FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2065622820> ?p ?o ?g. }

• W2065622820 endingPage "788" @default.
• W2065622820 startingPage "774" @default.
• W2065622820 abstract "EPAC proteins are the guanine nucleotide exchange factors that act as the intracellular receptors for cyclic AMP. Two variants of EPAC genes including EPAC1 and EPAC2 are cloned and are widely expressed throughout the brain. But, their functions in the brain remain unknown. Here, we genetically delete EPAC1 (EPAC1−/−), EPAC2 (EPAC2−/−), or both EPAC1 and EPAC2 genes (EPAC−/−) in the forebrain of mice. We show that EPAC null mutation impairs long-term potentiation (LTP) and that this impairment is paralleled with the severe deficits in spatial learning and social interactions and is mediated in a direct manner by miR-124 transcription and Zif268 translation. Knockdown of miR-124 restores Zif268 and hence reverses all aspects of the EPAC−/− phenotypes, whereas expression of miR-124 or knockdown of Zif268 reproduces the effects of EPAC null mutation. Thus, EPAC proteins control miR-124 transcription in the brain for processing spatial learning and social interactions. EPAC proteins are the guanine nucleotide exchange factors that act as the intracellular receptors for cyclic AMP. Two variants of EPAC genes including EPAC1 and EPAC2 are cloned and are widely expressed throughout the brain. But, their functions in the brain remain unknown. Here, we genetically delete EPAC1 (EPAC1−/−), EPAC2 (EPAC2−/−), or both EPAC1 and EPAC2 genes (EPAC−/−) in the forebrain of mice. We show that EPAC null mutation impairs long-term potentiation (LTP) and that this impairment is paralleled with the severe deficits in spatial learning and social interactions and is mediated in a direct manner by miR-124 transcription and Zif268 translation. Knockdown of miR-124 restores Zif268 and hence reverses all aspects of the EPAC−/− phenotypes, whereas expression of miR-124 or knockdown of Zif268 reproduces the effects of EPAC null mutation. Thus, EPAC proteins control miR-124 transcription in the brain for processing spatial learning and social interactions. EPAC proteins have functional redundancy in the brain EPAC proteins interact with miR-124 via activation of Rap1 miR-124 directly binds to, and inhibits, Zif268 translation Loss of EPAC proteins causes cognitive and social dysfunctions Excitatory transmission at the central synapses is primarily mediated by the amino acid glutamate (Edmonds et al., 1995Edmonds B. Gibb A.J. Colquhoun D. Mechanisms of activation of glutamate receptors and the time course of excitatory synaptic currents.Annu. Rev. Physiol. 1995; 57: 495-519Crossref PubMed Scopus (128) Google Scholar). The efficacy of glutamate transmission can be persistently changed following the specific patterns of neuronal activities (Nicoll and Malenka, 1995Nicoll R.A. Malenka R.C. Contrasting properties of two forms of long-term potentiation in the hippocampus.Nature. 1995; 377: 115-118Crossref PubMed Scopus (658) Google Scholar) and these changes, as seen in long-term potentiation (LTP) and long-term depression (LTD) in the hippocampus, are widely considered as a cellular substrate of spatial learning and memory consolidation (Bliss and Collingridge, 1993Bliss T.V. Collingridge G.L. A synaptic model of memory: long-term potentiation in the hippocampus.Nature. 1993; 361: 31-39Crossref PubMed Scopus (9154) Google Scholar, Malenka and Nicoll, 1999Malenka R.C. Nicoll R.A. Long-term potentiation—a decade of progress?.Science. 1999; 285: 1870-1874Crossref PubMed Scopus (2163) Google Scholar) and typically require rapid new gene expression (Soderling and Derkach, 2000Soderling T.R. Derkach V.A. Postsynaptic protein phosphorylation and LTP.Trends Neurosci. 2000; 23: 75-80Abstract Full Text Full Text PDF PubMed Scopus (433) Google Scholar, Kelleher et al., 2004Kelleher 3rd, R.J. Govindarajan A. Jung H.Y. Kang H. Tonegawa S. Translational control by MAPK signaling in long-term synaptic plasticity and memory.Cell. 2004; 116: 467-479Abstract Full Text Full Text PDF PubMed Scopus (662) Google Scholar). In the brain, a major cellular signaling molecule that is linked with gene expression is cyclic AMP (cAMP) (West et al., 2001West A.E. Chen W.G. Dalva M.B. Dolmetsch R.E. Kornhauser J.M. Shaywitz A.J. Takasu M.A. Tao X. Greenberg M.E. Calcium regulation of neuronal gene expression.Proc. Natl. Acad. Sci. USA. 2001; 98: 11024-11031Crossref PubMed Scopus (805) Google Scholar), which is known to play roles in cognition such as learning and memory formation (Benito and Barco, 2010Benito E. Barco A. CREB's control of intrinsic and synaptic plasticity: implications for CREB-dependent memory models.Trends Neurosci. 