FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2065569894> ?p ?o ?g. }

• W2065569894 endingPage "40980" @default.
• W2065569894 startingPage "40973" @default.
• W2065569894 abstract "AKAP350 can scaffold a number of protein kinases and phosphatases at the centrosome and the Golgi apparatus. We performed a yeast two-hybrid screen of a rabbit parietal cell library with a 3.2-kb segment of AKAP350 (nucleotides 3611–6813). This screen yielded a full-length clone of rabbit chloride intracellular channel 1 (CLIC1). CLIC1 belongs to a family of proteins, all of which contain a high degree of homology in their carboxyl termini. All CLIC family members were able to bind a 133-amino acid domain within AKAP350 through the last 120 amino acids in the conserved CLIC carboxyl termini. Antibodies developed against a bovine CLIC, p64, immunoprecipitated AKAP350 from HCA-7 colonic adenocarcinoma cell extracts. Antibodies against CLIC proteins recognized at least five CLIC species including a novel 46-kDa CLIC protein. We isolated the human homologue of bovine p64, CLIC5B, from HCA-7 cell cDNA. A splice variant of CLIC5, the predicted molecular mass of CLIC5B corresponds to the molecular mass of the 46-kDa CLIC immunoreactive protein in HCA-7 cells. Antibodies against CLIC5B colocalized with AKAP350 at the Golgi apparatus with minor staining of the centrosomes. AKAP350 and CLIC5B association with Golgi elements was lost following brefeldin A treatment. Furthermore, GFP-CLIC5B-(178–410) targeted to the Golgi apparatus in HCA-7 cells. The results suggest that AKAP350 associates with CLIC proteins and specifically that CLIC5B interacts with AKAP350 at the Golgi apparatus in HCA-7 cells. AKAP350 can scaffold a number of protein kinases and phosphatases at the centrosome and the Golgi apparatus. We performed a yeast two-hybrid screen of a rabbit parietal cell library with a 3.2-kb segment of AKAP350 (nucleotides 3611–6813). This screen yielded a full-length clone of rabbit chloride intracellular channel 1 (CLIC1). CLIC1 belongs to a family of proteins, all of which contain a high degree of homology in their carboxyl termini. All CLIC family members were able to bind a 133-amino acid domain within AKAP350 through the last 120 amino acids in the conserved CLIC carboxyl termini. Antibodies developed against a bovine CLIC, p64, immunoprecipitated AKAP350 from HCA-7 colonic adenocarcinoma cell extracts. Antibodies against CLIC proteins recognized at least five CLIC species including a novel 46-kDa CLIC protein. We isolated the human homologue of bovine p64, CLIC5B, from HCA-7 cell cDNA. A splice variant of CLIC5, the predicted molecular mass of CLIC5B corresponds to the molecular mass of the 46-kDa CLIC immunoreactive protein in HCA-7 cells. Antibodies against CLIC5B colocalized with AKAP350 at the Golgi apparatus with minor staining of the centrosomes. AKAP350 and CLIC5B association with Golgi elements was lost following brefeldin A treatment. Furthermore, GFP-CLIC5B-(178–410) targeted to the Golgi apparatus in HCA-7 cells. The results suggest that AKAP350 associates with CLIC proteins and specifically that CLIC5B interacts with AKAP350 at the Golgi apparatus in HCA-7 cells. Cells contain a dynamic organization of signaling molecules and proteins required for the transduction of intracellular signaling events. Thus, cellular organization is crucial for intracellular signals to function correctly. The study of how the cell completes this task has revealed molecular scaffolds that allow spatial control of signaling events (1Faux M.C. Scott J.D. Cell. 1996; 85: 9-12Google Scholar, 2Burack W.R. Shaw A.S. Cur. Opin. Cell Biol. 2000; 12: 211-216Google Scholar). The study of signaling molecules scaffolded in specific locations within the cell has led to an expanded understanding of the cellular functions that they control. Scaffolding proteins are utilized in the cell to localize signaling proteins to specific areas facilitating precise cellular function. Protein kinase A-anchoring proteins (AKAPs) 1The abbreviations used are: AKAP, protein kinase A-anchoring protein; CLIC, chloride intracellular channel; PHR, pericentrin homology region; PBS, phosphate-buffered saline; TBS, Tris-buffered saline. 1The abbreviations used are: AKAP, protein kinase A-anchoring protein; CLIC, chloride intracellular channel; PHR, pericentrin homology region; PBS, phosphate-buffered saline; TBS, Tris-buffered saline. are one class of scaffolding protein utilized by the cell to anchor the regulatory subunit of type II cAMP-dependent protein kinase A (3Carr D.W. Stofko-Hahn R.E. Fraser I.D.C. Bishop S.M. Acott T.S Brennan R.G. Scott J. J. Biol. Chem. 1991; 266: 14188-14192Google Scholar) to specific locations within the cell (4Lester L.B. Scott J.D. Recent Prog. Horm. Res. 1997; 52: 409-430Google Scholar). In addition to the targeting of anchored protein kinase A, another key function of AKAPs is the recruitment of other signaling proteins (5Dodge K. Scott J.D. FEBS Lett. 2000; 476: 58-61Google Scholar). Often an AKAP will scaffold both kinases and phosphatases, thereby coordinating specific signaling events (6Scott J.D. Edwards A.S. Cur. Opin. Cell Biol. 2000; 12: 217-221Google Scholar). Thus, protein scaffolds can assemble protein kinase and phosphatase systems in close proximity of their intended substrates. We have previously defined one AKAP, AKAP350, which is the product of a multiply spliced gene family and is localized at the centrosome (7Schmidt P.H. Dransfield D.T. Claudio J.O. Hawley R.G. Trotter K.W. Milgram S.L. Goldenring J.R. J. Biol. Chem. 1999; 274: 3055-3066Google Scholar). This protein has also been observed on the Golgi apparatus, where it was identified as the centrosome and Golgi apparatus-localized protein kinase N-associated protein (CG-NAP) (8Takahashi M. Shibata H. Shimakawa M. Miyamoto M. Mukai H. Ono