FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2065634344> ?p ?o ?g. }

• W2065634344 endingPage "41113" @default.
• W2065634344 startingPage "41107" @default.
• W2065634344 abstract "DNA topoisomerase (topo) I is a nuclear enzyme that plays an important role in DNA metabolism. Based on conserved nuclear targeting sequences, four classic nuclear localization signals (NLSs) have been proposed at the N terminus of human topo I, but studies with yeast have suggested that only one of them (amino acids (aa) 150–156) is sufficient to direct the enzyme to the nucleus. In this study, we expressed human topo I fused to enhanced green fluorescent protein (EGFP) in mammalian cells and demonstrated that whereas aa 150–156 are sufficient for nuclear localization, the nucleolar localization requires aa 157–199. More importantly, we identified a novel NLS within aa 117–146. In contrast to the classic NLSs that are rich in basic amino acids, the novel NLS identified in this study is rich in acidic amino acids. Furthermore, this novel NLS alone is sufficient to direct not only EGFP into the nucleus but also topo I; and the EGFP·topo I fusion driven by the novel NLS is as active in vivo as the wild-type topo I in response to the topo I inhibitor topotecan. Together, our results suggest that human topo I carries two independent NLSs that have opposite amino acid compositions. DNA topoisomerase (topo) I is a nuclear enzyme that plays an important role in DNA metabolism. Based on conserved nuclear targeting sequences, four classic nuclear localization signals (NLSs) have been proposed at the N terminus of human topo I, but studies with yeast have suggested that only one of them (amino acids (aa) 150–156) is sufficient to direct the enzyme to the nucleus. In this study, we expressed human topo I fused to enhanced green fluorescent protein (EGFP) in mammalian cells and demonstrated that whereas aa 150–156 are sufficient for nuclear localization, the nucleolar localization requires aa 157–199. More importantly, we identified a novel NLS within aa 117–146. In contrast to the classic NLSs that are rich in basic amino acids, the novel NLS identified in this study is rich in acidic amino acids. Furthermore, this novel NLS alone is sufficient to direct not only EGFP into the nucleus but also topo I; and the EGFP·topo I fusion driven by the novel NLS is as active in vivo as the wild-type topo I in response to the topo I inhibitor topotecan. Together, our results suggest that human topo I carries two independent NLSs that have opposite amino acid compositions. topoisomerase I amino acid(s) nuclear localization signal enhanced green fluorescent protein polymerase chain reaction topotecan Topoisomerase I (topo I)1 regulates DNA topology by making single-strand breaks, allowing strand passage, and then resealing these breaks independent of ATP hydrolysis (1Wang J.C. Annu. Rev. Biochem. 1996; 65: 635-692Crossref PubMed Scopus (2086) Google Scholar). Thus, topo I plays an important role in different aspects of DNA metabolism such as DNA replication, DNA recombination, transcription, and, possibly, DNA repair (2Trowbridge P.W. Roy R. Simmons D.T. Mol. Cell. Biol. 1999; 19: 1686-1694Crossref PubMed Scopus (31) Google Scholar, 3Fleischmann G. Pflugfelder G. Steiner E.K. Javaherian K. Howard G.C. Wang J.C. Elgin S.C. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 6958-6962Crossref PubMed Scopus (188) Google Scholar, 4Nitiss J.L. Nickloff J. Hoekstra M. DNA Damage and Repair. Humana Press Inc., Totowa, NJ1998: 517-537Google Scholar). In addition to its catalytic activity on DNA, the enzyme has been shown to have other activities functioning as a ribonuclease and a kinase (5Rossi F. Labourier E. Forne T. Divita G. Derancourt J. Riou J.F. Antoine E. Cathala G. Brunel C. Tazi J. Nature. 1996; 381: 80-82Crossref PubMed Scopus (287) Google Scholar, 6Rossi F. Labourier E. Gallouzi I.E. Derancourt J. Allemand E. Divita G. Tazi J. Nucleic Acids Res. 1998; 26: 2963-2970Crossref PubMed Scopus (41) Google Scholar, 7Sekiguchi J. Shuman S. Mol. Cell. 1997; 1: 89-97Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar); its kinase activity has been shown to phosphorylate RNA splicing factors (5Rossi F. Labourier E. Forne T. Divita G. Derancourt J. Riou J.F. Antoine E. Cathala G. Brunel C. Tazi J. Nature. 