2010; 33: 230-240Abstract Full Text Full Text PDF PubMed Scopus (308) Google Scholar, Impey et al., 2004Impey S. McCorkle S.R. Cha-Molstad H. Dwyer J.M. Yochum G.S. Boss J.M. McWeeney S. Dunn J.J. Mandel G. Goodman R.H. Defining the CREB regulon: a genome-wide analysis of transcription factor regulatory regions.Cell. 2004; 119: 1041-1054Abstract Full Text Full Text PDF PubMed Scopus (605) Google Scholar). A classical and direct cellular target of cAMP is protein kinase A (PKA). Another binding substrate of cAMP, called exchange protein directly activated by cAMP (EPAC), has been identified recently (de Rooij et al., 1998de Rooij J. Zwartkruis F.J. Verheijen M.H. Cool R.H. Nijman S.M. Wittinghofer A. Bos J.L. Epac is a Rap1 guanine-nucleotide-exchange factor directly activated by cyclic AMP.Nature. 1998; 396: 474-477Crossref PubMed Scopus (1528) Google Scholar, Kawasaki et al., 1998Kawasaki H. Springett G.M. Mochizuki N. Toki S. Nakaya M. Matsuda M. Housman D.E. Graybiel A.M. A family of cAMP-binding proteins that directly activate Rap1.Science. 1998; 282: 2275-2279Crossref PubMed Scopus (1112) Google Scholar, Zhang et al., 2009Zhang C.L. Katoh M. Shibasaki T. Minami K. Sunaga Y. Takahashi H. Yokoi N. Iwasaki M. Miki T. Seino S. The cAMP sensor Epac2 is a direct target of antidiabetic sulfonylurea drugs.Science. 2009; 325: 607-610Crossref PubMed Scopus (167) Google Scholar). Two variants of EPAC proteins have been cloned: EPAC1 and EPAC2, which are encoded by Rapgef3 and Rapgef4 genes, respectively (Bos, 2006Bos J.L. Epac proteins: multi-purpose cAMP targets.Trends Biochem. Sci. 2006; 31: 680-686Abstract Full Text Full Text PDF PubMed Scopus (425) Google Scholar, Zhang et al., 2009Zhang C.L. Katoh M. Shibasaki T. Minami K. Sunaga Y. Takahashi H. Yokoi N. Iwasaki M. Miki T. Seino S. The cAMP sensor Epac2 is a direct target of antidiabetic sulfonylurea drugs.Science. 2009; 325: 607-610Crossref PubMed Scopus (167) Google Scholar). EPAC proteins have multiple domains consisting of one (EPAC1) or two (EPAC2) cAMP regulatory binding motifs and a guanine nucleotide exchange factor (GEF) (Bos, 2006Bos J.L. Epac proteins: multi-purpose cAMP targets.Trends Biochem. Sci. 2006; 31: 680-686Abstract Full Text Full Text PDF PubMed Scopus (425) Google Scholar). When cAMP binds a regulatory motif, it causes a conformational change of EPAC proteins and hence activates a Ras-like small GTPase Rap1/2 (Rehmann et al., 2003Rehmann H. Prakash B. Wolf E. Rueppel A. de Rooij J. Bos J.L. Wittinghofer A. Structure and regulation of the cAMP-binding domains of Epac2.Nat. Struct. Biol. 2003; 10: 26-32Crossref PubMed Scopus (158) Google Scholar). In the cardiovascular system, EPAC1-Rap1 signaling controls endothelial cell growth and vascular formation (Sehrawat et al., 2008Sehrawat S. Cullere X. Patel S. Italiano Jr., J. Mayadas T.N. Role of Epac1, an exchange factor for Rap GTPases, in endothelial microtubule dynamics and barrier function.Mol. Biol. Cell. 2008; 19: 1261-1270Crossref PubMed Scopus (82) Google Scholar). In the pancreatic β-cells, EPAC2 regulates insulin secretion (Zhang et al., 2009Zhang C.L. Katoh M. Shibasaki T. Minami K. Sunaga Y. Takahashi H. Yokoi N. Iwasaki M. Miki T. Seino S. The cAMP sensor Epac2 is a direct target of antidiabetic sulfonylurea drugs.Science. 2009; 325: 607-610Crossref PubMed Scopus (167) Google Scholar). Both EPAC1 and EPAC2 genes are expressed throughout the brain including the hippocampus, striatum, and prefrontal cortex (Kawasaki et al., 1998Kawasaki H. Springett G.M. Mochizuki N. Toki S. Nakaya M. Matsuda M. Housman D.E. Graybiel A.M. A family of cAMP-binding proteins that directly activate Rap1.Science. 