Y. J. Biol. Chem. 1999; 274: 17267-17274Google Scholar). The sequence of CG-NAP is identical to AKAP450 designated according to its 450-kDa size (9Witczak O. Skalhegg B.S. Keryer G. Bornens M. Tasken K. Jahnsen T. Orstavik S. EMBO J. 1999; 18: 1858-1868Google Scholar), but we will refer to AKAP350/CG-NAP/AKAP450 as AKAP350 based on the original identification of this protein by Keryer et al. (10Keryer G. Rios R.M. Landmark B.F. Skalhegg B. Lahmann S.M. Bornens M. Exp. Cell Res. 1993; 204: 230-240Google Scholar) as a 350-kDa protein kinase A-anchoring protein at the centrosome. The function of a particular AKAP is defined by its localization and the proteins bound to the scaffold (10Keryer G. Rios R.M. Landmark B.F. Skalhegg B. Lahmann S.M. Bornens M. Exp. Cell Res. 1993; 204: 230-240Google Scholar). AKAP350 has putative binding sites for protein phosphatase 1, protein kinase N, protein phosphatase 2A (8Takahashi M. Shibata H. Shimakawa M. Miyamoto M. Mukai H. Ono Y. J. Biol. Chem. 1999; 274: 17267-17274Google Scholar), protein kinase Cε (11Takahashi M. Mukai H. Oishi K. Isagawa T. Ono Y. J. Biol. Chem. 2000; 275: 34592-34596Google Scholar), and phosphodiesterase 4D3 (12Tasken K.A Collas P. Kemmner W.A. Witczak O. Conti M. Tasken K. J. Biol. Chem. 2001; 276: 21999-22002Google Scholar) as well as two protein kinase A binding sites (7Schmidt P.H. Dransfield D.T. Claudio J.O. Hawley R.G. Trotter K.W. Milgram S.L. Goldenring J.R. J. Biol. Chem. 1999; 274: 3055-3066Google Scholar, 8Takahashi M. Shibata H. Shimakawa M. Miyamoto M. Mukai H. Ono Y. J. Biol. Chem. 1999; 274: 17267-17274Google Scholar). However, previous studies have not identified proteins other than kinases and phosphatases interacting with AKAP350. We hypothesized that AKAP350 also bound to other signaling proteins based on the large size of the protein. Using yeast two-hybrid screening we now show that the chloride intracellular channel (CLIC) family of proteins interacts with a region of AKAP350 previously denoted as the pericentrin homology region (PHR) because of its 41% similarity with the centrosomal protein pericentrin (7Schmidt P.H. Dransfield D.T. Claudio J.O. Hawley R.G. Trotter K.W. Milgram S.L. Goldenring J.R. J. Biol. Chem. 1999; 274: 3055-3066Google Scholar). In addition, we identify a novel human CLIC family member, designated CLIC5B, which represents the human homologue of bovine p64 (13Landry D. Sullivan S. Nicolaides M. Redhead C. Edelman A. Field M., Al- Awqati Q. Edwards J. J. Biol. Chem. 1993; 268: 14948-14955Google Scholar). CLIC5B shares all but its first exon with the previously published human CLIC5 protein (14Berryman M. Bretscher A. Mol. Biol. Cell. 2000; 11: 1509-1521Google Scholar), renamed here as CLIC5A. CLIC5B immunostaining colocalized with AKAP350 at the Golgi apparatus as well as, to a lesser extent, the centrosome. The results suggest that AKAP350 may scaffold CLIC proteins at discrete sites within the cell. Oligonucleotides were synthesized by the Medical College of Georgia Molecular Biology Core Facility. Cy3-conjugated species-specific secondary antibodies were purchased from Jackson ImmunoResearch Laboratories (West Grove, PA). Prolong Antifade and Alexa 488-conjugated species-specific secondary antibodies were from Molecular Probes, Inc. (Eugene, OR). [α-32P]dCTP was purchased from PerkinElmer Life Sciences. A rabbit parietal cell two-hybrid library in pAD-GAL4 (15Lapierre L.A. Tuma P.L. Navarre J. Goldenring J.R. Anderson J.M. J. Cell Sci. 1999; 112: 3723-3732Google Scholar) was screened with 3.2 kb of AKAP350 sequence (nucleotides 3611–6813, GenBankTMaccession number AF083037) cloned into the binding domain vector pBDGal-4-Cam (Stratagene) with the use of EcoRI andSalI sites. The Y190 yeast strain harboring theHIS3 and β-galactosidase reporter genes were used to screen ∼1 million clones as described previously (15Lapierre L.A. Tuma P.L. Navarre J. Goldenring J.R. Anderson J.M. J. Cell Sci. 1999; 112: 3723-3732Google Scholar). The isolated clone was rescued into XL-1 Blue bacteria, and plasmid DNA was prepared using Qiagen Miniprep kits. All DNA sequencing was performed using dye terminator chemistry automated sequencing in the Molecular Biology Core Facility at the Medical College of Georgia. The isolated clone and the “bait” pBDGal-4-Cam vector both gave negative results when analyzed by themselves in yeast two-hybrid assays. Deletion constructs of the CLIC5B and the PHR region of AKAP350 (nucleotides 3611–6813) were cloned into pADGal-4 and pBDGal-4-Cam, respectively, usingEcoRI and SalI sites and were tested for interaction in the yeast-two hybrid assay as described previously (15Lapierre L.A. Tuma P.L. Navarre J. Goldenring J.R. Anderson J.M. J. Cell Sci. 1999; 112: 3723-3732Google Scholar). Full-length human CLIC1, CLIC4, CLIC5A, and parchorin constructs (14Berryman M. Bretscher A. Mol. Biol. Cell. 2000; 11: 1509-1521Google Scholar,16Nishizawa T. Nagao T. Iwatsubo T. Forte J.G. Urushidani T. J. Biol. Chem. 2000; 275: 11164-11173Google Scholar) were cloned into pADGal-4 and tested for interaction with the AKAP350-PHR-pBDGal-4-Cam bait in the yeast two hybrid assay as described previously (15Lapierre L.A. Tuma P.L. Navarre J. Goldenring J.R. Anderson J.M. J. Cell Sci. 1999; 112: 3723-3732Google Scholar). Positive results were recorded if β-galactosidase assay was positive within 3 h. The pADGal-4 vectors produced negative results when analyzed by alone. The 14G2 monoclonal anti-AKAP350 antibody was developed as described previously (7Schmidt P.H. Dransfield D.T. Claudio J.O. Hawley R.G. Trotter K.W. Milgram S.L. Goldenring J.R. J. Biol. Chem. 1999; 274: 3055-3066Google Scholar). The 121, 656, and B132 polyclonal anti-CLIC antibodies were prepared as described previously (14Berryman M. Bretscher A. Mol. Biol. Cell. 2000; 11: 1509-1521Google Scholar, 17Schlesinger P.H. Blair