1996; 381: 80-82Crossref PubMed Scopus (287) Google Scholar). Topo I may also play a role in chromatid condensation (8Castano I.B. Brzoska P.M. Sadoff B.U. Chen H. Christman M.F. Genes Dev. 1996; 10: 2564-2576Crossref PubMed Scopus (103) Google Scholar). In lower eukaryotic organisms, topo I seems to be dispensable, in part because of the fact that other topoisomerases can subserve its role in its absence. However, mammalian topo I is essential for cell growth. Furthermore, topo I is a target for clinically important anticancer drugs such as topotecan and SN-38, the metabolic product of CPT-11 (9D'Arpa P. Beardmore C. Liu L.F. Cancer Res. 1990; 50: 6919-6924PubMed Google Scholar). The inhibitors target nuclear topo I and stabilize transient DNA-enzyme complexes, leading to cell death (9D'Arpa P. Beardmore C. Liu L.F. Cancer Res. 1990; 50: 6919-6924PubMed Google Scholar). Human topo I is a 765-aa protein that is exclusively localized to the nucleus because the N-terminal domain of the enzyme carries essential sequences for its nuclear localization (10D'Arpa P. Machlin P.S. Ratrie III, H. Rothfield N.F. Cleveland D.W. Earnshaw W.C. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 2543-2547Crossref PubMed Scopus (261) Google Scholar, 11Stewart L. Ireton G.C. Champoux J.J. J. Biol. Chem. 1996; 271: 7602-7608Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar). Although this N-terminal domain does not seem to contribute to its catalytic activityin vitro, it is essential for its in vivoactivity because the enzyme exerts its functions in the nucleus (12Alsner J. Svejstrup J.Q. Kjeldsen E. Sorensen B.S. Westergaard O. J. Biol. Chem. 1992; 267: 12408-12411Abstract Full Text PDF PubMed Google Scholar, 13Stewart L. Ireton G.C. Parker L.H. Madden K.R. Champoux J.J. J. Biol. Chem. 1996; 271: 7593-7601Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar). Although all nuclear localization signals (NLSs) for nuclear proteins seem to play the same role, i.e. targeting the nucleus, they vary considerably from short peptide motifs to large protein domains (14Nakielny S. Dreyfuss G. Cell. 1999; 99: 677-690Abstract Full Text Full Text PDF PubMed Scopus (655) Google Scholar). The classic peptide motifs are those rich in basic amino acids and are represented by a well known NLS found in SV40 T-antigen (15Kalderon D. Roberts B.L. Richardson W.D. Smith A.E. Cell. 1984; 39: 499-509Abstract Full Text PDF PubMed Scopus (1874) Google Scholar). Based on their conserved amino acid sequences, four putative NLSs have been suggested to be in the N-terminal domain of human topo I (12Alsner J. Svejstrup J.Q. Kjeldsen E. Sorensen B.S. Westergaard O. J. Biol. Chem. 1992; 267: 12408-12411Abstract Full Text PDF PubMed Google Scholar, 16Dingwall C. Laskey R.A. Trends Biochem. Sci. 1991; 16: 478-481Abstract Full Text PDF PubMed Scopus (1713) Google Scholar, 17Boulikas T. Crit. Rev. Eukaryotic Gene Expression. 1993; 3: 193-227PubMed Google Scholar). The first putative NLS (NLS-I) is at aa 59–65, and the other three putative NLSs are clustered at aa 150–198 (NLS-II, aa 150–156; NLS-III, aa 174–180; and NLS-IV, aa 192–198) (see Fig. 1). These NLSs consist of seven amino acids, each characterized by its high content of basic amino acids (16Dingwall C. Laskey R.A. Trends Biochem. Sci. 1991; 16: 478-481Abstract Full Text PDF PubMed Scopus (1713) Google Scholar), and are thereby considered “classic” peptide NLSs (14Nakielny S. Dreyfuss G. Cell. 1999; 99: 677-690Abstract Full Text Full Text PDF PubMed Scopus (655) Google Scholar). Overexpression of human topo I in yeast revealed that a region covering 71 amino acids (aa 140–210) of the N terminus is sufficient to direct the enzyme to the nucleus (12Alsner J. Svejstrup J.Q. Kjeldsen E. Sorensen B.S. Westergaard O. J. Biol. Chem. 1992; 267: 12408-12411Abstract Full Text PDF PubMed Google Scholar). By amino acid alignment, a conserved sequence (PKKIKTE) exists among human and yeast topo I and SV40 T antigen, suggesting that this is sufficient to direct the topo I to the nucleus (12Alsner J. Svejstrup J.Q. Kjeldsen E. Sorensen B.S. Westergaard O. J. Biol. Chem. 1992; 267: 12408-12411Abstract Full Text PDF PubMed Google Scholar). However, it is not known whether this sequence is functional in mammalian cells or whether all these putative NLSs are required for nuclear localization. Furthermore, topo I is predominantly localized in the nucleolus (18Muller M.T. Pfund W.P. Mehta V.B. Trask D.K. EMBO J. 1985; 4: 1237-1243Crossref PubMed Scopus (167) Google Scholar, 24Baker S.D. Wadkins R.M. Stewart C.F. Beck W.T. Danks M.K. Cytometry. 