1998; 282: 2275-2279Crossref PubMed Scopus (1112) Google Scholar). But, their neurological functions are yet to be described. In this study, we report that both EPAC1−/− and EPAC2−/− mice are phenotypically normal while double knockout (EPAC−/−) mice exhibit severe deficits in LTP, spatial learning, and social interactions, showing functional redundancy of EPAC proteins in the brain in vivo. Additionally, we identify that EPAC proteins via activation of Rap1 directly interacts with the regulatory element upstream of miR-124 gene and restricts miR-124. We further show that miR-124 directly binds to and inhibits Zif268 translation. These findings reveal an unexpected mechanism by which the mutation of EPAC genes cause cognition and social dysfunctions. Thus, targeting these genes can be considered as a promising strategy for the treatment of some neurological disorders. EPAC1 and EPAC2 proteins are very similar and expressed in largely overlapping patterns throughout the brain (Kawasaki et al., 1998Kawasaki H. Springett G.M. Mochizuki N. Toki S. Nakaya M. Matsuda M. Housman D.E. Graybiel A.M. A family of cAMP-binding proteins that directly activate Rap1.Science. 1998; 282: 2275-2279Crossref PubMed Scopus (1112) Google Scholar), suggesting functional redundancy. To test this idea and explore the in vivo functions of EPAC1 and EPAC2 proteins in the brain, we genetically deleted EPAC1 (EPAC1−/−, Figures 1A–1C ) or EPAC2 (EPAC2−/−, Figures 1D and 1E) or both EPAC1 and EPAC2 genes in the forebrain of mice (EPAC−/−, see Experimental Procedures and Figure 1F). A complete gene deletion in the null alleles was confirmed by RT-PCR and western blot analysis of EPAC1 (Figures 1C and 1F) or EPAC2 (Figures 1E and 1F) mRNA and proteins. Additionally, we demonstrated that a combined deletion of both EPAC1 and EPAC2 genes inactivated the GEFs for Rap1, whereas a single gene deletion (EPAC1−/− or EPAC2−/−) alone had no effect (Figures 1G and 1H), showing a synergistic action between EPAC1 and EPAC2 proteins. We next examined whether EPAC null mutation caused developmental changes or alterations in synaptic structures. We compared the overall synaptic protein compositions (Figure 1I), synaptic spines (Figure 1J), and spine densities (Figure 1K) as well as synaptic vesicles (Figure 1L) among genotypes; we discovered no abnormalities in EPAC−/− alleles. In contrast to our findings, an earlier study suggested that EPAC2 protein was involved in synaptic remodeling via regulation of spine turnover (Woolfrey et al., 2009Woolfrey K.M. Srivastava D.P. Photowala H. Yamashita M. Barbolina M.V. Cahill M.E. Xie Z. Jones K.A. Quilliam L.A. Prakriya M. Penzes P. Epac2 induces synapse remodeling and depression and its disease-associated forms alter spines.Nat. Neurosci. 2009; 12: 1275-1284Crossref PubMed Scopus (122) Google Scholar). However, this previous work was conducted in the in vitro cultured neurons and thus relevance to the in vivo neuronal functions of endogenous EPAC2 protein is questionable. Additionally, we analyzed the series cryostat brain sections (Figures S1A and S1B, available online) from adult mice. As shown for regions (Figure S1C) including the hippocampus, striatum, and the prefrontal cortex known to express EPAC genes, there were no structural deficits in EPAC−/− neurons. We next examined whether EPAC null mutation affects functional state of synapses. We used whole-cell patch-clamp recordings from the CA1 pyramidal neurons blind, with direct comparison of littermates derived from heterozygous mating. In this series of the studies, we first analyzed the evoked excitatory postsynaptic currents (EPSCs) by stimulation of the Schaffer-collateral fibers. Since the peak amplitude of EPSCs at a given stimulation varies from slice to slice, we constructed the input-output curves by plotting the normalized EPSCs amplitude against the stimulus intensities. We found that the evoked EPSCs in response to the elevated stimulus intensities were dramatically reduced in EPAC−/− and inducible (IN-EPAC−/−) neurons, compared to controls (Figure 2A , n = 16 recordings/8 mice). We also examined the spontaneous release of glutamate transmitter (Figure 2B) and demonstrated that the frequency (Figure 2C) but not the mean amplitude (Figure 2D) of the spontaneous EPSCs in EPAC null alleles decreased significantly, compared to the controls (n = 14 recordings/7 mice/group, p < 0.01). In the postsynaptic sites, we analyzed the current-voltage (I-V) relations of the normalized AMPA receptor-mediated (Figure 2E) and NMDA receptor-mediated (Figure 2F) EPSCs. We found that neither the voltage dependence nor the reversal potentials of the evoked EPSCs were altered in EPAC−/− neurons (n = 12 recordings/6 mice/group). Collectively, these findings indicate that EPAC null mutation reduces glutamate release from presynaptic terminals without altering the receptor channel conductance on the postsynaptic sites. To extend analysis of synaptic functions, we examined whether LTP, an activity-dependent long-lasting enhancement of synaptic transmission (Nicoll and Malenka, 1995Nicoll R.A. Malenka R.C. Contrasting properties of two forms of long-term potentiation in the hippocampus.Nature. 