H.C. Teitelbaum S.L. Edwards J.C. J. Biol. Chem. 1997; 272: 18636-18643Google Scholar). The specific polyclonal anti-CLIC5B antibody was raised against the peptide containing amino acids 14–26 (QNERTYEVPDPEE) of the deduced amino acid sequence of CLIC5B (New England Peptides). The peptide was synthesized in the Medical College of Georgia Molecular Biology Core Facility. The goat polyclonal antibody was affinity-purified using the CLIC5B peptide coupled to the Aminolink system (Pierce) and eluted with 100 mm glycine, pH 2.5. HCA-7 cells were incubated in lysis buffer (1% Nonidet P-40, 50 mmTris-HCl, pH 7.4, 250 mm NaCl, 2 mm EDTA, 5 mm benzamidine, 0.1 mm4-(2-aminoethyl)benzenesulfonyl fluoride, and protease inhibitors (Sigma)) for 5 min on ice and spun at 1000 ×g for 15 min at 4 °C. 300 μg of the HCA-7 lysate proteins were incubated with the 15 μl of 656 anti-CLIC antisera for 2 h at room temperature. Dynabeads M-280 sheep anti-rabbit IgG were washed twice in phosphate-buffered saline (PBS) with protease inhibitors for 10 min at room temperature and then blocked using 0.2% bovine serum albumin and protease inhibitors (Sigma) for 1 h at room temperature. The lysate/antibody mixture was then incubated with the blocked Dynabeads M-280 sheep anti-rabbit IgG for 1 h at room temperature (Dynal). The beads were washed with PBS with protease inhibitors three times for 15 min. The beads were then boiled in the presence of 1% SDS and 1/5 volume of 2-mercaptoethanol. The samples were separated on a 3–10% gradient SDS-PAGE and transferred to nitrocellulose for Western blot analysis. HCA-7 cells were grown to confluence and washed in PBS. The cells were scraped in PBS and pelleted at 200 × g for 5 min at 4 C. The cells were then homogenized in ice-cold 250 mm sucrose, 10 mmHEPES, pH 7.4, containing protease inhibitors (Sigma) using a Potter Teflon-on-glass homogenizer. The homogenates were centrifuged at 4 °C sequentially at 1,000 × g for 5 min (P0), 5,000 × g for 15 min (P1), 17,000 × gfor 20 min (P2), and 100,000 × g for 60 min (P3). The pellets were resuspended in PBS containing protease inhibitors and the high speed supernatant (S3) was also saved. HCA-7 cell homogenates and the different subcellular fractions were resolved by SDS-PAGE using 3–10% gradient gels for AKAP350 (14G2) and 10% gels for pan-CLIC (656) and anti-CLIC5B antibodies. For AKAP350 detection, gels were transferred for 2 h at 750 mA to nitrocellulose, whereas for other antibodies gels were transferred overnight at 100 mA to polyvinylidene difluoride membranes (Immobilon P). Blots were blocked with 5% nonfat milk/Tris-buffered saline (TBS), 0.5% Tween 20 and then probed with 14G2 (1:500), 656 (1:500), or anti-CLIC5B (1:50) in 3% bovine serum albumin/TBS-Tween for 1 h at room temperature. After being washed three times with TBS-Tween, blots were incubated with horseradish peroxidase-conjugated anti-mouse IgG (1:2500), anti-rabbit IgG (1:20000), or anti-goat IgG (1:10000) in 1% nonfat milk/TBS-Tween. Blots were finally washed three times with TBS-Tween and three times with TBS, and immunoreactivity was detected with chemiluminescence (Supersignal, Pierce) and subsequent exposure to BioMax film (Kodak). Total RNA were prepared from HCA-7 cells using RNASTAT-60 (Teltest). The Advantage RT for PCR kit (Clontech) was used to construct cDNA from 2 μg of HCA-7 total RNA using random hexamer primers. Gene-specific primers were constructed at the putative start site of CLIC5B and at the termination site for CLIC5A (sense: GCGCGAATTCCCATGAATGACGAAGACTACAGCACCA, antisense: GCGCGTCGACCTGGATCGGCTGAGGCGTTTGGCGACATCAG), and products were amplified using Advantage Polymerase (Clontech) with 40 cycles: 95 °C 15 s, 60 °C 10 s, 68 °C 120 s. The resulting product was cloned into pTOPO (Invitrogen) and the insert was sequenced with flanking vector primers. A human multi-tissue Northern blot was purchased from Origene. The blot was sequentially probed with a 336 nucleotide probe corresponding to the 5′ end of human CLIC5A (nucleotides 1–336, GenBank™ accession number AF216941) or a 516 nucleotide probe corresponding to the 5′ end human CLIC5B (nucleotides 1–516 GenBank™ accession number AY032602). Blots were probed overnight at 42 °C and then washed to high stringency (0.1X SSC, 65 °C). Blots were exposed to x-ray film at −70 °C for 24 h. HCA-7 cells were grown on glass coverslips to confluence. The cells were then incubated in the absence or presence of 10 μg/ml brefeldin A for 1 h at 37 °C. Cells were washed in phosphate-buffered saline and fixed with 4% paraformaldehyde for 15 min at room temperature. Cells were blocked with 17% donkey serum, 0.3% Triton-X100 in phosphate-buffered saline and then incubated simultaneously with 14G2 (mouse anti-AKAP350) (1:85), mouse anti-p58 (1:100), and/or affinity-purified goat anti-CLIC5B (1:5) for 2 h at room temperature. The cells were then simultaneously incubated with Alexa-488-conjugated anti-rabbit IgG and Cy3-conjugated anti-mouse IgG for 60 min. Coverslips were inverted and mounted with Prolong antifade. Cells were examined for triple labeling by confocal microscopy (Amersham Biosciences) using maximum intensity projections of 0.3 μm optical sections in the apical region of the cell. GFP-CLIC5B-(178–410) was amplified utilizing primers specific for exons 2–6 shared by CLIC5A and CLIC5B (sense: GCGCGAATTCTTTGTGAAGGCTGGAATCGATGGAGA and antisense: GCGCGTCGACCTGGATCGGCTGAGGCGTTTGGCGACATCAG). EcoRI andSalI sites were utilized to clone into EGFP-C2 (Clontech). This construct was transfected with Effectene (Qiagen) into HCA-7 cells, which were grown on glass coverslips overnight. Some cells were treated with 10 μg/ml brefeldin A for 1 h at 37 °C as detailed above. Cells were fixed and stained as described above. AKAP350 interacts with several signaling proteins including protein phosphatase 