996; 284: 383-389Google Scholar, 16Bachmann M. Hilker M. Grölz D. Tellmann G. Hake U. Kater L. deWilde P. Tröster H. J. Autoimmunity. 1996; 9: 757-766Google Scholar). Due to the unusual structure of the exon 1′ La mRNA it still remained unclear whether the exon 1′ La mRNA is a translatable mRNA and if so, which of the reading frames is used for translation. This was of special interest because one of the exon 1′ La cDNAs contained a frameshift mutation in a recently detected hot spot region in the exon 7 of the La gene (14Bachmann M. Bartsch H. Tröster H. Grölz D. J. Autoimmunity. 1996; 9: 747-756Google Scholar). The frameshift mutation caused a premature stop codon in the La protein reading frame. Thus the mutant exon 1′ La mRNA could encode for a C-terminally truncated mutant La peptide of 29 kDa. Here we present evidence that exon 1′ La mRNAs can be translated to La protein, whereas the upstream ORFs are not used for translation. The following materials were obtained:BstEII, EcoO109, EcoRI,KpnI, pGEX-2T, and T7-sequencing kit from Pharmacia Biotech Inc. (Freiburg, Germany); SalI, NheI, andNcoI from MBI Fermentas (St. Leon-Rot, Germany); QIAprep-spin kit and QIAEX were from Qiagen (Hilden, Germany); DMEM, Opti-MEM medium, LipofectAMINE, and Taq polymerase from Life Technologies, Inc. (Eggenstein, Germany); BglII,Pfu polymerase, pBluescript SK(−) from Stratagene GmbH (Heidelberg, Germany); CDP-Star Tropix, pCI-neo, pCI, and pGEM-T vector systems from Promega (Serva, Heidelberg, Germany); shrimp alkaline phosphatase, BstXI, HindIII, Taqbuffer (10 ×), DNA molecular weight marker VI, blocking reagent from Boehringer Mannheim (Mannheim, Germany); agarose and NuSieve-agarose from Biozym (Hameln, Germany); anti-mouse IgG conjugated with peroxidase developed in sheep ((Fab′)2 fragments) adsorbed with human serum proteins, anti-human and anti-rabbit IgG-conjugated with alkaline phosphatase, and isopropyl β-d-thiogalactopyranoside from Sigma; the ECL-Western blotting detection reagents from Amersham-Buchler (Braunschweig, Germany); 4-nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphate from Roth (Karlsruhe, Germany); and polyvinylidene difluoride membrane (IPVH 000 10; pore size 0.45 μm) obtained from Millipore (Bedford, MA, U. S. A.). The anti-La mAb SW5, which was found to be directed to the N-terminal domain of La protein (17Pruijn G.J.M. Thijssen J.P.H. Smith P.R. Williams D.G. vanVenrooij W.J. Eur. J. Biochem. 1995; 232: 611-619Google Scholar), was originally described by Smith et al. (18Smith P.R. Williams D.G. Venables P.J.W. Maini R.N. J. Immunol. Methods. 1985; 77: 63-69Google Scholar). The hybridoma supernatant was kindly provided by Prof. vanVenrooij (University of Nijmegen, The Netherlands). As anti-La serum we used the serum of the patient (Ma) (12Bachmann M. Pfeifer K. Schröder H.C. Müller W.E.G. Cell. 1990; 60: 85-93Google Scholar). PCR was performed using a TC9600 Cycler (Perkin-Elmer, Überlingen, Germany). The 50-μl assay in 1 × Taq buffer contained 2 units Taqpolymerase, 1.5 mm MgCl2, 5% (v/v) Me2So, 200 μm dNTP, 20 pmol of each primer, and 1 ng of DNA. Cycling was started by heating for 3 min to 95 °C. 40 cycles followed, each consisting of 15 s at 94 °C, 15 s at 57 °C, and 1 min at 72 °C. Then the temperature was held for 10 min at 72 °C and cooled down to 4 °C. The PCR products were further analyzed by agarose gel electrophoresis. PCR fragments were visualized by ethidium bromide staining. Isolated PCR fragments were either directly sequenced or sequenced after subcloning into pGEM-T (13Tröster H. Metzger T.E. Semsei I. Schwemmle M. Winterpacht A. Zabel B. Bachmann M. J. Exp. Med. 1994; 180: 2059-2067Google Scholar). DNA was prepared using the QIAprep-spin kit and concentrated by ethanol precipitation to a final concentration of about 1 μg/μl in Tris-EDTA buffer (10 mm Tris, 1 mm EDTA, pH 8.3). DNA sequencing was performed as described previously (13Tröster H. Metzger T.E. Semsei I. Schwemmle M. Winterpacht A. Zabel B. Bachmann