1995; 19: 134-145Crossref PubMed Scopus (45) Google Scholar), but the sequence for this nucleolar localization has not been defined. We have recently shown that overexpression of catalytically active human topo I in mammalian cells can be achieved by fusion to enhanced green fluorescent protein (EGFP) (19Mo Y.-Y. Wang P.C. Beck W.T. Exp. Cell Res. 2000; 256: 480-490Crossref PubMed Scopus (32) Google Scholar). Thus, the EGFP·topo I fusion protein provides a useful tool to examine the subcellular localization of topo I in live cells. Our data revealed that the EGFP·topo I closely associates with chromosomal DNA at both interphase and mitosis (19Mo Y.-Y. Wang P.C. Beck W.T. Exp. Cell Res. 2000; 256: 480-490Crossref PubMed Scopus (32) Google Scholar). Furthermore, our studies also revealed that the N-terminal domain is essential for the enzyme to get into the nucleus, suggesting that the functional NLS of the human topo I is located at the N terminus, consistent with findings in yeast (12Alsner J. Svejstrup J.Q. Kjeldsen E. Sorensen B.S. Westergaard O. J. Biol. Chem. 1992; 267: 12408-12411Abstract Full Text PDF PubMed Google Scholar). To delineate the specific sequences required for topo I to target the nucleus in mammalian cells, we expanded our deletion analysis of its N-terminal domain. To our surprise, as described herein, we found a novel NLS that does not fall into the classic basic peptide motif and is sufficient to direct topo I into the nucleus in mammalian cells. HeLa, COS-7, and NIH 3T3 cells were obtained from ATCC (Manassas, VA) and were grown in Dulbecco's modified Eagle's medium (BioWhittaker, Walkersville, MD). Chinese hamster ovary cells (ATCC) were grown in RPMI. All media were supplemented with 10% fetal bovine serum, 100 units of penicillin/ml, and 100 μg of streptomycin/ml. Cells were incubated at 37 °C in a humidified chamber supplemented with 5% CO2. Plasmids carrying the EGFP·topo I gene were introduced into HeLa cells by the calcium phosphate method as described previously (20Mo Y.-Y. Ameiss K.A. Beck W.T. BioTechniques. 1998; 25: 1052-1057Crossref PubMed Scopus (21) Google Scholar). After transfection, cells were subcultured in 6-well plates with one coverslip in each well and allowed to grow for another 16–24 h before microscopic examination. Transfection of COS-7, NIH 3T3, and Chinese hamster ovary cells was conducted by electroporation, using Electroporator with Extender II (Bio-Rad). Cells at the log phase were trypsinized, harvested, and then resuspended in Dulbecco's modified Eagle's medium without fetal bovine serum at 1 × 107 cells/ml. An aliquot of 0.4 ml of such cell suspension was mixed with 15 μg of plasmid DNA and incubated for 10 min at room temperature. Cells were subjected to an electric pulse (950 microfarads and 220 volts), as suggested by the manufacturer. Expression plasmids used in this study are shown in Fig. 1 and Fig. 7 A. The full-length topo I·EGFP fusion construct (pTI-2) and the N-terminal fusion (pTI-5) have been described previously (19Mo Y.-Y. Wang P.C. Beck W.T. Exp. Cell Res. 2000; 256: 480-490Crossref PubMed Scopus (32) Google Scholar). pTI-2/X1 encompassed aa 1–140 and was constructed by digestion of pTI-2 with EcoRI and partial digestion with XhoI. The topo I fragment with the vector was isolated and purified by Gene Clean II (Bio 101, Vista, CA). The overhanging ends of this fragment were blunted by treatment with mungbean nuclease and then self-ligated in the presence of T4 DNA ligase. For deletions involving other regions of topo I, where no suitable restriction enzyme sites were available in the original topo I cDNA sequence, PCR was performed to introduce appropriate enzyme sites for convenient subcloning. PCR reactions were essentially performed using a standard method (21Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley and Sons, New York1989: 