1, protein kinase N, protein phosphatase 2A (8Takahashi M. Shibata H. Shimakawa M. Miyamoto M. Mukai H. Ono Y. J. Biol. Chem. 1999; 274: 17267-17274Google Scholar), protein kinase Cε (11Takahashi M. Mukai H. Oishi K. Isagawa T. Ono Y. J. Biol. Chem. 2000; 275: 34592-34596Google Scholar) and Type II protein kinase A (Fig.1 A) (7Schmidt P.H. Dransfield D.T. Claudio J.O. Hawley R.G. Trotter K.W. Milgram S.L. Goldenring J.R. J. Biol. Chem. 1999; 274: 3055-3066Google Scholar, 8Takahashi M. Shibata H. Shimakawa M. Miyamoto M. Mukai H. Ono Y. J. Biol. Chem. 1999; 274: 17267-17274Google Scholar). To investigate further the function of AKAP350 as a scaffolding protein, we performed a yeast two-hybrid screen of a rabbit parietal cell library. We screened the library with a 3.2-kb segment of AKAP350, previously termed the PHR (7Schmidt P.H. Dransfield D.T. Claudio J.O. Hawley R.G. Trotter K.W. Milgram S.L. Goldenring J.R. J. Biol. Chem. 1999; 274: 3055-3066Google Scholar) because of its weak homology (41% similarity) with the centrosomal protein, pericentrin (Fig.1 A). One positive clone was identified as a full-length cDNA of the rabbit homologue of human CLIC1 (NCC27) (GenBankTM accession number U93205). Subsequent yeast two-hybrid binary assays confirmed the interaction of rabbit CLIC1 with the PHR of AKAP350. The rabbit CLIC1 sequence and deletion constructs of the PHR of AKAP350 were used in yeast two-hybrid binary assays to map the rabbit CLIC1 binding site in AKAP350. The CLIC binding region of AKAP350 was limited to a 133-amino acid region between amino acids 1388 and 1515 of AKAP350 (Fig. 1 B). To characterize the CLIC/AKAP350 interaction, coimmunoprecipitation experiments were performed using a rabbit polyclonal anti-CLIC antibody, 656. This antibody was chosen for its ability to recognize a range of CLIC family members. The antibody was developed against a region of the carboxyl terminus of the avian CLIC, p62, and is known to recognize avian p62, bovine p64 (17Schlesinger P.H. Blair H.C. Teitelbaum S.L. Edwards J.C. J. Biol. Chem. 1997; 272: 18636-18643Google Scholar), and human CLIC1 and CLIC4. 2J. C. Edwards, unpublished results. Fig.2 A demonstrates that, in extracts of HCA-7 cells, the pan-CLIC 656 antibody recognized major bands of 31, 32, and 46 kDa as well as a minor band at 85 kDa. Beads with only anti-rabbit antibody or beads coated with the anti-pan-CLIC antibody, 656, were incubated with 1% Nonidet P-40 extracts from HCA-7 human colon adenocarcinoma cells. The bound protein was separated by SDS-PAGE and subjected to Western blot analysis with the monoclonal anti-AKAP350 antibody, 14G2. The anti-CLIC antibody 656 specifically immunoprecipitated AKAP350 when compared with beads coated only with anti-rabbit antibody (Fig. 2 B). The Western blot analysis with antibody 656 confirmed that it did not recognize AKAP350 (data not shown). These biochemical data confirmed the in situassociation of AKAP350 with a CLIC family member in HCA-7 cells. As noted in Fig. 2 A, the 656 pan-CLIC antibody recognized at least four discrete proteins in HCA-7 cells. The 31- and 32-kDa bands could represent CLIC1 and CLIC4 because of their apparent molecular mass and the known ability of the 656 antibody to cross-react with CLIC1 and CLIC4.2 Previously, no CLIC protein had been described as migrating at 46 kDa. Another pan-CLIC rabbit polyclonal antibody (121), which recognizes the conserved CLIC carboxyl terminus of CLIC1 (14Berryman M. Bretscher A. Mol. Biol. Cell. 2000; 11: 1509-1521Google Scholar), also recognized a 46-kDa band in HCA-7 cells (data not shown). We employed several specific CLIC antibodies to determine whether they recognized this protein. Antibodies specific for CLIC1 and parchorin did not recognize this protein (data not shown). However, only a polyclonal antibody affinity-purified against CLIC5 (B132) did recognize a 46-kDa band (data not shown). These results suggested that a CLIC5 immunoreactive protein might represent the 46-kDa CLIC species in HCA-7 cells. The high homology between bovine p64 and the more recently documented CLIC5 led us to hypothesize that a CLIC5 splice variant might represent a human homologue of bovine p64 (13Landry D. Sullivan S. Nicolaides M. Redhead C. Edelman A. Field M., Al- Awqati Q. Edwards J. J. Biol. Chem. 1993; 268: 14948-14955Google Scholar, 14Berryman M. Bretscher A. Mol. Biol. Cell. 2000; 11: 1509-1521Google Scholar). Human CLIC5 and bovine p64 show extensive identity in their carboxyl termini but have little similarity in their amino-terminal sequences. We performed a search with the 5′ coding sequence from bovine p64 against genomic BAC sequences containing the human CLIC5 cDNA. This search revealed an alternate initiation site for CLIC5 that is present 65 kb upstream of the published start site of human CLIC5 (Fig.3). Utilizing a sense primer against this putative alternative start site and an antisense primer against the 3′ end of the CLIC5 coding sequence, we were able to amplify a 1230-bp sequence from HCA-7 cell cDNA (Fig. 3). This sequence encodes for a protein with an apparent molecular mass of 46 kDa, corresponding to the molecular weight of the CLIC-immunoreactive band detected by the 656 antibody (Fig. 2 A). We named this protein CLIC5B (GenBankTM accession number AY032602) and have renamed the previously published CLIC5 as CLIC5A (14Berryman M. Bretscher A. Mol. Biol. Cell. 2000; 11: 1509-1521Google Scholar). The only difference between these proteins is found in their first exons. The first exon of CLIC5A encodes for its first 21 amino acids, whereas the first exon of CLIC5B encodes for its first 180 amino acids (Fig. 3 B). Because human CLIC5B shows 72% identity with bovine p64, CLIC5B most likely represents the human homologue of bovine p64. To determine the tissue distribution of these two proteins, Northern blot analysis