M. J. Exp. Med. 1994; 180: 2059-2067Google Scholar). For an analysis of the 5′-ends of the La mRNAs we chose the 5′-rapid amplification of cDNA ends system (5′-RACE) supplied by Life Technologies, Inc. It includes a first strand cDNA synthesis and a PCR amplification step. During reverse transcription 40 units of RNase inhibitor were added to each 1-μg RNA sample. The RNA samples were isolated from either (adult) liver (L) of the tumor patient, human fetal spleen (20th week), PBLs of the patient with pSS, and PBLs of a (adult) control person, and mouse LTA cells, which were untransfected or transfected with the human either La gene or La exon 1 La cDNA (19Chambers J.C. Kenan D. Martin B.J. Keene J.D. J. Biol. Chem. 1988; 263: 18043-18051Google Scholar). Although the liver tissue of the tumor patient did not obviously show metastasis, the tissue displayed an abundant expression of the c-myc oncogene (data not shown). The RNA was isolated as described earlier (13Tröster H. Metzger T.E. Semsei I. Schwemmle M. Winterpacht A. Zabel B. Bachmann M. J. Exp. Med. 1994; 180: 2059-2067Google Scholar). The reactions and the following 5′-RACE steps were performed according to the instructions of the supplier. For the first strand synthesis the primer P1 locating within the exon 4 was used (P1, CACTGATTTCCATGAGTTCTGCCTTGG). This primer was extracted with phenol/chloroform and diluted in diethyl pyrocarbonate-treated bidistilled water. The first amplification was performed using the Anchor primer of the supplier as upstream primer and the primer P2 locating in the exon 3 (P2, TGTCCCGTGGCAAATTGAAGTCGCC) as downstream primer. The cDNA synthesis and the first amplification step is schematically summarized in Fig. 2(S). The cDNAs were further amplified using nested primer pairs. The nested primer pairs consisted of the common downstream exon 2 primer P3 (P3, GATGACAGATTTTGGCCTCCAG) in combination with either the exon 1 specific upstream primer P4 (P4, GAGTCGTTGCTGTTGCTGTTTG) or the exon 1′ specific upstream primer P5 (P5, TTCTAGTCTCACCGAAGGCTTGTG) (see also Fig. 2 (A1). Alternatively the cDNAs were amplified using a combination of the universal amplification primer (UAP) of the supplier with either the exon 1′ specific downstream primer P6 (P6, CTGAAACCTGATGTGAGCGATG) or the exon 1 specific downstream primer P7 (P7, CCACAGGCTCACAAACAGCAAC) as schematically summarized in Figs. 2(B1) and 3 (S). All exon 1 and 1′ constructs were cloned in the two transfection vectors pCI-neo and pCI according to the following strategy. Cloning started from the La cDNA La23 in pBluescript SK(−). The La insert in La23 started at the 5′-site with an oligo(dT) tail and represented a 5′-shortened exon 1′ La mRNA derivative. Therefore, in a first step an exon 1′ full-length La cDNA had to be constructed. In parallel an exon 1 full-length La cDNA was constructed. Because La23 started at the 5′ terminus with 51 dT residues, this irregular oligo(dT) tail was shortened to 5 dT residues to obtain the 5′-shortened exon 1′ construct. During cloning we learned that La23 contained a frameshift mutation within the coding region (Ref. 14Bachmann M. Bartsch H. Tröster H. Grölz D. J. Autoimmunity. 1996; 9: 747-756Google Scholar; see also Fig. 6, ORF1 La(N)). Because all constructs were derivatives of La23, in a further cloning step the mutated reading frame was replaced with the correct reading frame, which was obtained from the La cDNA La19. For the first step of the cloning procedure 5′-exon 1′ and 5′-exon 1 fragments were required and prepared by PCR using the proofreadingPfu polymerase. In the case of the exon 1′ fragment, PCR was performed using DNA of a genomic subclone as substrate. The subclone was prepared from the charon phage Lambda 2.1 (19Chambers J.C. Kenan D. Martin B.J. Keene J.D. J. Biol. Chem. 1988; 263: 18043-18051Google Scholar), which was a gift by Prof. J. D. Keene (Duke University, Durham, NC). Restriction of Lambda 2.1 DNA with EcoRI resulted in a 4.4- and a 4.6-kilobase fragment. The 