FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2063588043> ?p ?o ?g. }

• W2063588043 endingPage "36792" @default.
• W2063588043 startingPage "36783" @default.
• W2063588043 abstract "The N terminus of G protein-coupled receptors has been implicated in binding to peptide hormones. We have used random saturation mutagenesis to identify essential residues in the N terminus of the human complement factor 5a receptor (C5aR). In a library of N-terminal mutant C5aR molecules screened for activation by C5a, residues 24-30 of the C5aR showed a marked propensity to mutate to cysteine, most likely indicating that sulfhydryl groups at these positions are appropriately situated to form disulfide interactions with the unpaired Cys27 of human C5a. This presumptive spatial constraint allowed the ligand to be computationally docked to the receptor to form a model of the C5a/C5aR interaction. When the N-terminal mutant C5aR library was rescreened with C5a C27R, a ligand incapable of disulfide interactions, no individual position in the N terminus was essential for receptor signaling. However, the region 19-29 was relatively highly conserved in the functional mutants, further demonstrating that this region of the C5aR makes a productive physiologic interaction with the C5a ligand. The N terminus of G protein-coupled receptors has been implicated in binding to peptide hormones. We have used random saturation mutagenesis to identify essential residues in the N terminus of the human complement factor 5a receptor (C5aR). In a library of N-terminal mutant C5aR molecules screened for activation by C5a, residues 24-30 of the C5aR showed a marked propensity to mutate to cysteine, most likely indicating that sulfhydryl groups at these positions are appropriately situated to form disulfide interactions with the unpaired Cys27 of human C5a. This presumptive spatial constraint allowed the ligand to be computationally docked to the receptor to form a model of the C5a/C5aR interaction. When the N-terminal mutant C5aR library was rescreened with C5a C27R, a ligand incapable of disulfide interactions, no individual position in the N terminus was essential for receptor signaling. However, the region 19-29 was relatively highly conserved in the functional mutants, further demonstrating that this region of the C5aR makes a productive physiologic interaction with the C5a ligand. G protein-coupled receptors (GPCRs) 3The abbreviations used are: GPCR, G protein-coupled receptor; C5a, complement factor 5a; C5aR, complement factor 5a receptor; 3-AT, 3-amino-1,2,4-triazole; YFP, yellow fluorescent protein; TM, transmembrane helix; PIPES, 1,4-piperazinediethanesulfonic acid. transduce signals from a wide variety of biological stimuli, including small molecules, lipids, peptides, proteins, and environmental cues such as odorants and light (1Ji T.H. Grossmann M. Ji I. J. Biol. Chem. 1998; 273: 17299-17302Abstract Full Text Full Text PDF PubMed Scopus (550) Google Scholar). As the largest family of cell-surface receptors, they have provided fertile ground for pharmacologic modulation. GPCRs share a secondary structure consisting of seven transmembrane helices (TMs 1-7) joined by three intracellular and three extracellular loops, along with N- and C-terminal domains (Fig. 1). The receptors serve as binary switches that, when activated by ligand, exhibit guanine nucleotide exchange factor activity toward heterotrimeric G proteins (2Hamm H.E. J. Biol. Chem. 1998; 273: 669-672Abstract Full Text Full Text PDF PubMed Scopus (939) Google Scholar). Because they are large transmembrane proteins, GPCRs are difficult to study by direct structural methods such as x-ray crystallography. A series of crystal structures of bovine rhodopsin has allowed major progress in the understanding of GPCR structure (3Palczewski K. Kumasaka T. Hori T. Behnke C.A. Motoshima H. Fox B.A. Le Trong I. Teller D.C. Okada T. Stenkamp R.E. Yamamoto M. Miyano M. Science. 