1995; 377: 115-118Crossref PubMed Scopus (658) Google Scholar), was altered in EPAC null alleles. In this study, we performed the intracellular sharp electrode recordings of the excitatory postsynaptic potentials (EPSPs) in CA1 pyramidal neurons. We observed that brief high-frequency stimulation (tetanus) increased the peak amplitudes of the evoked EPSPs in control littermates. This increase (LTP) was maintained over 90 min (Figures 2G and 2H, 1.78 ± 0.15, n = 12 recordings/6 mice/group). In EPAC−/− neurons, however, a short-term enhancement but not LTP was found; the peak amplitudes decayed to the basal levels after 30 min of the tetanus (1.05 ± 0.71, n = 14 recordings/7 mice/group, p < 0.01). Similar to CA1 pyramidal neurons, an absence of LTP was observed in the EPAC−/− granule cells (Figure 2H). LTP deficits in EPAC−/− cells was not due to the developmental abnormalities because it was found in the inducible EPAC−/− mice (IN-EPAC−/−), in which EPAC1 gene was deleted after development was completed (1.09 ± 0.79 in CA1 and 1.11 ± 0.68 in the dentate granule cells, respectively; Figures 2G and 2H). It should be mentioned that there was a reduction of synaptic strength in EPAC−/− neurons in response to the elevated stimulus intensities under the basal condition (Figure 2A). Thus, the failure expression of LTP in EPAC−/− mice could be a functional consequence of a general synaptic deficit. To investigate this possibility, we examined the capacity of EPAC−/− neurons for LTD expression by applying 300 stimuli over the course of 3 min. We found that the magnitude of LTD did not differ among groups (Figure 2I). Thus, EPAC null mutation specifically impairs LTP. LTP of synaptic transmission in the hippocampus is widely considered as a cellular substrate of spatial learning and memory formation (Nicoll and Malenka, 1995Nicoll R.A. Malenka R.C. Contrasting properties of two forms of long-term potentiation in the hippocampus.Nature. 1995; 377: 115-118Crossref PubMed Scopus (658) Google Scholar, Kessels and Malinow, 2009Kessels H.W. Malinow R. Synaptic AMPA receptor plasticity and behavior.Neuron. 2009; 61: 340-350Abstract Full Text Full Text PDF PubMed Scopus (692) Google Scholar). Thus, we asked whether the deficits of LTP, particularly in its late phase, were paralleled with the abnormalities in spatial information acquisition. To answer this question, we carried out the Morris water maze tests. Prior to the tests, we tested the exploratory activity and locomotion of mice in the open field. We measured the floor plane movements (Figure 3A ) and vertical plane entries (i.e., rearing, Figure 3B) as well as the stereotypic behaviors (i.e., grooming, Figure 3C) and found that all parameters examined were normal in EPAC null alleles (n = 16 mice per group). We next trained adult male mice in the hidden platform version of the Morris water maze with four trials per day. Consistent with previous studies using pharmacological reagents (Ouyang et al., 2008Ouyang M. Zhang L. Zhu J.J. Schwede F. Thomas S.A. Epac signaling is required for hippocampus-dependent memory retrieval.Proc. Natl. Acad. Sci. USA. 2008; 105: 11993-11997Crossref PubMed Scopus (59) Google Scholar), we found that EPAC null mutant mice had a significant longer latency and swim path length to reach the platform, compared to the other groups (Figure 3D, n = 16 mice/group, p < 0.01). At the end of the training, we placed mice for a one-day probe trial, in which the platform in the water maze was removed and mice were allowed to search the pool for 60 s. Our data demonstrated that all groups, but not EPAC null mutants, had preference searching in the targeting quadrant (Figure 