4.6-kilobase EcoRI fragment was isolated and subcloned into pBluescript SK(−). This subclone contained besides the exons 1 and 2 the intron between exons 1 and 2 including the exon 1′. PCR was performed using as upstream primer P8 (P8, CGCTTTACTAGTGCGCGACTGCGCGTTTCC; the artificialSpeI site is underlined) and as downstream primer P6. The resulting exon 1′ fragment started at the predicted 5′-start of exon 1′ (13Tröster H. Metzger T.E. Semsei I. Schwemmle M. Winterpacht A. Zabel B. Bachmann M. J. Exp. Med. 1994; 180: 2059-2067Google Scholar) and ended downstream of an EcoO109 site, which located downstream of the oligo(dT) stretch in the La sequence. The exon 1′ fragments were cleaved with SpeI and EcoO109 and cloned into the respective sites of La23. For this purpose La23 was linearized with SpeI, and the isolated DNA was partially digested with EcoO109. Despite using Pfupolymerase a series of clones had to be characterized, because the vaste majority of clones had an incorrect length of dT residues in the oligo(dT) tail ranging from 14 to 28 residues. Finally a single clone was isolated with the correct length of 23 dT residues. The 5′-exon 1 fragment was obtained as follows. As substrate we used the La cDNA M13–3, which was originally described by Chan et al. (20Chan E.K.L. Sullivan K.F. Tan E.M. Nucleic Acids Res. 1989; 17: 2233-2244Google Scholar) and which was a gift of Dr. E. K. L. Chan (Scripps Clinic, La Jolla, CA). Upstream exon 1 primer served the primer P9 (P9, CGCTTTACTAGTCGGTCCCCATCTTCTTGG; the artificialSpeI site is underlined). The downstream primer P1 located in the exon 4 downstream of the KpnI site in the La sequence. The exon 1 PCR fragments were cleaved with SpeI and KpnI and cloned into the respective sites of La23. For this purpose La23 was linearized with SpeI, and the isolated linearized DNA was partially digested with KpnI. The exon 1 and 1′ La inserts were isolated from the pBluescript SK(−) constructs by cleavage with SpeI and XhoI and cloned into pCI-neo and pCI, which were restricted with NheI andSalI. The exon 1′ construct in pCI was termed as ORF1 La(N) (see also Fig. 6, I). In the case of the 5′-shortened exon 1′ construct, a PCR fragment was prepared using as upstream primer P10 (P10, CGCTTTACTAGTTTTTACCTCCACCGCCTTC; the artificialSpeI site is underlined) in combination with P1 as downstream primer and La23 as substrate. The resulting fragment was cleaved with SpeI and KpnI and cloned in the respective sites of La23. Finally the reading frame of the exon 1 and 1′ constructs was corrected as follows. La19 cDNA containing the correct La coding sequence was restricted with BstEII, which cleaved in the exon 9 of the La sequence, and BglII, which cleaved in the exon 5 of the La sequence. The exon 1 and 1′ pCI-neo and pCI constructs were linearized with BstEII and after isolation of the linearized DNA partially digested with BglII. Then theBglII-BstEII fragment of La19 was cloned in the respective sites of the exon 1 and 1′ pCI-neo or pCI construct. The final constructs were sequenced. The human Raji and XPTA cell lines were grown in RPMI 1640 medium containing 10% FCS in a humidified CO2 atmosphere. Mouse LTA and NIH 3T3 cells and human HeLa cells were grown in DMEM containing 10% FCS in a humidified CO2 atmosphere either in culture flasks for preparation of extracts or on coverslips for epifluorescence microscopy. The mouse cells were transfected transiently according to the following protocol. Transfection was performed in 6-well tissue culture plates (35 mm) containing coverslips. Cells were grown to confluency of 70–80% in 4 ml of DMEM containing 10% FCS. Prior to transfection the serum/medium was removed, and the cells were washed for 30 min with 2 ml of DMEM without FCS and antibiotics. In parallel 1.5 μg of plasmid DNA (see below) was dissolved in 100 μl of Opti-MEM medium and combined with 100 μl of DMEM (without antibiotics and FCS) containing 6 μl of LipofectAMINE. After removal of the 2 ml of DMEM, 0.8 ml of DMEM lacking FCS and antibiotics were added to the cells, and the DNA mixture followed. After an 5-h incubation 1 ml of DMEM containing 20% FCS and antibiotics was added. 