15.1.1-15.1.15Google Scholar). In general, appropriate DNA fragments were first amplified by PCR, cloned into pCR2.1 (Invitrogen, Carlsbad, CA), and then subcloned into the pEGFP-C3 (CLONTECH, Palo Alto, CA). Sequences and positions of the PCR primers are listed in Table I.Table IOligonucleotide primers used in this studyNameSequence 1-aThe nucleotides in bold are either introduced or mutagenized.Position 1-bThe starting methionine as aa 1.I-5.1GGATCCAGTGGGGACCACCTCCAC (s) 1-cs, sense strand; as, antisense strand.2–7I-5.1AGGATCCCACAAAGATGGAAGCTCAG (s)69–74I-5.1BGGATCCAAACCTAAGAAAATTAAAAC (s)148–154I-5.1CGGATCCAGAGACAAGGAAAAACG (s)84–89I-5.1DGGATCCAAGAAGGAGAAGAAAAG (s)158–163I-5.1GGGATCCAAAGATAAAAAAGTTCCTG (s)181–186I-5.1HGGATCCAAAGATGAACCTGAAGAT (s)117–122I-5.1IGGATCCTATTTTGTTCCTCCTAAA (s)125–130I-5.1KGGATCCCGAGATGAGGATGATGTTGATTATCTGCAG (s)140–147I-5.1LCTGCAGAAGAAGGAGAAGAAAAGA (s)158–163I-5.1MCTGCAGAAACCTAAGAAAATTAAAACA (s)148–154I-5.2GGATCCGAAGAGGAACAGAAGTGG (s)198–203I-5.2ACTGCAGGAAGAGGAACAGAAGTGG (s)198–203I-3.1CTAAAACTCATAGTCTTC (as)761–765I-3.2TTACTCTCTTTCTTCGGCTT (as)194–199I-3.2ACTAGGTATCTTCTGTTTTAATTTTC (as)151–157I-3.2BCTACTCAGGAACTTTTTTATCTTT (as)180–186I-3.2CCTGCAGCTCAGGAACTTTTTTATCTTT (as)180–186I-3.3TTAATCAACATCATCCTCATC (as)141–147I-3.3ATTAATCAACTTTTTTCTCATCTCG (as)140–147I-3.3BCTGCAGATAATCAACATCATCCTCATC (as)141–147I-3.3DCTGCAGAAACCTAAGAAAATTAAAACA (as)111–116I-3.4TTAGGTCTTCTCCTTCTCTTTG (as)62–681-a The nucleotides in bold are either introduced or mutagenized.1-b The starting methionine as aa 1.1-c s, sense strand; as, antisense strand. Open table in a new tab pTI-28 carried aa 1–199 with a deletion of aa 148–157 and was constructed as follows. First, a fragment that covers aa 1–147 was amplified by PCR using primers I-5.1 and I-3.3B (where aPstI site was introduced; see Table I); a second fragment that covers aa 158–199 was amplified by primers I-5.1L (where aPstI site was also introduced; TableI) and I-3.2. These two fragments were then ligated and cloned into pEGFP-C3 so that the resultant plasmid (pTI-28) carried the N terminus of topo I with a deletion of aa 148–157. The same strategy was used to construct pTI-29, pTI-31, pTI-32, and pTI-33 using appropriate primer sets. The control vector pT104/B1 has been described previously (22Mo Y.-Y. Beck W.T. Exp. Cell Res. 1999; 25: 50-62Crossref Scopus (34) Google Scholar). Either nuclear extract or total protein was prepared for Western blot as described previously (23Hann C. Evans D.L. Fertala J. Benedetti P. Bjornsti M.A. Hall D.J. J. Biol. Chem. 1998; 273: 8425-8433Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). To detect the expression of the EGFP·topo I fusion proteins, immunoblotting was carried out using antibodies against green fluorescent protein (CLONTECH). Topo I-specific antibody TI-I (24Baker S.D. Wadkins R.M. Stewart C.F. Beck W.T. Danks M.K. Cytometry. 1995; 19: 134-145Crossref PubMed Scopus (45) Google Scholar) was used to detect both endogenous and EGFP·topo I fusion proteins. Immunostaining was carried out as described previously (25Reynolds A.B. Daniel J.M. Mo Y.-Y. Wu J. Zhang Z. Exp. Cell Res. 1996; 225: 328-337Crossref PubMed Scopus (128) Google Scholar), but with a slight modification. In brief, HeLa cells were grown over coverslips in 6-well plates overnight. The cells were fixed in 2% formaldehyde and 0.2% glutaraldehyde in phosphate-buffered saline and permeabilized by 0.2% Triton X-100. After incubation with the primary antibody against Hsp70 (monoclonal, Amersham Pharmacia Biotech), the cells were then incubated with secondary donkey anti-mouse antibody labeled with fluorescein isothiocyanate (Jackson ImmunoResearch, West Grove, PA). The samples were examined by fluorescence microscopy (Carl Zeiss, Thornwood, NY) using a filter with maximum excitation at 480 nm and maximum emission at 520 nm. To detect subcellular localization of EGFP·topo I, cells were subcultured after transfection with an appropriate plasmid in 6-well plates with a coverslip in each well and grown for 16–24 h. When needed, cells were also fixed with cold fixing solution (1% paraformaldehyde in phosphate-buffered saline). For nuclear staining, the fixed cells were incubated with Hoechst dye (1 μg/ml, Sigma) for 15 min at room temperature. Fluorescent signals were revealed under the fluorescence microscope using the filters for EGFP and 4′,6-diamidino-2-phenylindole, respectively. Band depletion and growth inhibition assays have been described previously (19Mo Y.