of 12 different human tissues was performed. Due to the CLIC5 splicing, we designed a CLIC5A-specific probe that included a region of the 5′ untranslated sequence and the unique first exon of CLIC5A. The message size of CLIC5A was consistent with the previously published size of 6.4 kb (14Berryman M. Bretscher A. Mol. Biol. Cell. 2000; 11: 1509-1521Google Scholar) (Fig. 4 A). We found the highest expression in the lung, with a lower level of message in the heart, kidney, and skeletal muscle than previously reported with a probe designed against full-length CLIC5A (13Landry D. Sullivan S. Nicolaides M. Redhead C. Edelman A. Field M., Al- Awqati Q. Edwards J. J. Biol. Chem. 1993; 268: 14948-14955Google Scholar). CLIC5A mRNA was also detected in the colon and placenta upon longer exposure of the blot to film (data not shown). As Berryman and Bretscher (14Berryman M. Bretscher A. Mol. Biol. Cell. 2000; 11: 1509-1521Google Scholar) described, the CLIC5A-specific probe also recognized less intense bands at 3.8 and 2.3 kb in some tissues (data not shown). A probe designed against the unique first exon of CLIC5B was used to evaluate the tissue distribution of CLIC5B. CLIC5B expression was detected only in the small intestine. The CLIC5B mRNA migrated at a slightly higher size (6.6 kb) than CLIC5A (Fig. 4 B). The CLIC family of proteins is defined by their high homology in their carboxyl termini, which contain two conserved putative transmembrane domains (18Valenzuela S.M. Marin D.K. Por S.B. Robbins J.M. Warton K. Bootcov M.R. Schofield P.R. Campbell T.J. Breit S.N. J. Biol. Chem. 1997; 272: 12575-12582Google Scholar). To determine the specificity of AKAP350 binding for members of the CLIC family, clones of human CLIC1, CLIC4, CLIC5A, CLIC5B, and rabbit parchorin (14Berryman M. Bretscher A. Mol. Biol. Cell. 2000; 11: 1509-1521Google Scholar, 16Nishizawa T. Nagao T. Iwatsubo T. Forte J.G. Urushidani T. J. Biol. Chem. 2000; 275: 11164-11173Google Scholar) were paired with AKAP350 in yeast two-hybrid binary assays. Each of these CLIC family members interacted with AKAP350 (Fig.5 A). These results suggested that the conserved carboxyl terminus in the CLIC family contained the binding site for AKAP350 (Fig. 5 A). Constructs containing the first and second halves of the conserved region of CLIC5B were used in yeast two-hybrid binary assays to determine the region responsible for binding to AKAP350. The binding region was contained in the final 120 amino acids of CLIC5B. The entire region was necessary for the binding of AKAP350 to CLIC5B, because any further truncations of this region were unable to bind to AKAP350 (Fig.5 B). This region contains extensive identity in all CLIC family members (Fig. 5 B). In an accompanying paper (19Shanks R.A. Steadman B.T. Schmidt P.H. Goldenring J.R. J. Biol. Chem. 2002; 277: 40967-40972Google Scholar), we have characterized AKAP350A as a Golgi apparatus-specific splice variant of AKAP350. To explore the localization of AKAP350 and CLIC5B, we prepared a goat polyclonal antiserum against CLIC5B-specific peptide sequence. Fig.6 demonstrates that antibodies against CLCI5B detected a single 46-kDa band in fractions of HCA-7 cells with the highest concentrations in heavy microsomes and the high speed supernatant. All CLIC5B immunoreactivity was abolished by incubation with 10 μm competing CLIC5B peptide (data not shown). AKAP350 was also present in these fractions but was also detected in the lighter microsomal fractions. Because the patterns of AKAP350 and CLIC5B immunoreactivity were overlapping but not identical, CLIC5B antibodies were used to stain HCA-7 cells. Fig. 7 Ademonstrates that, although considerable cytosolic staining was observed, CLIC5B immunoreactivity localized to the Golgi with extensive colocalization with the p58 Golgi marker. A pan-CLIC antibody (121) also demonstrated strong staining of the Golgi apparatus (data not shown). Treatment of cells with brefeldin A led to disruption of the Golgi and vesiculation of p58 staining with dispersal of CLIC5B staining into a predominantly cytosolic distribution (Fig.7 A). We also observed colocalization of CLIC5B with AKAP350 staining with the 14G2 monoclonal antibody (Fig. 7 B). Brefeldin A treatment dispersed the Golgi staining by both CLIC5B and AKAP350 antibodies. However, in brefeldin-treated cells, it was also apparent that a small amount of CLIC5B staining was also present at centrosomes in which AKAP350 staining was unaltered by brefeldin treatment (Fig. 7 B). These results demonstrate that CLIC5B localizes predominantly to the Golgi apparatus, with a lesser association with the centrosome. To clarify the localization of CLIC5B with the Golgi apparatus, a GFP-chimera (GFP-CLIC5B-(178–410)) was constructed utilizing amino acids 178–410 of CLIC5B. This region represents the shared exons 2–6 of CLIC5A and CLIC5B (Fig. 4). The HCA-7 cells were then stained with the Golgi apparatus marker p58 (Fig.8). HCA-7 cells expressing GFP-CLIC5B-(178–410) displayed colocalization with the Golgi apparatus. Staining with the anti-AKAP350 14G2 antibody was unchanged in cells expressing this GFP-chimera (data not shown). Treatment of cells with brefeldin A caused dispersal of GFP-CLIC5B-(178–410), confirming its localization to the Golgi apparatus (data not shown). These data suggest that the region coding for exons 2–6 is sufficient for the targeting of CLIC5B to the Golgi apparatus. AKAPs scaffold signaling proteins to specific locations required for specialized functions throughout cells. The signaling proteins associated with an AKAP often define the functions of these scaffolds (5Dodge K. Scott J.D. FEBS Lett. 2000; 476: 58-61Google Scholar). In this report, we have identified the interaction of AKAP350 with CLIC family members, specifically the colocalization of CLIC5B and AKAP350 at the Golgi apparatus