20 h after the beginning of transfection the medium was replaced by 2 ml of DMEM containing 10% FCS and antibiotics. 44 h after transfection the cells were either harvested for preparation of total extracts or fixed with methanol/EGTA for immunofluorescence microscopy. In general we observed that even after optimization of the transfection conditions the expression level of the pCI-neo constructs was only 25% compared with the pCI constructs. In addition to transiently transfected cells, permanently transfected LTA cell lines were used. These lines were kindly provided by Dr. K. Keech of the group of Prof. J. McCluskey and Prof. T. Gordon (Flinders Medical Center, Bedfort, South Australia). The cells were transfected with either the human La gene or the human exon 1 La cDNA (19Chambers J.C. Kenan D. Martin B.J. Keene J.D. J. Biol. Chem. 1988; 263: 18043-18051Google Scholar). The permanently transfected LTA cells were grown in the presence of 0.02% geneticin. For immunofluorescence microscopy the cells were fixed with methanol containing 0.02% EGTA at −20 °C for 1 h. Indirect immunofluorescence of cells with the anti-La mAb SW5 was performed by incubating the fixed cells, which had been rehydrated for 5 min with PBS, with cell culture supernatant of hybridomas secreting the anti-La mAb SW5 for at least 15 min. The cells were washed with PBS (5 min), and the bound anti-La mAb was detected using Cy3-conjugated anti-mouse antibody developed in goat. The incubation time for the secondary antibody was 15 min. The staining occurred at room temperature and the unbound secondary antibodies were removed by washing with PBS (twice, 5 min). The stained cells were mounted using PBS/glycerol (1:1 v/v). Confocal laser scanning microscopy (cLSM) was performed using a Zeiss LSM 10. The stained specimens were cut automatically into horizontal sections (512 × 512 pixels/8 bit, objective lenses Plan-Neofluar 40 ×/1.3 oil). Evaluation of the stored stacks of the horizontal optical sections was performed with the LSM 10 image processing unit. Total extracts of transiently transfected cell lines were prepared by incubation with 350 μl of SDS-PAGE sample solution (95 °C). Total extracts from XPTA cells or permanently transfected LTA cells were harvested by adding 100 μl of hot cell lysis buffer (100 mmNa2HPO4, pH 8.3, 200 mmdithiothreitol, 1% SDS, 10% glycerol (v/v)) per cm2. Raji cells were harvested by centrifugation (250 × g, 10 min). The lysed cells were heated for 5 min to 95 °C and centrifuged at 14,000 × g for 5 min at 4 °C. 5-μl aliquots were mixed with SDS-PAGE sample solution and used for SDS-PAGE. SDS-PAGE and immunoblotting was performed as described (22Laemmli U.K. Nature. 1970; 227: 680-685Google Scholar, 23Matsudaira P. J. Biol. Chem. 1987; 262: 10035-10038Google Scholar). After blocking and washing the blots were incubated with cell culture supernatant of hybridoma cells secreting the anti-La mAb SW5. Formed immune complexes were visualized using the enhanced chemiluminescence-Western blotting detection reagents. Then the anti-La SW5 immune complexes were eluted, and the blot was processed a second time using either the patient's anti-La antibody or the anti-ORF1 rabbit serum. The formed immune complexes were detected using anti-human or anti-rabbit antibodies conjugated with alkaline phosphatase and 5-bromo-4-chloro-3-indolyl phosphate/4-nitro blue tetrazolium chloride as substrate. To obtain antibodies against the ORF1, a fusion protein consisting of glutathioneS-transferase (GST) and a portion of ORF1 was constructed. For this purpose an exon 1′ fragment spanning nucleotides 171–260 (6Pruijn G.J.M. Slobbe R.L. van Venrooij W.J. Mol. Biol. Rep. 1990; 14: 43-48Google Scholar) was amplified by PCR using the upstream primer P11 (P11, CCCGGGATCCATGCGAGATCCTGG; the artificialBamHI site is