-Y. Wang P.C. Beck W.T. Exp. Cell Res. 2000; 256: 480-490Crossref PubMed Scopus (32) Google Scholar). Our previous studies have shown that the N-terminal domain is essential for human topo I to target the nucleus in HeLa cells (19Mo Y.-Y. Wang P.C. Beck W.T. Exp. Cell Res. 2000; 256: 480-490Crossref PubMed Scopus (32) Google Scholar), and four putative NLSs have been proposed at this region (12Alsner J. Svejstrup J.Q. Kjeldsen E. Sorensen B.S. Westergaard O. J. Biol. Chem. 1992; 267: 12408-12411Abstract Full Text PDF PubMed Google Scholar). To investigate whether any or all of these NLSs are actually functional in mammalian cells, we made a series of deletion mutants for the N-terminal domain (Fig. 1). Expression of those deleted EGFP·topo I fusion constructs was examined by Western blot. As shown in Fig. 2, the fusion proteins were detected at the sizes expected. For instance, we detected an apparent molecular mass of ∼60 kDa for pTI-5, which is in good agreement with its predicted size (Fig. 2). Similarly, we also detected the rest of the fusion proteins roughly within their predicted molecular masses (Fig. 2). Once these fusion constructs were confirmed to be expressed exogenously in HeLa cells, we followed their subcellular localization. Consistent with our previous results (19Mo Y.-Y. Wang P.C. Beck W.T. Exp. Cell Res. 2000; 256: 480-490Crossref PubMed Scopus (32) Google Scholar), cells transfected with pTI-5 (Clone #1 in Fig. 1) displayed green fluorescent protein in the nucleus, and was concentrated in nucleoli (Fig. 3). Consequently, experiments were designed to determine what specific sequences are required for nuclear/nucleolar localization. Among four putative NLSs at the N terminus of human topo I, NLS-I (aa 59–65) is well separated from the other three (aa 150–198; see Fig. 1) (13Stewart L. Ireton G.C. Parker L.H. Madden K.R. Champoux J.J. J. Biol. Chem. 1996; 271: 7593-7601Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar). Thus, we attempted initially to test whether NLS-I plays any role in targeting the nucleus. Hence, we made a fusion construct, pTI-7 (Clone #4, aa 1–146), in such a way that the cloned DNA fragment ended immediately before NLS-II (aa 150–156). The fusion protein encoded by pTI-7 showed exclusively nuclear distribution (Fig. 3), suggesting that a functional NLS exists at aa 1–146, even in the absence of the other three putative NLSs. To determine whether NLS-I (aa 59–65) is responsible for the observed nuclear localization, we made pTI-8 (Clone #2, aa 1–67) that included NLS-I, but we deleted the rest of the sequences (aa 68–146). The fusion protein from pTI-8 revealed cytoplasmic distribution just like that of the vector control (pT104/B1) (Fig. 3), suggesting that NLS-I is not functional for nuclear localization or is not sufficient for it. The presence of a functional NLS at aa 1–146 suggests that human topo I might carry two NLSs, because previous studies suggested that NLS-II (aa 150–156) is important, at least in yeast (12Alsner J. Svejstrup J.Q. Kjeldsen E. Sorensen B.S. Westergaard O. J. Biol. Chem. 1992; 267: 12408-12411Abstract Full Text PDF PubMed Google Scholar). To test whether NLS-II, -III, and -IV are functional in HeLa cells, we made pTI-10 (Clone #5, aa 148–199), with no overlap with pTI-7. As expected, we found that cells transfected with pTI-10 displayed green fluorescent nuclear staining (Fig. 3). Therefore, two functional NLSs exist at the N terminus of human topo I, one located at aa 1–146, and another located at aa 148–199. Importantly, they appear to function independently. Because amino acids 148–199 carry three putative NLSs, we made further deletions to delineate a minimal sequence that is sufficient to support nuclear localization. We first made pTI-27 (Clone #7, aa 148–187) that includes NLS-II and -III but lacks NLS-IV. As seen for pTI-10, the fusion protein from pTI-27 displayed nuclear staining (Fig. 4), suggesting that NLS-IV is not essential. To test the role of NLS-II in nuclear localization, we deleted NLS-II from pTI-10 (aa 