2000; 289: 739-745Crossref PubMed Scopus (5039) Google Scholar, 7Li J. Edwards P.C. Burghammer M. Villa C. Schertler G.F. J. Mol. Biol. 2004; 343: 1409-1438Crossref PubMed Scopus (676) Google Scholar) but has not made clear the mechanism by which these receptors serve as switches, because rhodopsin has only been crystallized in its resting state. The mechanism of GPCR activation has, however, been productively explored using a variety of biochemical, biophysical, and computational techniques. Overall, ligand binding by GPCRs appears to induce a rigid-body movement of TM6 away from TM3, exposing new receptor surfaces that allow coupling to downstream effectors (8Gether U. Endocr. Rev. 2000; 21: 90-113Crossref PubMed Scopus (1002) Google Scholar, 11Bissantz C. J. Recept. Signal. Transduct. Res. 2003; 23: 123-153Crossref PubMed Scopus (62) Google Scholar). Our laboratory has studied the human complement factor 5a receptor (C5aR) (12Gerard N.P. Gerard C. Nature. 1991; 349: 614-617Crossref PubMed Scopus (566) Google Scholar) as a model system because it, like rhodopsin and many other clinically important receptors, belongs to the large family A of GPCRs (13Horn F. Bettler E. Oliveira L. Campagne F. Cohen F.E. Vriend G. Nucleic Acids Res. 2003; 31: 294-297Crossref PubMed Scopus (329) Google Scholar). The C5aR has 19% amino acid identity with rhodopsin and has loop and transmembrane helix lengths similar to those of rhodopsin. Furthermore, the C5aR can be expressed in Saccharomyces cerevisiae, making it amenable to genetic studies. In addition to its role as a model receptor, the C5aR has intrinsic biological interest. The vertebrate anaphylatoxin C5a is produced upon activation of the serum complement cascade and is the principal chemotactic agent for recruitment of neutrophils to sites of inflammation. The C5aR is also responsible for histamine release from mast cells, degranulation of eosinophils, vasodilation, vascular permeabilization, and other components of the acute inflammatory response (14Wetsel R.A. Curr. Opin. Immunol. 1995; 7: 48-53Crossref PubMed Scopus (183) Google Scholar). The central role of the C5aR in inflammation has made it a candidate therapeutic target in lupus (15Bao L. Osawe I. Puri T. Lambris J.D. Haas M. Quigg R.J. Eur. J. Immunol. 2005; 35: 2496-2506Crossref PubMed Scopus (117) Google Scholar) and rheumatoid arthritis (16Wang Y. Rollins S.A. Madri J.A. Matis L.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8955-8959Crossref PubMed Scopus (314) Google Scholar), among other autoimmune disorders, and in sepsis (17Allegretti M. Moriconi A. Beccari A.R. Di Bitondo R. Bizzarri C. Bertini R. Colotta F. Curr. Med. Chem. 2005; 12: 217-236Crossref PubMed Scopus (75) Google Scholar). Optimal anti-C5aR therapeutics will require a good understanding of the structural basis for the ligand binding ability, switch mechanism, and interaction with downstream effectors of the receptor. The two-site model of C5a/C5aR binding (18Siciliano S.J. Rollins T.E. DeMartino J. Konteatis Z. Malkowitz L. Van Riper G. Bondy S. Rosen H. Springer M.S. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 1214-1218Crossref PubMed Scopus (219) Google Scholar) proposes that two separate binding sites contribute to ligand affinity. One binding site involves the C terminus of C5a (approximately residues 67-74) and a pocket formed by the TMs of the C5aR. In support of this claim, mutations in the ligand C-terminal tail inhibit ligand binding and receptor activation (19Mollison K.W. Mandecki W. Zuiderweg E.R. Fayer L. Fey T.A. Krause R.A. Conway R.G. Miller L. Edalji R.P. Shallcross M.A. Lane B. Fox J.L. Greer J. Carter G.W. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 292-296Crossref PubMed Scopus (116) Google Scholar). Synthetic hexapeptides derived from the tail of C5a can compete with the full-length ligand and serve as full agonists (18Siciliano S.J. Rollins T.E. DeMartino J. Konteatis Z. Malkowitz L. Van Riper G. Bondy S. Rosen H. Springer M.S. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 1214-1218Crossref PubMed Scopus (219) Google Scholar, 20Kawai M. Quincy D.A. Lane B. Mollison K.W. Or Y.S. Luly J.R. Carter G.W. J. Med. Chem. 1992; 35: 220-223Crossref PubMed Scopus (39) Google Scholar), indicating that the tail interacts with the receptor. Receptor residues Ile116, Arg206, and Val286 have been identified as points of interaction with the C5a C-terminal tail (21Gerber B.O. Meng E.C. Dotsch V. Baranski T.J. Bourne H.R. J. Biol. Chem. 2001; 276: 3394-3400Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar, 22DeMartino J.A. Konteatis Z.D. Siciliano S.J. Van Riper G. Underwood D.J. Fischer P.A. Springer M.S. J. Biol. Chem. 1995; 270: 15966-15969Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar). Evidence for a second site of receptor/ligand interaction comes from the observation that high-affinity C5a sites are lost when the C5aR N terminus is truncated (23DeMartino J.A. Van Riper G. Siciliano S.J. Molineaux C.J. Konteatis Z.D. Rosen H. Springer M.S. J. Biol. Chem. 1994; 269: 14446-14450Abstract Full Text PDF PubMed Google Scholar), subjected to point mutations (24Mery L. Boulay F. Eur. J. Haematol. 