underlined; A indicates a point mutation introduced in the native BamHI site) and the downstream primer P12 (P12, AGGATCCAAGACGCAATGGGGATGAG; the artificial BamHI site is underlined) subcloned into pGEM-T and after restriction with BamHI inserted into theBamHI site of pGEX-2T. To proof the specificity of the anti-ORF1 serum and to look for or to rule out an expression of the ORF1 further constructs were prepared. In a first step the complete exon 1′ was cloned in the transfection vector pCI. Because the translation initiation site of the ORF1 in the exon 1′ is not optimal according to Kozak (24Kozak M. J. Cell Biol. 1991; 115: 887-902Google Scholar), a further construct was prepared in which the translation initiation site was optimized according to the Kozak rules. This construct was termed ORF1 Kozak construct. Finally, the ORF1 was cloned downstream of a 3′-terminally truncated exon 1′-La mRNA. This clone was termed as ORF1 La(N)-ORF1 (see also Fig. 6,I). The ORF1 in the pCI transfection vector was obtained as follows. The pCI vector containing the full-length exon 1′ La cDNA was cut withSmaI. Then the cleaved DNA was partially digested withBalI and religated. The resulting clone contained the 5′ leader sequence of the exon 1′ La mRNA (nucleotides 1–137), the complete ORF1 (starting at nucleotide 138 and ending at nucleotide 276 including the oligo(dT) tail). It ended at nucleotide 293 in the exon 1′. The ORF1 Kozak construct was prepared as follows. The full-length exon 1′ La cDNA served as substrate for PCR using as upstream primer the primer P13 (P13, TGCTAGC GCCACCATGGGGGATCCTGGGGTTC; the artificial NheI site is underlined, the mutated optimized translational initiation site according to Kozak is given in italics). The primer P14 (P14, TCTAGACGCTATGGGGATGAGG; the artificialXbaI site is underlined) served the downstream primer. The resulting fragment was subcloned in pGEM-T, isolated by cleavage withNheI and XbaI, and cloned into the respective sites of pCI. The resulting ORF1 construct contained the same portion of the ORF1, which was also cloned in the GST-ORF1 construct. The ORF1 La(N)-ORF1 construct was prepared as follows. The exon 1′ full-length construct in pCI was cleaved with XbaI and dephosphorylated. The resulting deletion La mutant encoded for amino acids 1–228 of La protein. The ORF1 insert was amplified from the above mentioned ORF1 subcloned in pGEM-T using as upstream primer P15 (P15, TGTAAAACGACGGCCAGTG) and as downstream primer P16 (P16, ATGAAATCACTAGTGATTGCTAGCGCCACC; the SpeI site is underlined). The resulting PCR fragment was cleaved withSpeI and XbaI and cloned in the XbaI site of the N-terminal truncated La deletion construct. In a recent study Keech et al. (21Keech C.L. Gordon T. Reynolds P. McCluskey J. J. Autoimmunity. 1993; 6: 543-555Google Scholar) describe a mouse LTA cell line transfected with the human La gene. This cell line expressed human La protein in addition to the endogenous mouse La protein. As shown in Fig. 1 a differentiation between the human La protein and the endogenous mouse La protein in this mouse LTA cell line was possible by two techniques, including immunofluorescence microscopy (Fig. 1 A) and SDS-PAGE/immunoblotting (Fig. 1 B). As shown in Fig.1 A (a) LTA cells transfected with the human La gene were stained with the anti-La mAb SW5, whereas untransfected cells were not stained (Fig. 1 A, b and c). After SDS-PAGE/immunoblotting, the anti-La mAb SW5 reacted with a single protein band according to a molecular mass of 50 kDa from the extract of the LTA cell line transfected with the human La gene (Fig.1 B, lane 2). The same band was also recognized by the patient's anti-La antibody (Fig. 1 B, lane 4). The anti-La mAb SW5 did not react with the total extract of the untransfected LTA cells (Fig. 1 B, lane 1). In contrast, the patient's antibody reacted with a further protein band according to a molecular mass of 45 kDa in the extract of both the transfected (Fig. 1 B, lane 4) and the untransfected