148–199), resulting in pTI-13 (Clone #6, aa 157–199). Although pTI-10 retained nuclear localization capability, a deletion involving NLS-II (pTI-13) abolished its ability to target the nucleus (Fig. 4). These results indicate that NLS-II (aa 150–156) has the capability of nuclear targeting. To further determine whether NLS-II alone is sufficient to support nuclear localization, a peptide (KPKKIKTED) was fused to EGFP (pTI-26, Clone #8). As expected, cells transfected with pTI-26 clearly revealed nuclear localization (Fig. 4). These results indicate that although three putative NLSs are clustered at aa 148–199, in HeLa cells, NLS-II is the only functional one among them and that neither NLS-III nor NLS-IV is important for nuclear localization. Topo I has been shown to be predominantly in the nucleolus (18Muller M.T. Pfund W.P. Mehta V.B. Trask D.K. EMBO J. 1985; 4: 1237-1243Crossref PubMed Scopus (167) Google Scholar). Consistent with this finding, the fusion protein from pTI-5 was detected in the nucleus and particularly concentrated in the nucleolus (Figs. 3 and 4). To further confirm that the green fluorescent particles observed in pTI-5-transfected cells (Fig. 3) are nucleoli, we immuno-stained HeLa cells with an antibody specific to Hsp70, a well known protein that is localized to the nucleolus when cells are under heat stress (28Vincent M. Tanguay R.M. Nature. 1979; 281: 501-503Crossref PubMed Scopus (62) Google Scholar, 29Morcillo G. Gorab E. Tanguay R.M. Diez J.L. Exp. Cell Res. 1997; 236: 361-370Crossref PubMed Scopus (22) Google Scholar). The staining patterns by the anti-Hsp70 antibody were basically identical to those of EGFP staining by pTI-5 (Fig. 4 B), suggesting that the green fluorescent particles seen in cells transfected with pTI-5 are localized in nucleoli. Heat shock treatment did not change the nucleolar localization pattern of pTI-5. Cells transfected with pTI-10 revealed both nuclear and nucleolar localization, similar to pTI-5 (Figs. 3 and 4), suggesting that the signal for nucleolar localization resided at aa 150–199. Further deletion analyses support this notion, because both pTI-26 and pTI-27 resulted only in nuclear but not nucleolar localization of the fusion proteins (Fig. 4 A). Therefore, although neither NLS-III nor NLS-IV is required for nuclear localization, at least NLS-IV is important for nucleolar localization. Data from Figs. 3 and 4 indicated that the N terminus of human topo I carries multiple NLSs that function independently. More importantly, NLS at aa 1–146 might be novel, because NLS-I within this region does not appear to play such a role (Fig. 3). To better understand this potential novel NLS, we first made pTI-2/X1 (Clone #3), which carried only aa 1–140, because previous studies suggested that the sequence covering aa 1–140 lacked nuclear targeting ability in yeast (12Alsner J. Svejstrup J.Q. Kjeldsen E. Sorensen B.S. Westergaard O. J. Biol. Chem. 1992; 267: 12408-12411Abstract Full Text PDF PubMed Google Scholar). As shown in Fig. 5, we found that green fluorescent protein encoded by pTI-2/X1 was predominantly distributed in the cytoplasm, consistent with the previous results (12Alsner J. Svejstrup J.Q. Kjeldsen E. Sorensen B.S. Westergaard O. J. Biol. Chem. 1992; 267: 12408-12411Abstract Full Text PDF PubMed Google Scholar), although we occasionally observed a few cells with the green fluorescent protein in the nucleus (<5%). Compared with pTI-2/X1, pTI-7 carries an additional six amino acids (DEDDAD, aa 141–146), suggesting that these six amino acids play an important role in targeting the nucleus. To test whether the sequence DEDDAD alone is sufficient to target the nucleus, we fused this fragment to pEGFP-C3 (pTI-16, Clone #13) and found that the fusion protein from this clone carried no functional NLS (Fig. 5), suggesting that the sequence DEDDAD alone is not sufficient to function as an NLS. It is obvious that the sequence DEDDAD is rich in acidic amino acids, in contrast to classic monopartite NLSs that are rich in basic amino acids (14Nakielny S. Dreyfuss G. Cell. 1999; 99: 677-690Abstract Full Text Full Text PDF PubMed Scopus (655) Google Scholar). To further delineate the sequence that carries a potential novel NLS, we first tested the effect of