1993; 51: 282-287Crossref PubMed Scopus (21) Google Scholar, 25Mery L. Boulay F. J. Biol. Chem. 1994; 269: 3457-3463Abstract Full Text PDF PubMed Google Scholar), or substituted by the corresponding region of the formyl-methionyl-leucyl-phenylalanine receptor (25Mery L. Boulay F. J. Biol. Chem. 1994; 269: 3457-3463Abstract Full Text PDF PubMed Google Scholar). Approximately half of the binding energy for C5a appears to be derived from interactions with the receptor N terminus (25Mery L. Boulay F. J. Biol. Chem. 1994; 269: 3457-3463Abstract Full Text PDF PubMed Google Scholar). NMR studies showed that a peptide identical to the first 34 amino acids of C5aR retained its ability to bind C5a and that proton resonances in receptor positions 21-30 were most strongly affected by the binding event (26Chen Z. Zhang X. Gonnella N.C. Pellas T.C. Boyar W.C. Ni F. J. Biol. Chem. 1998; 273: 10411-10419Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). Although these data implicate the N terminus of the C5aR in ligand binding, it remains unclear which region of C5a is involved in the interaction. In the two-site model for C5aR function, the N terminus of the receptor captures the ligand and positions it to interact with the TM bundle but does not directly participate in the switch mechanism. A receptor/ligand interaction at the second site is required to actuate the switch. A similar model has been proposed for other family A receptors, including the follicle-stimulating hormone receptor (27Fan Q.R. Hendrickson W.A. Endocrine. 2005; 26: 179-188Crossref PubMed Scopus (33) Google Scholar, 28Fan Q.R. Hendrickson W.A. Nature. 2005; 433: 269-277Crossref PubMed Scopus (471) Google Scholar), vasopressin receptor (29Kojro E. Eich P. Gimpl G. Fahrenholz F. Biochemistry. 1993; 32: 13537-13544Crossref PubMed Scopus (81) Google Scholar), and neuropeptide Y receptor (30Walker P. Munoz M. Martinez R. Peitsch M.C. J. Biol. Chem. 1994; 269: 2863-2869Abstract Full Text PDF PubMed Google Scholar). For small-molecule ligands that are too small to span two binding sites, the binding affinity of the receptor usually lies entirely in the TM domain, not in an extracellular region. Prior work from our laboratory has illustrated the value of random saturation mutagenesis in the structure/function analysis of GPCRs (31Baranski T.J. Herzmark P. Lichtarge O. Gerber B.O. Trueheart J. Meng E.C. Iiri T. Sheikh S.P. Bourne H.R. J. Biol. Chem. 1999; 274: 15757-15765Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 34Klco J.M. Nikiforovich G.V. Baranski T.J. J. Biol. Chem. 2006; 281: 12010-12019Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar). This technique makes use of a high-throughput reverse-genetic screen to examine the role of each amino acid position while relying on a minimum of a priori assumptions. In the present study, we subjected the N terminus of the C5aR to random saturation mutagenesis to identify residues that are essential for interacting with the ligand. No individual residue was found to be essential; however, our analysis revealed a structural constraint that allowed us to model the binding of C5a to its receptor. Yeast Strains—Yeast strain BY1142 (31Baranski T.J. Herzmark P. Lichtarge O. Gerber B.O. Trueheart J. Meng E.C. Iiri T. Sheikh S.P. Bourne H.R. J. Biol. Chem. 1999; 274: 15757-15765Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar) has the genotype MATα far1Δ1442 tbt1-1 Pfus1-HIS3 can1 ste14::trp1::LYS2 ste3Δ1156 gpa1 (41)-Gαi3 lys2 ura3 leu2 trp1 his3 ade2. In this strain, all but the first 41 residues of the endogenous yeast Gα subunit Gpa1 are replaced by human Gαi3, creating a chimeric α subunit that can be activated by mammalian receptors but can also signal to downstream components of the yeast mitogen-activated protein kinase pathway tivated protein kinase mating cascade is engineered so that G protein activation causes transcription of the Pfus1-HIS3 reporter. Thus, G protein or receptor activity allows the yeast to grow on histidine-deficient medium. Strain BY1173 has the genotype MATa ura3 leu2 trp1 his3 can1 gpa1Δ::ade2Δ::3xHA far1Δ::ura3Δ fus1::Pfus1-HIS3 LEU2::Pfus1-LacZ sst2Δ::ura3Δ ste2Δ::G418R trp1::GPA1/Gαi1 (36Brown A.J. Dyos S.L. Whiteway M.S. White J.H. Watson M.A. Marzioch M. Clare J.J. Cousens D.J. Paddon C. Plumpton C. Romanos M.A. Dowell S.J. Yeast. 