of HCA-7 cells. For the first time, these results demonstrate the interaction at the Golgi apparatus of AKAP350 with an effector protein with no known enzymatic activity. In addition, these studies establish a mechanism for the scaffolding of CLIC proteins at discrete locations within the cell. The CLIC protein family consists of seven members, all of which have several common attributes. The family consists of parchorin, bovine p64, and CLIC1-CLIC5. Each protein in this family has a high amino acid homology at the carboxyl-terminal end of the protein. This homologous region consists of ∼200 amino acids and contains a putative hydrophobic membrane-spanning domain. Although expression patterns and localization differ for each of the family members, all of these CLIC proteins associate with membranous organelles. The data presented here suggest that the CLIC5 gene encodes for at least two gene products. Northern blot analysis for CLIC5A and CLIC5B also demonstrated different mRNA expression patterns for these proteins. Multiple message sizes have been reported for CLIC1, CLIC4, CLIC5A, and p64 (13Landry D. Sullivan S. Nicolaides M. Redhead C. Edelman A. Field M., Al- Awqati Q. Edwards J. J. Biol. Chem. 1993; 268: 14948-14955Google Scholar, 14Berryman M. Bretscher A. Mol. Biol. Cell. 2000; 11: 1509-1521Google Scholar, 20Qian Z. Okuhara D. Abe M.K. Rosner M.R. J. Biol. Chem. 1999; 274: 1621-1627Google Scholar, 21Edwards J.C. Am. J. Physiol. 1999; 276: F398-F408Google Scholar, 22Tulk B.M. Edwards J.C. Am. J. Physiol. 1998; 274: F1140-F1149Google Scholar), suggesting that each of the members of this family of proteins contains several multiply spliced species. Because of the high homology among CLIC family members in their carboxyl termini, amino-terminal region splicing events could provide distinguishing characteristics enabling a single gene to encode for proteins with a diverse range of functions. Berryman and Bretscher (14Berryman M. Bretscher A. Mol. Biol. Cell. 2000; 11: 1509-1521Google Scholar) utilized the full-length CLIC5A cDNA as a probe to perform Northern analysis of a multi-tissue blot. To distinguish CLIC5A from CLIC5B, we utilized probes specific for the unique first exons of CLIC5A and CLIC5B. The CLIC5B probe recognized a single 6.6-kb message detectable only in the small intestine. The CLIC5B message was slightly longer than the CLIC5A message of 6.4 kb observed in several tissues (14Berryman M. Bretscher A. Mol. Biol. Cell. 2000; 11: 1509-1521Google Scholar). Interestingly, the CLIC5A-specific probe still recognized other shorter message sizes of 3.8 and 2.3 kb (data not shown), which correlates with the reported mRNA sizes observed with the probe designed against full-length CLIC5A (14Berryman M. Bretscher A. Mol. Biol. Cell. 2000; 11: 1509-1521Google Scholar). These smaller mRNAs could represent shorter message sizes created from splicing events downstream of the first exon. The bovine homologue of CLIC5B (p64) also showed similar multiple message sizes by Northern analysis (13Landry D. Sullivan S. Nicolaides M. Redhead C. Edelman A. Field M., Al- Awqati Q. Edwards J. J. Biol. Chem. 1993; 268: 14948-14955Google Scholar). The differences observed between each of these studies warrants further investigation to determine the functional diversity of CLIC5/p64 splice variants. Previous studies have demonstrated the association of CLIC family members with the cytoskeleton (CLIC5A), nucleus (CLIC3, CLIC1), Golgi apparatus (bovine p64), mitochondria (CLIC4), and the sub-apical membrane compartment (CLIC1, CLIC4, CLIC5A, and parchorin) (13Landry D. Sullivan S. Nicolaides M. Redhead C. Edelman A. Field M., Al- Awqati Q. Edwards J. J. Biol. Chem. 1993; 268: 14948-14955Google Scholar, 14Berryman M. Bretscher A. Mol. Biol. Cell. 2000; 11: 1509-1521Google Scholar, 16Nishizawa T. Nagao T. Iwatsubo T. Forte J.G. Urushidani T. J. Biol. Chem. 2000; 275: 11164-11173Google Scholar,20Qian Z. Okuhara D. Abe M.K. Rosner M.R. J. Biol. Chem. 1999; 274: 1621-1627Google Scholar, 21Edwards J.C. Am. J. Physiol. 1999; 276: F398-F408Google Scholar, 23Fernandez-Salas E. Sagar M. Cheng C. Yuspa S.H. Weinberg W.C. J. Biol. Chem. 1999; 274: 36488-36497Google Scholar). Targeting domains in CLICs responsible for their localization have not been elucidated. The 46-kDa CLIC5B protein appears to be a major immunoreactive CLIC in HCA-7 cells. Immunocytochemical studies demonstrated the predominant localization of CLIC5B immunoreactivity with the Golgi apparatus in HCA-7 cells. CLIC5B, formed through an alternate initiation site of theCLIC5A gene, most likely represents the human homologue of bovine p64. CLIC5B and p64 share 72% identity; p64 was originally isolated from kidney microsomes containing Golgi apparatus markers (13Landry D. Sullivan S. Nicolaides M. Redhead C. Edelman A. Field M., Al- Awqati Q. Edwards J. J. Biol. Chem. 1993; 268: 14948-14955Google Scholar). Interestingly, the region conserved in CLIC5A and CLIC5B (exons 2–6) localized to the Golgi apparatus when overexpressed as a GFP-chimera protein in HCA-7 cells. Therefore, the ability to localize to the Golgi apparatus is at least partially maintained in the conserved region of CLIC5A and CLIC5B. Previous studies have localized CLIC5A predominantly to the supapical compartment (14Berryman M. Bretscher A. Mol. Biol. Cell. 2000; 11: 1509-1521Google Scholar). The first exon of CLIC5A may therefore code for a motif required for Golgi apparatus export or targeting to the apical membrane domain. Although AKAP350 can bind to CLIC5B and could sequester it to the Golgi apparatus, we have shown that AKAP350 can potentially bind to all CLIC family members. Therefore, interactions with AKAP350 may not be sufficient for organelle-specific targeting of CLIC family members. The association of AKAP350 and CLIC5B was affected by structural changes