cells (Fig. 1 B, lane 3). These data allowed the following conclusions: (i) the human and the mouse La protein can be separated by SDS-PAGE, (ii) the protein band with a molecular mass of about 50 kDa represented the human La protein, (iii) the protein band with a molecular mass of 45 kDa represented the endogenous mouse La protein, (iv) the patient's anti-La antibody reacted with both the human and the mouse La protein, and (v) the anti-La mAb SW5 reacted only with the human but not with the endogenous mouse La protein. Consequently, transfection of mouse cells with a human exon 1′ La construct should allow the decision if the exon 1′ La mRNA is a translatable mRNA. Moreover, a mouse cell line transfected with an exon 1′ La construct but also the LTA cell line transfected with the human La gene should be useful to look for translation products of the upstream ORFs of the exon 1′ La mRNA. One prerequisite to use the LTA cell line transfected with the human La gene for such a purpose was that the exon 1′ La mRNA was made and expressed similarly to human cells. Therefore, in a first step we analyzed if the mouse LTA cells allowed the expression of the exon 1′ La mRNA type from the human La gene. For this purpose 5′-RACE experiments were performed as schematically summarized in Fig. 2(S). The PCR products obtained after the first amplification step were further amplified using a primer combination consisting either of the common exon 2 downstream primer together with an exon 1 (Fig. 2, A1, PCR 2a) or exon 1′ (Fig. 2,A1, PCR 2b) specific upstream primer or of the common UAP upstream primer in combination with an exon 1′ specific downstream primer (Fig. 2, B1, and also Fig.3, S, B). As shown in Fig. 2 (A2, lanes 1), both the exon 1′ and exon 1 human La mRNA forms could be detected in the mouse LTA cells transfected with the human La gene, whereas they were not detectable in the untransfected cell line (Fig. 2, A2,lanes 3). The human exon 1′ La mRNAs were also not detectable in a LTA cell line permanently transfected with the human exon 1 La cDNA (Fig. 2, A2, exon 1′,lane 2), whereas the human exon 1 La mRNA was detectable in this LTA cell line (Fig. 2, A2, exon 1,lane 2). Finally, when the exon 1 and 1′ bands were excised, subcloned, and sequenced, the PCR products could be unequivocally characterized as human exon 1 or exon 1′ products. Already during determination of the 5′-start of the exon 1′ La mRNA type a series of 5′-shortened exon 1′ La cDNAs were isolated. The decision of the 5′-start of the exon 1′ La mRNA was made on the longest 5′-exon 1′ La cDNA fragment obtained by the 5′-RACE technique. However, when the 5′-RACE products obtained for mRNAs isolated from the LTA cells transfected with the human La gene were separated on a NuSieve-agarose gel (Fig. 2, B2,lane 1), several bands were obtained. Therefore, further 5′-RACE studies were performed, and the PCR products were characterized. For this purpose exon 1 and exon 1′ 5′-RACE products were prepared in parallel from different mRNA preparations according to the procedure that is schematically summarized in Fig. 2(S). After the first amplification (Fig. 2, S,PCR(1)) the PCR products were further amplified as schematically summarized in Fig. 3 (S). The second amplification was performed using the common UAP primer in combination with either an exon 1 (Fig. 3, S, [A]) or an exon 1′ (Fig. 3, S, [B]) specific downstream primer. The mRNA preparations used for the 5′-RACE experiments were obtained from different human tissues including liver (Fig. 3,A and B, lanes L), PBLs of a patient with pSS (Fig. 3, A and B, lanes P p) and a healthy donor (Fig. 3, A andB, lanes P h), and fetal spleen (Fig. 3,A and B, lanes FS). As shown in Fig. 3 (A, lanes a–d), the exon 1 5′-RACE products gave" @default.
W2062972082 created "2016-06-24" @default.
W2062972082 creator A5024619995 @default.
W2062972082 creator A5040122370 @default.
W2062972082 creator A5054949906 @default.
W2062972082 creator A5063907511 @default.