2000; 16: 11-22Crossref PubMed Scopus (151) Google Scholar); in this strain, the final 5 residues of Gpa1 are replaced by the corresponding residues of human Gαi1, again to provide a signaling assay for mammalian receptors. The integrated Pfus1-LacZ reporter causes G protein activation to elicit β-galactosidase expression. Yeast were transformed by the standard lithium acetate procedure and grown at 30 °C. Library Construction and Screening—Site-directed mutagenesis was used to introduce an NcoI site near the N terminus of C5aR and a silent MluI site near position 32. The introduction of NcoI required an N2D mutation in C5aR; this is a conservative change that preserves receptor function and ligand affinity. To eliminate the possibility of wild-type contamination of the N-terminal mutant library, a noncoding “stuffer” sequence was first subcloned between NcoI and MluI, and the resulting plasmid was used for library construction. The oligonucleotide 5′-ATACCATGGACTCTTTTAATTATACTACTCCAGATTATGGTCATTATGATGATAAAGATACTCTAGATCTAAATACTCCAGTTGATAAAACTTCTAATACTCTACGCGTAG-3′ was synthesized (Integrated DNA Technologies, Coralville, IA) with a palindromic 3′ sequence and a 20% mutation doping rate at the underlined positions, corresponding to residues 2-32 of the receptor. To preserve the NcoI site, only nucleotides 2 and 3 of the codon for Asp2 were mutagenized. The mutant oligonucleotide was self-annealed, filled in with Klenow polymerase (New England Biolabs), and subcloned into the NcoI/MluI sites of C5aR to create a library of ∼2 × 105 mutant receptors (pBN1232) in an ADE2 vector. To screen the library, yeast BY1142 was cotransformed with pBN1232 and with the C5a ligand plasmid pBN444 (URA3 vector), then grown under selection. Approximately 105 transformants were screened by the yeast growth assay described below. Thirty colonies exhibiting ligand-dependent growth on 3-AT were selected for further analysis. Plasmids were isolated from these colonies by standard methods, sequenced (Protein and Nucleic Acid Chemistry Laboratory, Washington University, St. Louis, MO), and resubjected to the growth assay to confirm their phenotypes. Library Statistical Analysis—Before screening, characteristics of the N-terminal mutant library were verified by sequencing randomly selected clones. Mutations were evenly spaced along the region under study. The randomly selected receptors contained an average of 18.3 nucleotide changes (18.1%) and 11 amino acid changes (36.7%). Assuming a binomial distribution of mutations, 54.9% of the total codons in the library were unmutated, 36.4% contained precisely one nucleotide change, 8.0% had two changes, and 0.6% had three changes. At positions 24, 26, 27, and 29 of the C5aR, the native codons were such that two nucleotide changes were required for cysteine to arise, yet cysteine occurred 25 times at these positions in the selected receptors. To find the number of cysteines that would have been expected here by chance, we noted that two-nucleotide mutations allowed any given triplet codon to change to 27 of the 63 remaining codons. Two of these codons represented cysteine, so P(cysteine|occurrence of a two-nucleotide mutation) = 2/27 = 0.074. The probability of observing a cysteine was P(cysteine|occurrence of a two-nucleotide mutation) × P(occurrence of a two-nucleotide mutation) = 0.074 × 0.080 = 0.0059. Our 29 mutant receptors sampled these positions 4 × 29 = 116 times, so the expected number of cysteines at these positions was 116 × 0.0059 = 0.69. We repeated this analysis for position 30, where a single nucleotide change (TCT to TGT) was required to introduce a cysteine. A single-nucleotide mutation made nine mutant codons accessible, only one of which (in this case) encoded cysteine, so P(cysteine|occurrence of a single-nucleotide mutation) = 1/9 = 0.111). At position 30, the expected probability of cysteine was P(cysteine|occurrence of a single-nucleotide mutation) × P(occurrence of a single-nucleotide mutation) = 0.111 × 0.364 = 0.040. Our mutant receptors sampled this position 29 times, so the expected number of cysteines at position 30 was 29 × 0.040 = 1.2. (The possibility of a two-nucleotide transition to cysteine contributes negligibly to this calculation, adding an additional 0.1 expected cysteine in 29 receptors.) Sequence Conservation Scoring—Conservation at each position of C5aR was determined using the Scorecons server (www.ebi.ac.uk/thornton-srv/databases/cgi-bin/valdar/scorecons_server.pl) (37Valdar W.S. Proteins. 