3E, n = 16 mice/group), showing the spatial learning and memory deficits in EPAC null alleles. To further analyze the capacity of the spatial information acquisition, the same groups of mice were tested in the reversal water maze training, in which the hidden platform in the maze was placed to the opposite quadrant. We found that EPAC null mutants had longer latency to find new platform location (Figure 3F, n = 16 mice/group, p < 0.01) and spent less time in a newly trained quadrant (Figure 3G, n = 16 mice/group, p < 0.01). This finding indicates that EPAC null alleles had abnormal reversal learning. In the visible platform version of the water maze test, however, all mice showed the similar latencies to find the platform (Figure 3H, n = 16 mice/group, p < 0.01). Thus, the spatial learning and memory deficits were not associated with the abnormal gross performance in EPAC null alleles. EPAC genes are expressed in the hippocampus and in all other regions of the forebrain (Kawasaki et al., 1998Kawasaki H. Springett G.M. Mochizuki N. Toki S. Nakaya M. Matsuda M. Housman D.E. Graybiel A.M. A family of cAMP-binding proteins that directly activate Rap1.Science. 1998; 282: 2275-2279Crossref PubMed Scopus (1112) Google Scholar). Thus, EPAC null mutation may have effects on the other categories of behaviors. For this consideration, we examined the social approach and preference of mice for exploring two different types of stimuli (the unfamiliar mouse and the unfamiliar object) in an automated three-chamber apparatus, as previously described (Silverman et al., 2010Silverman J.L. Yang M. Lord C. Crawley J.N. Behavioural phenotyping assays for mouse models of autism.Nat. Rev. Neurosci. 2010; 11: 490-502Crossref PubMed Scopus (878) Google Scholar). In this test, we used adult male mice at 90 ± 2 days old. We showed that EPAC null alleles spent only half as much time as other groups in the mouse side (Figure 3I) and in sniffing the unfamiliar mice (Figure 3J, n = 15 mice/group, p < 0.01). These data indicate that EPAC null mutation impairs the social behaviors. We next asked whether this impairment of social interactions occurs in EPAC null alleles at the younger age. We carried out the juvenile play tests using the postnatal mice at 21 days old. In each of the tests, two unfamiliar male mice were paired for 30 min sessions of play in the arena. Consistent with the social deficits observed during the adulthood, the juvenile EPAC null alleles had fewer nose-to-nose sniffing (Figure 3K, n = 18 mice per group, p < 0.01), front approach (Figure 3L, n = 18 mice per group, p < 0.01), and push/crawl (Figure 3M, n = 18 mice per group, p < 0.01) to their pairs, compared to the age-matched control mice. Spatial learning and social behaviors are a complex of physiological responses that are involved in a variety of transcriptional and translational events (Soderling and Derkach, 2000Soderling T.R. Derkach V.A. Postsynaptic protein phosphorylation and LTP.Trends Neurosci. 2000; 23: 75-80Abstract Full Text Full Text PDF PubMed Scopus (433) Google Scholar, Kelleher et al., 2004Kelleher 3rd, R.J. Govindarajan A. Jung H.Y. Kang H. Tonegawa S. Translational control by MAPK signaling in long-term synaptic plasticity and memory.Cell. 2004; 116: 467-479Abstract Full Text Full Text PDF PubMed Scopus (662) Google Scholar). To determine which of these events are linked with EPAC null mutation, we examined small (∼21–23 nucleotides), noncoding RNA transcripts (miRNAs), which are known to negatively regulate the learning capacities via restricting mRNA translation (Bartel, 2004Bartel D.P. MicroRNAs: genomics, biogenesis, mechanism, and function.Cell. 2004; 116: 281-297Abstract Full Text Full Text PDF PubMed Scopus (27032) Google Scholar, He and Hannon, 2004He L. Hannon G.J. MicroRNAs: small RNAs with a big role in gene regulation.Nat. Rev. Genet. 2004; 5: 522-531Crossref PubMed Scopus (5194) Google Scholar, Schratt et al., 2006Schratt G.M. Tuebing F. Nigh E.A. Kane C.G. Sabatini M.E. Kiebler M. Greenberg M.E. A brain-specific microRNA regulates dendritic spine development.Nature. 