deletion of NLS-I on its nuclear localization, and thus we made pTI-9 (Clone #9, aa 69–146) in which NLS-I (aa 59–65) was excluded. The fusion protein from pTI-9 was localized to the nucleus (Fig. 5), as seen for pTI-7 (aa 1–146), indicating that NLS-I plays no role in targeting the nucleus. To determine the minimal sequence for the novel NLS, we made a series of deletion constructs: pTI-17 (Clone #10, aa 84–146), pTI-18 (Clone #11, aa 117–146), and pTI-20 (Clone #12, aa 125–146). We observed nuclei stained with green fluorescent protein in the cells transfected with pTI-17 and pTI-18 (Fig. 5 A), as seen for pTI-7 (Fig. 5 A). A further deletion involving aa 117–125,i.e. pTI-20, drastically reduced the nuclear localization capability of the fusion protein, resulting in a predominant cytoplasmic distribution of the fusion protein (Fig. 5 A). These results suggest that the minimal sequence for the novel NLS is located within aa 117–146. Because aa 117–146 are an essential part of the novel NLS that alone is sufficient for nuclear import (Fig. 5 A), these amino acids were used to search for amino acid homology. As shown in Fig. 5 B, this sequence was found in topo I of mice, Chinese hamsters and chickens, in addition to humans, with an almost perfect match (26Tanizawa A. Beitrand R. Kohlhagen G. Tabuchi A. Jenkins J. Pommier Y. J. Biol. Chem. 1993; 268: 25463-25468Abstract Full Text PDF PubMed Google Scholar, 27Koiwai O. Yasui Y. Sakai Y. Watanabe T. Ishii K. Yanagihara S. Andoh T. Gene. 1993; 125: 211-216Crossref PubMed Scopus (24) Google Scholar). A high homology was also found with topo I of frogs (Fig. 5 B). Interestingly, the yeast or Drosophilatopo I lacks this sequence. Because the six amino acids (DEDDAD, aa 141–146) are important for nuclear localization and are highly acidic, we thought that it would be interesting to determine whether there is any effect on the subcellular localization of the fusion protein by mutations of this region. Thus, DD at aa 143–144 in this sequence was replaced by KK, thus representing a double point mutation (pTI-19, Clone #14). Indeed, whereas pTI-18 retained its functional NLS, pTI-19 lost the ability to target the nucleus, displaying cytoplasmic distribution (Fig. 5 A), suggesting that these two aspartic acids play an important role in nuclear targeting. Although the fusion proteins from pTI-7, -9, -17, and -18 were localized in the nucleus, they showed little nucleolar green fluorescent staining (Fig. 5). This is in contrast to that of pTI-5, which was mostly localized in the nucleolus, suggesting that the novel NLS either plays no role in nucleolar localization or is not sufficient to do so. To test whether the novel NLS can replace NLS-II for nucleolar accumulation in the presence of NLS-III and -IV, we made a fusion construct, pTI-28 (Clone #15; see Fig. 1), in which NLS-II was deleted from pTI-5. Transfection of HeLa cells with pTI-28 revealed a similar nucleolar accumulation to that of pTI-5 (Fig. 4 A). These results indicated that NLS-II is not required for nuclear/nucleolar localization of the fusion protein if the novel NLS is present with NLS-III and NLS-IV. To further test the effect of the novel NLS on nuclear/nucleolar localization of the full-length topo I, we made three deletion constructs (pTI-31, pTI-32, and pTI-33) as seen in Fig. 6 A. pTI-31 carried the full-length topo I with a deletion of NLS-II (Δ aa 148–157); pTI-32 carried the full-length topo I with a deletion of the novel NLS (Δ aa 117–146); and pTI-33 carried the full-length topo I with a deletion of NLS-IV (Δ aa 188–198). Although not all pTI-2-transfected cells displayed nucleolar localization (Fig. 6 B), which is consistent with our previous results (19Mo Y.-Y. Wang P.C. Beck W.T. Exp. Cell Res. 2000; 256: 480-490Crossref PubMed Scopus (32) Google Scholar), like pTI-2, pTI-31 and pTI-32 resulted in a similar ratio of nucleolar localization (∼50%), calculated from 200 transfected cells for each plasmid. These results suggest that the novel NLS can replace NLS-II for nucleolar localization. To determine the role of NLS-IV in nucleolar localization, we deleted NLS-IV from pTI-28, resulting in pTI-29 (Clone #16; see Fig. 1). Like pTI-27, the fusion protein from pTI-29 displayed only nucle" @default.