2002; 48: 227-241Crossref PubMed Scopus (485) Google Scholar) with the default parameters of α = 1 for symbol diversity, β = 0.5 for stereochemical diversity, and γ = 3 for gaps. Ligand Mutagenesis—A C27R mutation was introduced into the C5a ligand by PfuTurbo (Stratagene) site-directed mutagenesis followed by plasmid sequencing. YFP Tagging of Receptors—Three receptors from the N series (N2, N13, and N55) were selected for further analysis. These were tagged with YFP at their C terminus by subcloning the KpnI-XhoI fragment of the mutant C5aR plasmid into the XhoI-KpnI fragment of a wild-type C5aR-YFP plasmid. The resulting tag allowed receptors to be detected by Western blotting or, in vivo, by fluorescence microscopy. For Western blotting, log-phase yeast growing in liquid culture were harvested by centrifugation and lysed by vortexing for 5 min with 0.5-mm glass beads in 1× SDS sample buffer containing 100 mm dithiothreitol and protease inhibitors. Lysates were separated on 10% SDS-PAGE, transferred to polylvinylidene difluoride membrane (Bio-Rad), and immunoblotted with rabbit anti-green fluorescent protein antiserum at 1:200 dilution (sc-8334; Santa Cruz Biotechnology). Yeast Growth Assay—To assess the strength of receptor signaling, a yeast growth assay was used. For each receptor/ligand combination, three single colonies of yeast expressing a ligand (C5a, C5a C27R, or empty vector) and receptor were replica-plated onto Ura/His drop-out plates containing 3-AT (1-100 mm) and minimal adenine. 3-AT is a competitive inhibitor of the HIS3 gene product, so the concentration of 3-AT tolerated is an indicator of the strength of GPCR signaling. A color selection method allowed us to confirm that growth was receptor-dependent. White colony color indicated continued adenine prototrophy. Colonies that lost their receptor/ADE2 plasmid became reliant on scarce environmental adenine, therefore either failing to grow or producing a red pigment that was cause for exclusion from our selection. β-Galactosidase Assay—Yeast BY1173 transformed with appropriate receptor and ligand plasmids (or empty vector) was grown in suspension at 30 °C under selective conditions. To assess yeast density after overnight growth, the A600 of each culture was measured using a Spectronic-20 spectrophotometer (Bausch & Lomb). All of the cultures had an A600 of ∼0.7. For each culture, a standard quantity of yeast (10 μl divided by the A600) was seeded into a 96-well microtiter plate containing lysis/substrate buffer at final concentrations of 0.5% Triton X-100, 1 mg/ml chlorophenol red β-d-galactopyranoside, and 25 mm PIPES, pH 6.8. The quantity of yeast was sufficiently small that there was no turbidity visible in the wells. The assay plate was sealed and incubated at 37 °C. After 1 h, color development was halted by the addition of Na2CO3 to 0.2 m, and A570 was measured on a Bio-Rad model 680 microplate reader. Molecular Modeling—The C5aR was modeled as a three-dimensional bundle of TMs connected by extracellular loops, as was described previously (34Klco J.M. Nikiforovich G.V. Baranski T.J. J. Biol. Chem. 2006; 281: 12010-12019Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar). The obtained structure was extended outward at the N terminus by manually adding a fragment corresponding to residues 24-37 of C5aR in a position presumably allowing contacts with residue 27 of C5a. Using the Swiss PDB Viewer (www.expasy.org/spdbv/) (38Guex N. Peitsch M.C. Electrophoresis. 1997; 18: 2714-2723Crossref PubMed Scopus (9589) Google Scholar), a structure of C5a taken from Protein Data Bank entry 1KJS (39Zhang X. Boyar W. Toth M.J. Wennogle L. Gonnella N.C. Proteins. 