2006; 439: 283-289Crossref PubMed Scopus (1368) Google Scholar). We conducted the miRNA arrays with a total of 785 probe sets to compare the expression of miRNAs in the forebrain of EPAC−/− mice with the control littermates. Combined with qPCR analysis we found a number of brain-enriched miRNAs that were significantly altered in EPAC−/− mice (Figures 4A and 4B , n = 12 assays/6 mice/group); three were massively upregulated whereas three were downregulated (Figure 4A and 4B, n = 12 assays/6 mice/group). Of these miRNAs, miR-124 is of particularly interest because of its ability to coordinate synaptic functions in memory consolidation (Rajasethupathy et al., 2009Rajasethupathy P. Fiumara F. Sheridan R. Betel D. Puthanveettil S.V. Russo J.J. Sander C. Tuschl T. Kandel E. Characterization of small RNAs in Aplysia reveals a role for miR-124 in constraining synaptic plasticity through CREB.Neuron. 2009; 63: 803-817Abstract Full Text Full Text PDF PubMed Scopus (309) Google Scholar, Fischbach and Carew, 2009Fischbach S.J. Carew T.J. MicroRNAs in memory processing.Neuron. 2009; 63: 714-716Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar, Arvanitis et al., 2010Arvanitis D.N. Jungas T. Behar A. Davy A. Ephrin-B1 reverse signaling controls a posttranscriptional feedback mechanism via miR-124.Mol. Cell. Biol. 2010; 30: 2508-2517Crossref PubMed Scopus (52) Google Scholar). miR-124 binds to a complementary sequence (GUGCCU) in the mRNA 3′-untranslated region (3′UTR) and facilitates the mRNA degradation (Lim et al., 2005Lim L.P. Lau N.C. Garrett-Engele P. Grimson A. Schelter J.M. Castle J. Bartel D.P. Linsley P.S. Johnson J.M. Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs.Nature. 2005; 433: 769-773Crossref PubMed Scopus (3786) Google Scholar). To search for the specific mRNA targets of miR-124 in EPAC−/− mice, we carried out a genome-wide gene expression analysis with 36,422 probe sets (Figure S2). We identified 11 genes that were significantly altered in EPAC−/− mice (Figure 4C, also see Figure S2). The most notable gene was Zif268, also known as Egr1; it was dramatically downregulated (Figures 4C–4F, n = 12 assays/6 mice per group). Zif268 encodes a zinc finger transcription factor essential for stabilizing synaptic plasticity and spatial learning (Hall et al., 2000Hall J. Thomas K.L. Everitt B.J. Rapid and selective induction of BDNF expression in the hippocampus during contextual learning.Nat. Neurosci. 2000; 3: 533-535Crossref PubMed Scopus (506) Google Scholar, Jones et al., 2001Jones M.W. Errington M.L. French P.J. Fine A. Bliss T.V. Garel S. Charnay P. Bozon B. Laroche S. Davis S. A requirement for the immediate early gene Zif268 in the expression of late LTP and long-term memories.Nat. Neurosci. 2001; 4: 289-296Crossref PubMed Scopus (697) Google Scholar, Bozon et al., 2003Bozon B. Davis S. Laroche S. A requirement for the immediate early gene zif268 in reconsolidation of recognition memory after retrieval.Neuron. 2003; 40: 695-701Abstract Full Text Full Text PDF PubMed Scopus (262) Google Scholar, Baumgärtel et al., 2008Baumgärtel K. Genoux D. Welzl H. Tweedie-Cullen R.Y. Koshibu K. Livingstone-Zatchej M. Mamie C. Mansuy I.M. Control of the establishment of aversive memory by calcineurin and Zif268.Nat. Neurosci. 2008; 11: 572-578Crossref PubMed Scopus (107) Google Scholar, Renaudineau et al., 2009Renaudineau S. Poucet B. Laroche S. Davis S. Save E. Impaired long-term stability of CA1 place cell representation in mice lacking the transcription factor zif268/egr1.Proc. Natl. Acad. Sci. USA. 2009; 106: 11771-11775Crossref PubMed Scopus (49) Google Scholar). Since Zif268 contains a miR-124 conserved binding site in its 3′UTR region (Figure 4G), we hypothesize that miR-124 binds directly to and inhibits Zif268 mRNA translation. To test this hypothesis, we created a wild-type 3′UTR segment and its mutant of Zif268 and placed these segments into the luciferase reporter system. When coexpressed with miR-124, a wild-type reporter showed significant inhibition (Figure 4H, n = 4), compared to its mutant, demonstrating that miR-124 directly targets to Zif268. To directly determine whether miR-124 inhibition of Zif268 mediates the EPAC−/− phenotypes, we created a saline-formulated, locked-nucleic acid-modified (LNA) antisense oligonucleotide (LNA-miR-124). As a control, we used LNA-negative (LNA-control, or control). We injected 3 μl of LNA-miR-124 (50 mg/ml) or LNA-control directly into the third ventricle of adult mice. Forty-eight hours after the injection, real-time PCR