in the Golgi apparatus. In brefeldin A-treated HCA-7 cells, both CLIC5B and AKAP350 staining were dispersed in the cytosol. These data suggest that the structural integrity of the Golgi apparatus is necessary for the association of CLIC5B and AKAP350 with the Golgi cisternae. These results support a model for AKAP350 scaffolding of CLIC5B at the assembled trans-Golgi cisternae. In addition, Western analyses demonstrate a large amount of both CLIC5B and AKAP350 protein in the supernatant fraction after homogenization. These data suggest a dynamic association of CLIC5B with AKAP350, providing a mechanism for the modulation of CLIC function at the Golgi apparatus. Although the function of CLIC5B at the Golgi apparatus is unclear, previous studies have described CLIC family members as independent channels. Harrop et al. (24Harrop S.J. DeMaere M.Z. Fairlie W.D. Reztsova R. Valenzuela S.M. Mazzanti M. Tonini R. Qui M.R. Jankova L. Warton D. Bauskin A.R., Wu, W.M. Pankhurst S. Campbell T.J. Breit S.N. Curni P.M.G. J. Biol. Chem. 2001; 276: 44993-45000Google Scholar) have recently described a 23-amino acid sequence in carboxyl terminus of CLIC1 as a putative transmembrane domain. Indeed, this region is highly conserved among all of the CLIC family members. A mounting volume of evidence describes the CLIC proteins as potential integral membrane proteins that can exist as cytosolic and/or membrane proteins based on a significant conformational change in the amino terminus (24Harrop S.J. DeMaere M.Z. Fairlie W.D. Reztsova R. Valenzuela S.M. Mazzanti M. Tonini R. Qui M.R. Jankova L. Warton D. Bauskin A.R., Wu, W.M. Pankhurst S. Campbell T.J. Breit S.N. Curni P.M.G. J. Biol. Chem. 2001; 276: 44993-45000Google Scholar, 25Tulk B.M. Kapadia S. Edwards J.E. Am. J. Physiol. 2002; 282: C1103-C1112Google Scholar). This new conformation would expose the putative transmembrane domain. The large conformational change required in CLIC1 for the exposure of this domain could require signaling through kinases and phosphatases. Because AKAP350 contains putative binding sites for protein phosphatase 1, protein kinase N, protein phosphatase 2A (8Takahashi M. Shibata H. Shimakawa M. Miyamoto M. Mukai H. Ono Y. J. Biol. Chem. 1999; 274: 17267-17274Google Scholar), protein kinase Cε (11Takahashi M. Mukai H. Oishi K. Isagawa T. Ono Y. J. Biol. Chem. 2000; 275: 34592-34596Google Scholar), phosphodiesterase 4D3 (12Tasken K.A Collas P. Kemmner W.A. Witczak O. Conti M. Tasken K. J. Biol. Chem. 2001; 276: 21999-22002Google Scholar), and protein kinase A (7Schmidt P.H. Dransfield D.T. Claudio J.O. Hawley R.G. Trotter K.W. Milgram S.L. Goldenring J.R. J. Biol. Chem. 1999; 274: 3055-3066Google Scholar, 8Takahashi M. Shibata H. Shimakawa M. Miyamoto M. Mukai H. Ono Y. J. Biol. Chem. 1999; 274: 17267-17274Google Scholar), it is conceivable that these enzymes could play a role in the function of CLIC5B as well as other CLIC family members. Edwards and colleagues (26Edwards J.C. Tulk B. Schlesinger P.H. J. Membr. Biol. 1998; 163: 119-127Google Scholar) have suggested that phosphorylation and dephosphorylation of the CLIC5B bovine homologue, p64, has an effect on its ability to control chloride movement. Further investigations into the function of CLIC5B as a chloride anion channel will have to be completed before it can be determined whether this CLIC protein mediates chloride movement at the Golgi apparatus. Signaling events will likely control the movement and function of the CLIC family of proteins. In this report, we describe the interaction of all CLIC family members with a conserved region found in all AKAP350 splice variants (7Schmidt P.H. Dransfield D.T. Claudio J.O. Hawley R.G. Trotter K.W. Milgram S.L. Goldenring J.R. J. Biol. Chem. 1999; 274: 3055-3066Google Scholar). Therefore, it is possible that other CLIC family members will be scaffolded by AKAP350 in other intracellular locations in particular cell types. Although we have not established that AKAP350 is present wherever CLIC family members are localized, a more comprehensive study of other cell types could lead to the discovery of other AKAP350/CLIC interactions. This interaction is intriguing because of the diversity of localized signaling molecules that AKAP350 can potentially target to control the function of CLICs. Many of the CLIC family members share phosphorylation motifs for enzymes scaffolded by AKAP350. For example CLIC4, p64, CLIC5A, and CLIC5B all share a conserved protein kinase A phosphorylation site in their extreme carboxyl termini (27Martin M.E. Hidalgo J. Vega F.M. Velasco A. J. Cell Sci. 1999; 112: 3869-3878Google Scholar, 28Molloy S.S. Thomas L. Kamibayasi C. Mumby M.C. Thomas G. J. Cell Biol. 1998; 142: 1399-1411Google Scholar). Thus, cAMP-dependent phosphorylation of CLIC proteins by protein kinase A could regulate their distribution and function. In summary, we have described the interaction of CLIC family members with AKAP350. In HCA-7 cells, CLIC5B, the human homologue of bovine p64, colocalizes predominantly with AKAP350 at the Golgi apparatus with lesser localization at the centrosome. This report represents the first demonstration of AKAP350 with a non-enzymatic effector protein at the Golgi apparatus. These studies indicate that AKAP350 not only scaffolds enzymatic signaling molecules but also conveys organelle-specific interactions with non-kinase/phosphatase effector molecules. The relationships between the signaling proteins scaffolded to AKAP350 and CLIC proteins will provide further insights into the function of the CLIC family of proteins and AKAP350 in specific subcellular compartments. We thank Dr. Lynne A. Lapierre for assistance with the yeast two-hybrid work and her intellectual input into this manuscript. Furthermore, we thank Dr. Hank Schmidt for assistance with several of the techniques utilized here." @default.