1997; 28: 261-267Crossref PubMed Scopus (65) Google Scholar) was docked to the C5aR to satisfy the following constraints: (i) proximity between Cys27 of C5a and residues 24-30 of the C5aR; (ii) outward orientation of the side chain of Asn64; and (iii) burial of the C terminus of C5a in its known binding pocket in the TM bundle. To place the ligand Gly73 in proximity to receptor Val286 and Ile116 (21Gerber B.O. Meng E.C. Dotsch V. Baranski T.J. Bourne H.R. J. Biol. Chem. 2001; 276: 3394-3400Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar) and the ligand C-terminal carboxylate close to receptor Arg206 (22DeMartino J.A. Konteatis Z.D. Siciliano S.J. Van Riper G. Underwood D.J. Fischer P.A. Springer M.S. J. Biol. Chem. 1995; 270: 15966-15969Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar, 40Raffetseder U. Roper D. Mery L. Gietz C. Klos A. Grotzinger J. Wollmer A. Boulay F. Kohl J. Bautsch W. Eur. J. Biochem. 1996; 235: 82-90Crossref PubMed Scopus (36) Google Scholar), the dihedral angles ϕ and Ψ of the peptide backbone for ligand residues 63-65 and 67 were manually adjusted within the allowable regions of the Ramachandran plot. The resulting docked model was subjected to energy minimization using the program SYBYL (Tripos, St. Louis, MO) to remove clashes between residues. Random Mutagenesis of the C5aR N Terminus—The N terminus of the C5a receptor consists of ∼37 amino acid residues situated upstream of the first transmembrane domain (12Gerard N.P. Gerard C. Nature. 1991; 349: 614-617Crossref PubMed Scopus (566) Google Scholar). To identify N-terminal residues that play a role in either ligand binding or activation of C5aR, we made use of a random mutagenesis strategy (31Baranski T.J. Herzmark P. Lichtarge O. Gerber B.O. Trueheart J. Meng E.C. Iiri T. Sheikh S.P. Bourne H.R. J. Biol. Chem. 1999; 274: 15757-15765Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 33Klco J.M. Wiegand C.B. Narzinski K. Baranski T.J. Nat. Struct. Mol. Biol. 2005; 12: 320-326Crossref PubMed Scopus (137) Google Scholar). Randomly doped oligonucleotides were subcloned into nucleotide positions 5-96 of the human C5aR open reading frame to construct a library of mutant receptors. To screen the mutant receptors for signaling ability, we used a yeast strain (BY1142) that has been engineered to provide a receptor signaling assay. In wild-type yeast, the pheromone receptor Ste2p activates a mitogen-activated protein kinase cascade that culminates in cell cycle arrest and yeast mating. BY1142 lacks the FAR1 gene required for cell cycle arrest and instead contains an integrated Pfus1-HIS3 reporter; thus, yeast expressing a functional receptor exhibit histidine prototrophy upon receptor activation. The strength of receptor signaling can be assessed by replica-plating colonies of yeast on media containing increasing concentrations of 3-AT, a competitive inhibitor of the HIS3 gene product. To provide a signal to activate the mutant receptors, we coexpressed the receptor library with the human C5a ligand fused to a pre-pro-α factor secretory sequence. C5a is a 74-amino acid polypeptide that, when directed through the secretory pathway of yeast, is retained in the periplasmic space and is able to activate receptors in an autocrine manner. We selected 29 mutant receptors (the “N” series of receptors) that retained the ability to be activated by C5a despite containing an average of 11.2 amino acid changes relative to the wild-type sequence (Fig. 2). None of the 29 receptors was functional when coexpressed with an empty vector in place of C5a, demonstrating that they are not constitutively active. Amino acid changes in the functional N-terminal C5aR mutants were evenly distributed in the region between residues 3 and 32, the boundaries of our mutagenesis. There were 326 individual amino acid changes in the functional mutants; of these, 254 (77.9%) involved only one nucleotide change, making each of them relatively likely to arise in the unscreened mutant library. In random mutagenesis screens, amino acid positions that do not tolerate mutations or that allow only conservative changes are considered to be “preserved” and are inferred to play a structural or functional role. We evaluated the preservation of each position in the C5aR N terminus using a scoring algorithm (Scorecons (37Valdar W.S. Proteins. 