was used to analyze miR-124. We found that LNA-miR-124 induced a stable silencing of miR-124 in the hippocampus and the prefrontal cortex, whereas LNA-control did not (Figure 4I, n = 6 assays/3 mice). Following inhibition of endogenous miR-124, Zif268 mRNA (Figure 4J, n = 6 assays/3 mice), and protein (Figures 4K and 4L, n = 6 assays/3 mice) in EPAC−/− mice were elevated to a level comparable with that in EPAC+/+ mice. Although knockdown of miR-124 produced little effect on synaptic transmission (Figure 5A , n = 10 recordings/5 mice/group), it completely restored the capacity of EPAC−/− neurons to express LTP (Figure 5B, n = 12 recordings/6 mice/group, p < 0.01) and resulted in a significant improvement of spatial learning (Figures 5C–5E, n = 16 mice/group, p < 0.01) and social interactions in both adult (Figures 5F and 5G, n = 16 mice/group, p < 0.01) and juvenile (Figure 5H, n = 18 mice/group, p < 0.01) EPAC−/− mice. Thus, LTP and the behavioral deficits observed in EPAC null alleles can be reversed by knockdown of miR-124. We next investigated whether expression of miR-124 mimics the effects of EPAC null mutation. We constructed type ½ recombinant adeno-associated virus (rAAV1/2) vectors to express miR-124 (rAAV1/2-miR-124, Figure 6A ). As a control, a negative miRNA sequence (GTGTAACACGTCTATACGCCCA, rAAV1/2-control, or control) was expressed. We found that expression of miR-124 in the hippocampus of EPAC+/+ mice reduced the endogenous Zif268 to a level similar to that observed in EPAC−/− mice (Figures 6B and 6C, n = 4, p < 0.01). When miR-124 was expressed in the hippocampus of EPAC−/− mice, however, there was no further decrease of Zif268 (Figure 6C, n = 4, p < 0.01), indicating that EPAC null mutation occludes the inhibitory effects of miR-124 on Zif268 translation. This inhibition was specific since expression of miR-124 had no effect on several other genes (Figure 6B, n = 6, p < 0.01), including cyclic AMP-response element binding protein (CREB) and brain-derived growth factor (BDNF). Importantly, we found that expression of miR-124 did not alter the basal synaptic transmission (Figures 6D and 6E, n = 12 recordings/6 mice/group), but it resulted in a loss of a late phase of LTP (Figures 6F and 6G, n = 15 recordings/5 mice/group, p < 0.01) and disrupted the spatial learning and memory (Figures 6H–6K, n = 15 mice per group, ∗p < 0.01). Notably, however, the social behaviors were normal when miR-124 was expressed in the hippocampus (Figures 6L–6N, n = 15 mice per group). It has been known that the social behaviors are largely processed in the prefrontal cortex of the brain (Walsh et al., 2008Walsh C.A. Morrow E.M. Rubenstein J.L.R. Autism and brain development.Cell. 2008; 135: 396-400Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar, Silverman et al., 2010Silverman J.L. Yang M. Lord C. Crawley J.N. Behavioural phenotyping assays for mouse models of autism.Nat. Rev. Neurosci. 2010; 11: 490-502Crossref PubMed Scopus (878) Google Scholar). We thus expressed miR-124 in this region by injection of the rAAV1/2-miR-124/eGFP virus particles and found it did cause the social behavioral deficits (Figures 6L–6N, n = 15 mice per group). Significantly, miR-124 phenotypes including the deficits of LTP (Figure 6G, n = 12 recordings/6 mice/group, p < 0.01), spatial learning (Figures 6H–6K, n = 15 mice per groups), and social behaviors (Figures 6L–6N, n = 15 mice per groups) can be reproduced by knockdown of endogenous Zif268 using LNA-Zif268 antisense (Figure S3, n = 13 mice per groups). Together, these results demonstrate that miR-124 transcription mediates the EPAC effects in regulation of LTP, spatial learning, and social interactions by controlling Zif268 translation. EPAC proteins activate Rap1 guanine nucleotide exchange factor (de Rooij et al., 1998de Rooij J. Zwartkruis F.J. Verheijen M.H. Cool R.H. Nijman S.M. Wittinghofer A. Bos J.L. Epac is a Rap1 guanine-nucleotide-exchange factor directly activated by cyclic AMP.Nature. 1998; 396: 474-477Crossref PubMed Scopus (1528) Google Schol" @default.
• W2065622820 created "2016-06-24" @default.
• W2065622820 creator A5006012404 @default.
• W2065622820 creator A5008729488 @default.
• W2065622820 creator A5012087376 @default.
• W2065622820 creator A5014154811 @default.
• W2065622820 creator A5033478356 @default.