• W2065569894 created "2016-06-24" @default.
• W2065569894 creator A5003330445 @default.
• W2065569894 creator A5010236925 @default.
• W2065569894 creator A5016128705 @default.
• W2065569894 creator A5019828287 @default.
• W2065569894 creator A5026030880 @default.
• W2065569894 creator A5032831725 @default.
• W2065569894 creator A5071470838 @default.
• W2065569894 date "2002-10-01" @default.
• W2065569894 modified "2023-09-30" @default.
• W2065569894 title "AKAP350 at the Golgi Apparatus" @default.
• W2065569894 cites W1583997555 @default.
• W2065569894 cites W1907395275 @default.
• W2065569894 cites W1965513986 @default.
• W2065569894 cites W1971571944 @default.
• W2065569894 cites W1975197610 @default.
• W2065569894 cites W1980815000 @default.
• W2065569894 cites W1998183313 @default.
• W2065569894 cites W1999138366 @default.
• W2065569894 cites W2042293477 @default.
• W2065569894 cites W2043635727 @default.
• W2065569894 cites W2055317075 @default.
• W2065569894 cites W2066236227 @default.
• W2065569894 cites W2067668425 @default.
• W2065569894 cites W2070038686 @default.
• W2065569894 cites W2070212643 @default.
• W2065569894 cites W2079270852 @default.
• W2065569894 cites W2079593971 @default.
• W2065569894 cites W2091470808 @default.
• W2065569894 cites W2110789463 @default.
• W2065569894 cites W2125159364 @default.
• W2065569894 cites W2126645075 @default.
• W2065569894 cites W2137096206 @default.
• W2065569894 cites W2142746235 @default.
• W2065569894 cites W2156139362 @default.
• W2065569894 cites W2169240396 @default.
• W2065569894 doi "https://doi.org/10.1074/jbc.m112277200" @default.
• W2065569894 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12163479" @default.
• W2065569894 hasPublicationYear "2002" @default.
• W2065569894 type Work @default.
• W2065569894 sameAs 2065569894 @default.
• W2065569894 citedByCount "60" @default.
• W2065569894 countsByYear W20655698942012 @default.
• W2065569894 countsByYear W20655698942013 @default.
• W2065569894 countsByYear W20655698942014 @default.
• W2065569894 countsByYear W20655698942015 @default.
• W2065569894 countsByYear W20655698942016 @default.
• W2065569894 countsByYear W20655698942017 @default.
• W2065569894 countsByYear W20655698942018 @default.
• W2065569894 countsByYear W20655698942019 @default.
• W2065569894 countsByYear W20655698942020 @default.
• W2065569894 countsByYear W20655698942021 @default.
• W2065569894 countsByYear W20655698942023 @default.
• W2065569894 crossrefType "journal-article" @default.
• W2065569894 hasAuthorship W2065569894A5003330445 @default.
• W2065569894 hasAuthorship W2065569894A5010236925 @default.
• W2065569894 hasAuthorship W2065569894A5016128705 @default.
• W2065569894 hasAuthorship W2065569894A5019828287 @default.
• W2065569894 hasAuthorship W2065569894A5026030880 @default.
• W2065569894 hasAuthorship W2065569894A5032831725 @default.
• W2065569894 hasAuthorship W2065569894A5071470838 @default.
• W2065569894 hasBestOaLocation W20655698941 @default.
• W2065569894 hasConcept C119062480 @default.
• W2065569894 hasConcept C158617107 @default.
• W2065569894 hasConcept C185592680 @default.
• W2065569894 hasConcept C86803240 @default.
• W2065569894 hasConcept C95444343 @default.
• W2065569894 hasConceptScore W2065569894C119062480 @default.
• W2065569894 hasConceptScore W2065569894C158617107 @default.
• W2065569894 hasConceptScore W2065569894C185592680 @default.
• W2065569894 hasConceptScore W2065569894C86803240 @default.
• W2065569894 hasConceptScore W2065569894C95444343 @default.
• W2065569894 hasIssue "43" @default.
• W2065569894 hasLocation W20655698941 @default.
• W2065569894 hasOpenAccess W2065569894 @default.
• W2065569894 hasPrimaryLocation W20655698941 @default.
• W2065569894 hasRelatedWork W1968444384 @default.
• W2065569894 hasRelatedWork W2016948813 @default.
• W2065569894 hasRelatedWork W2070194181 @default.
• W2065569894 hasRelatedWork W2094922719 @default.
• W2065569894 hasRelatedWork W2099343588 @default.
• W2065569894 hasRelatedWork W2100588304 @default.
• W2065569894 hasRelatedWork W2342724047 @default.
• W2065569894 hasRelatedWork W3018787070 @default.
• W2065569894 hasRelatedWork W4312213758 @default.
• W2065569894 hasRelatedWork W4383370858 @default.
• W2065569894 hasVolume "277" @default.
• W2065569894 isParatext "false" @default.
• W2065569894 isRetracted "false" @default.
• W2065569894 magId "2065569894" @default.
• W2065569894 workType "article" @default.