2002; 48: 227-241Crossref PubMed Scopus (485) Google Scholar)) that considers both the substitution rate and the degree to which those substitutions preserve the character of the amino acid side chain. For this analysis, the amino acids are classified as being aliphatic (AVLIMC), aromatic (FWYH), polar (STNQ), positive (KR), negative (DE), or prone to special conformations (GP) (41Mirny L.A. Shakhnovich E.I. J. Mol. Biol. 1999; 291: 177-196Crossref PubMed Scopus (346) Google Scholar). Important caveats for this analysis are, first, that these categories do not fully capture the context-dependent chemical behavior of each amino acid, and second, that the preservation analysis is necessarily sensitive to the details of the algorithm that is used. As an additional measure of preservation, we defined a residue as being “strictly preserved” if it tolerated only conservative mutations (i.e. mutations entailing a substitution score ≥ 1 in the PAM250 matrix (42Dayhoff M.O. Schwartz R.M. Orcutt B.C. Dayhoff M.O. Atlas of Protein Sequence and Structure. National Biomedical Research Foundation, Washington, D. C.1978: 345-352Google Scholar)) or a single nonconservative change in the absence of other changes. This measure of preservation has been used in our previous mutagenesis studies of the C5aR (31Baranski T.J. Herzmark P. Lichtarge O. Gerber B.O. Trueheart J. Meng E.C. Iiri T. Sheikh S.P. Bourne H.R. J. Biol. Chem. 1999; 274: 15757-15765Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 34Klco J.M. Nikiforovich G.V. Baranski T.J. J. Biol. Chem. 2006; 281: 12010-12019Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar). The degree of preservation of each amino acid position is shown by shades of gray in Fig. 2. There were no strictly preserved residues in the N terminus of C5aR; the most highly preserved residue was Asp2, but only two nucleotides of this codon had been subjected to mutagenesis. Thr19, Ser3, Tyr6, Thr8, and Asn5 were the next most preserved amino acids, in descending order. The absence of strictly preserved positions stands in marked contrast to the other regions of the C5aR, each of which contains at least one strictly preserved position (31Baranski T.J. Herzmark P. Lichtarge O. Gerber B.O. Trueheart J. Meng E.C. Iiri T. Sheikh S.P. Bourne H.R. J. Biol. Chem. 1999; 274: 15757-15765Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 34Klco J.M. Nikiforovich G.V. Baranski T.J. J. Biol. Chem. 2006; 281: 12010-12019Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar). Hydrophobic interactions are often involved in protein tertiary structure. If this were the case for the C5aR N terminus, we would expect to find certain positions to tolerate only hydrophobic side chains. As in our previous studies, hydrophobic residues (Ala, Cys, His, Ile, Leu, Met, Phe, Thr, Trp, Tyr, and Val) were defined as those for which the free amino acid preferentially partitions into the organic phase of an octanol/water mixture (43Fauchère J.L. Charton M. Kier L.B. Verloop A. Pliska V. Int. J. Pept. Protein Res. 1988; 32: 269-278Crossref PubMed Scopus (328) Google Scholar). In our screen of the N terminus using C5a as the ligand, there were no positions that required hydrophobic residues for function (Fig. 2). Because no residue of the N terminus was strictly preserved by random mutagenesis screening, we asked whether other factors could account for the functionality of the mutants. Remarkably, the vast majority of the functional mutants (25 of 29 or 86.2%) incorporated one or more cysteines at positions 24-30 (circled in Fig. 2). At most of these positions, amino acids 24, 26, 27, and 29, accounting for 25 of 35 cysteines in this region, two nucleotide changes were necessary for cysteine to arise. In the absence of selective pressure, we would have expected to see a total of 0.69 cysteines at these positions in a set of 29 receptors (see “Experimental Procedu" @default.
• W2063588043 created "2016-06-24" @default.
• W2063588043 creator A5004313839 @default.
• W2063588043 creator A5037423758 @default.
• W2063588043 creator A5081155797 @default.
• W2063588043 creator A5087744497 @default.
• W2063588043 date "2006-12-01" @default.
• W2063588043 modified "2023-10-03" @default.
• W2063588043 title "Random Mutagenesis of the Complement Factor 5a (C5a) Receptor N Terminus Provides a Structural Constraint for C5a Docking" @default.
• W2063588043 cites W1506918918 @default.
• W2063588043 cites W1533894940 @default.
• W2063588043 cites W1546290898 @default.
• W2063588043 cites W1571861757 @default.