• W2065622820 creator A5045382404 @default.
• W2065622820 creator A5046003874 @default.
• W2065622820 creator A5056942753 @default.
• W2065622820 creator A5057209439 @default.
• W2065622820 creator A5065036137 @default.
• W2065622820 creator A5065591432 @default.
• W2065622820 creator A5066266457 @default.
• W2065622820 creator A5074120154 @default.
• W2065622820 creator A5075474558 @default.
• W2065622820 creator A5076978793 @default.
• W2065622820 creator A5091830338 @default.
• W2065622820 date "2012-02-01" @default.
• W2065622820 modified "2023-10-18" @default.
• W2065622820 title "EPAC Null Mutation Impairs Learning and Social Interactions via Aberrant Regulation of miR-124 and Zif268 Translation" @default.
• W2065622820 cites W144423133 @default.
• W2065622820 cites W1552458995 @default.
• W2065622820 cites W1821495885 @default.
• W2065622820 cites W1885709862 @default.
• W2065622820 cites W1965456948 @default.
• W2065622820 cites W1974316629 @default.
• W2065622820 cites W1978337436 @default.
• W2065622820 cites W1985333845 @default.
• W2065622820 cites W1990898781 @default.
• W2065622820 cites W2001243727 @default.
• W2065622820 cites W2002012536 @default.
• W2065622820 cites W2003338471 @default.
• W2065622820 cites W2005800358 @default.
• W2065622820 cites W2007477974 @default.
• W2065622820 cites W2015746168 @default.
• W2065622820 cites W2020705596 @default.
• W2065622820 cites W2021885143 @default.
• W2065622820 cites W2022430914 @default.
• W2065622820 cites W2023969596 @default.
• W2065622820 cites W2032848663 @default.
• W2065622820 cites W2034500416 @default.
• W2065622820 cites W2035550082 @default.
• W2065622820 cites W2039141906 @default.
• W2065622820 cites W2040590580 @default.
• W2065622820 cites W2041028158 @default.
• W2065622820 cites W2041733763 @default.
• W2065622820 cites W2043718702 @default.
• W2065622820 cites W2043753178 @default.
• W2065622820 cites W2049511526 @default.
• W2065622820 cites W2053079477 @default.
• W2065622820 cites W2058861807 @default.
• W2065622820 cites W2059117412 @default.
• W2065622820 cites W2059222949 @default.
• W2065622820 cites W2059346427 @default.
• W2065622820 cites W2063716341 @default.
• W2065622820 cites W2069705491 @default.
• W2065622820 cites W2075856578 @default.
• W2065622820 cites W2078037416 @default.
• W2065622820 cites W2089741501 @default.
• W2065622820 cites W2095108567 @default.
• W2065622820 cites W2098277878 @default.
• W2065622820 cites W2107572837 @default.
• W2065622820 cites W2108401127 @default.
• W2065622820 cites W2110358620 @default.
• W2065622820 cites W2110724392 @default.
• W2065622820 cites W2112215250 @default.
• W2065622820 cites W2117391818 @default.
• W2065622820 cites W2128523448 @default.
• W2065622820 cites W2136008443 @default.
• W2065622820 cites W2138473891 @default.
• W2065622820 cites W2148073154 @default.
• W2065622820 cites W2149297993 @default.
• W2065622820 cites W2151423922 @default.
• W2065622820 cites W2157035381 @default.
• W2065622820 cites W2162584238 @default.
• W2065622820 cites W2171833185 @default.
• W2065622820 cites W4211261982 @default.
• W2065622820 doi "https://doi.org/10.1016/j.neuron.2012.02.003" @default.
• W2065622820 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3307595" @default.
• W2065622820 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/22365550" @default.
• W2065622820 hasPublicationYear "2012" @default.
• W2065622820 type Work @default.
• W2065622820 sameAs 2065622820 @default.
• W2065622820 citedByCount "160" @default.
• W2065622820 countsByYear W20656228202012 @default.
• W2065622820 countsByYear W20656228202013 @default.
• W2065622820 countsByYear W20656228202014 @default.
• W2065622820 countsByYear W20656228202015 @default.
• W2065622820 countsByYear W20656228202016 @default.
• W2065622820 countsByYear W20656228202017 @default.
• W2065622820 countsByYear W20656228202018 @default.
• W2065622820 countsByYear W20656228202019 @default.
• W2065622820 countsByYear W20656228202020 @default.
• W2065622820 countsByYear W20656228202021 @default.
• W2065622820 countsByYear W20656228202022 @default.
• W2065622820 countsByYear W20656228202023 @default.
• W2065622820 crossrefType "journal-article" @default.

• next