W2062972082 creator A5071966507 @default.
W2062972082 date "1997-05-01" @default.
W2062972082 modified "2023-10-16" @default.
W2062972082 title "Transfection Analysis of Expression of mRNA Isoforms Encoding the Nuclear Autoantigen La/SS-B" @default.
W2062972082 cites W1506081776 @default.
W2062972082 cites W1552738427 @default.
W2062972082 cites W1554364726 @default.
W2062972082 cites W1582424095 @default.
W2062972082 cites W1620364639 @default.
W2062972082 cites W1932052686 @default.
W2062972082 cites W1978697032 @default.
W2062972082 cites W1990944487 @default.
W2062972082 cites W1999896275 @default.
W2062972082 cites W2010622983 @default.
W2062972082 cites W2011699726 @default.
W2062972082 cites W2022837567 @default.
W2062972082 cites W2022915892 @default.
W2062972082 cites W2038442197 @default.
W2062972082 cites W2046791042 @default.
W2062972082 cites W2048999323 @default.
W2062972082 cites W2049661143 @default.
W2062972082 cites W2070732336 @default.
W2062972082 cites W2072927794 @default.
W2062972082 cites W2100837269 @default.
W2062972082 cites W210302837 @default.
W2062972082 cites W284187410 @default.
W2062972082 cites W4229982716 @default.
W2062972082 doi "https://doi.org/10.1074/jbc.272.18.12076" @default.
W2062972082 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9115276" @default.
W2062972082 hasPublicationYear "1997" @default.
W2062972082 type Work @default.
W2062972082 sameAs 2062972082 @default.
W2062972082 citedByCount "13" @default.
W2062972082 countsByYear W20629720822021 @default.
W2062972082 crossrefType "journal-article" @default.
W2062972082 hasAuthorship W2062972082A5024619995 @default.
W2062972082 hasAuthorship W2062972082A5040122370 @default.
W2062972082 hasAuthorship W2062972082A5054949906 @default.
W2062972082 hasAuthorship W2062972082A5063907511 @default.
W2062972082 hasAuthorship W2062972082A5071966507 @default.
W2062972082 hasBestOaLocation W20629720821 @default.
W2062972082 hasConcept C104317684 @default.
W2062972082 hasConcept C105580179 @default.
W2062972082 hasConcept C153911025 @default.
W2062972082 hasConcept C185592680 @default.
W2062972082 hasConcept C53345823 @default.
W2062972082 hasConcept C54009773 @default.
W2062972082 hasConcept C54355233 @default.
W2062972082 hasConcept C86803240 @default.
W2062972082 hasConcept C95444343 @default.
W2062972082 hasConceptScore W2062972082C104317684 @default.
W2062972082 hasConceptScore W2062972082C105580179 @default.
W2062972082 hasConceptScore W2062972082C153911025 @default.
W2062972082 hasConceptScore W2062972082C185592680 @default.
W2062972082 hasConceptScore W2062972082C53345823 @default.
W2062972082 hasConceptScore W2062972082C54009773 @default.
W2062972082 hasConceptScore W2062972082C54355233 @default.
W2062972082 hasConceptScore W2062972082C86803240 @default.
W2062972082 hasConceptScore W2062972082C95444343 @default.
W2062972082 hasIssue "18" @default.
W2062972082 hasLocation W20629720821 @default.
W2062972082 hasOpenAccess W2062972082 @default.
W2062972082 hasPrimaryLocation W20629720821 @default.
W2062972082 hasRelatedWork W1974868223 @default.
W2062972082 hasRelatedWork W1976731363 @default.
W2062972082 hasRelatedWork W1989943173 @default.
W2062972082 hasRelatedWork W2026980989 @default.
W2062972082 hasRelatedWork W2083535977 @default.
W2062972082 hasRelatedWork W2267242741 @default.
W2062972082 hasRelatedWork W2351833432 @default.
W2062972082 hasRelatedWork W2388736249 @default.
W2062972082 hasRelatedWork W2424525284 @default.
W2062972082 hasRelatedWork W3030472574 @default.
W2062972082 hasVolume "272" @default.
W2062972082 isParatext "false" @default.
W2062972082 isRetracted "false" @default.
W2062972082 magId "2062972082" @default.
W2062972082 workType "article" @default.