• W2063588043 cites W1736189198 @default.
• W2063588043 cites W1965582988 @default.
• W2063588043 cites W1972084384 @default.
• W2063588043 cites W1978958492 @default.
• W2063588043 cites W1980567977 @default.
• W2063588043 cites W1986428075 @default.
• W2063588043 cites W1986662318 @default.
• W2063588043 cites W1987036950 @default.
• W2063588043 cites W1997028984 @default.
• W2063588043 cites W2013230660 @default.
• W2063588043 cites W2015642465 @default.
• W2063588043 cites W2018797206 @default.
• W2063588043 cites W2021073687 @default.
• W2063588043 cites W2024875771 @default.
• W2063588043 cites W2033388874 @default.
• W2063588043 cites W2043890981 @default.
• W2063588043 cites W2045109604 @default.
• W2063588043 cites W2046271055 @default.
• W2063588043 cites W2046832358 @default.
• W2063588043 cites W2052998793 @default.
• W2063588043 cites W2056824071 @default.
• W2063588043 cites W2058573636 @default.
• W2063588043 cites W2062250702 @default.
• W2063588043 cites W2066109743 @default.
• W2063588043 cites W2070234134 @default.
• W2063588043 cites W2073034308 @default.
• W2063588043 cites W2076324521 @default.
• W2063588043 cites W2080210935 @default.
• W2063588043 cites W2097365951 @default.
• W2063588043 cites W2097575163 @default.
• W2063588043 cites W2098437920 @default.
• W2063588043 cites W2102763490 @default.
• W2063588043 cites W2103908315 @default.
• W2063588043 cites W2111909811 @default.
• W2063588043 cites W2122967721 @default.
• W2063588043 cites W2130783152 @default.
• W2063588043 cites W2133524076 @default.
• W2063588043 cites W2135689740 @default.
• W2063588043 cites W2138958920 @default.
• W2063588043 cites W2140820106 @default.
• W2063588043 cites W2143197682 @default.
• W2063588043 cites W2149963584 @default.
• W2063588043 cites W2150996942 @default.
• W2063588043 cites W2153047120 @default.
• W2063588043 cites W2159001526 @default.
• W2063588043 cites W2412270304 @default.
• W2063588043 cites W4233523656 @default.
• W2063588043 doi "https://doi.org/10.1074/jbc.m607686200" @default.
• W2063588043 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17023413" @default.
• W2063588043 hasPublicationYear "2006" @default.
• W2063588043 type Work @default.
• W2063588043 sameAs 2063588043 @default.
• W2063588043 citedByCount "18" @default.
• W2063588043 countsByYear W20635880432012 @default.
• W2063588043 countsByYear W20635880432013 @default.
• W2063588043 countsByYear W20635880432014 @default.
• W2063588043 countsByYear W20635880432015 @default.
• W2063588043 countsByYear W20635880432018 @default.
• W2063588043 countsByYear W20635880432021 @default.
• W2063588043 countsByYear W20635880432023 @default.
• W2063588043 crossrefType "journal-article" @default.
• W2063588043 hasAuthorship W2063588043A5004313839 @default.
• W2063588043 hasAuthorship W2063588043A5037423758 @default.
• W2063588043 hasAuthorship W2063588043A5081155797 @default.
• W2063588043 hasAuthorship W2063588043A5087744497 @default.
• W2063588043 hasBestOaLocation W20635880431 @default.
• W2063588043 hasConcept C104317684 @default.
• W2063588043 hasConcept C111684460 @default.
• W2063588043 hasConcept C112313634 @default.
• W2063588043 hasConcept C127716648 @default.
• W2063588043 hasConcept C159110408 @default.
• W2063588043 hasConcept C159654299 @default.
• W2063588043 hasConcept C16318435 @default.
• W2063588043 hasConcept C185592680 @default.
• W2063588043 hasConcept C188082640 @default.
• W2063588043 hasConcept C2524010 @default.
• W2063588043 hasConcept C2776036281 @default.
• W2063588043 hasConcept C2779499704 @default.
• W2063588043 hasConcept C33923547 @default.
• W2063588043 hasConcept C41685203 @default.
• W2063588043 hasConcept C501734568 @default.
• W2063588043 hasConcept C54355233 @default.
• W2063588043 hasConcept C55493867 @default.
• W2063588043 hasConcept C70721500 @default.
• W2063588043 hasConcept C71318922 @default.

• next