• W2065634344 created "2016-06-24" @default.
• W2065634344 creator A5059498891 @default.
• W2065634344 creator A5067921099 @default.
• W2065634344 creator A5077954031 @default.
• W2065634344 date "2000-12-01" @default.
• W2065634344 modified "2023-10-16" @default.
• W2065634344 title "A Novel Nuclear Localization Signal in Human DNA Topoisomerase I" @default.
• W2065634344 cites W1497849975 @default.
• W2065634344 cites W1533516721 @default.
• W2065634344 cites W1582272319 @default.
• W2065634344 cites W1593864150 @default.
• W2065634344 cites W1925850732 @default.
• W2065634344 cites W192877506 @default.
• W2065634344 cites W1968375984 @default.
• W2065634344 cites W1968923197 @default.
• W2065634344 cites W1973052124 @default.
• W2065634344 cites W1980730914 @default.
• W2065634344 cites W1994422429 @default.
• W2065634344 cites W2002493222 @default.
• W2065634344 cites W2003028412 @default.
• W2065634344 cites W2006758809 @default.
• W2065634344 cites W2007232880 @default.
• W2065634344 cites W2032640145 @default.
• W2065634344 cites W2033722975 @default.
• W2065634344 cites W2035270220 @default.
• W2065634344 cites W2040000960 @default.
• W2065634344 cites W2043044660 @default.
• W2065634344 cites W2053025410 @default.
• W2065634344 cites W2054760667 @default.
• W2065634344 cites W2061301880 @default.
• W2065634344 cites W2070439383 @default.
• W2065634344 cites W2081427703 @default.
• W2065634344 cites W2083703133 @default.
• W2065634344 cites W2086725260 @default.
• W2065634344 cites W2090378536 @default.
• W2065634344 cites W2091129135 @default.
• W2065634344 cites W2106925642 @default.
• W2065634344 cites W2114045127 @default.
• W2065634344 cites W2126615528 @default.
• W2065634344 cites W2129493754 @default.
• W2065634344 cites W2133933241 @default.
• W2065634344 cites W2136007486 @default.
• W2065634344 cites W2149565889 @default.
• W2065634344 cites W2154774247 @default.
• W2065634344 cites W2163584895 @default.
• W2065634344 cites W38643767 @default.
• W2065634344 cites W4236530034 @default.
• W2065634344 cites W4248002052 @default.
• W2065634344 doi "https://doi.org/10.1074/jbc.m003135200" @default.
• W2065634344 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11016921" @default.
• W2065634344 hasPublicationYear "2000" @default.
• W2065634344 type Work @default.
• W2065634344 sameAs 2065634344 @default.
• W2065634344 citedByCount "50" @default.
• W2065634344 countsByYear W20656343442012 @default.
• W2065634344 countsByYear W20656343442013 @default.
• W2065634344 countsByYear W20656343442014 @default.
• W2065634344 countsByYear W20656343442016 @default.
• W2065634344 countsByYear W20656343442018 @default.
• W2065634344 countsByYear W20656343442022 @default.
• W2065634344 countsByYear W20656343442023 @default.
• W2065634344 crossrefType "journal-article" @default.
• W2065634344 hasAuthorship W2065634344A5059498891 @default.
• W2065634344 hasAuthorship W2065634344A5067921099 @default.
• W2065634344 hasAuthorship W2065634344A5077954031 @default.
• W2065634344 hasBestOaLocation W20656343441 @default.
• W2065634344 hasConcept C104317684 @default.
• W2065634344 hasConcept C115960442 @default.
• W2065634344 hasConcept C12554922 @default.
• W2065634344 hasConcept C147897179 @default.
• W2065634344 hasConcept C153911025 @default.
• W2065634344 hasConcept C185592680 @default.
• W2065634344 hasConcept C24586158 @default.
• W2065634344 hasConcept C49805395 @default.
• W2065634344 hasConcept C552990157 @default.
• W2065634344 hasConcept C55493867 @default.
• W2065634344 hasConcept C70721500 @default.
• W2065634344 hasConcept C86803240 @default.
• W2065634344 hasConcept C95444343 @default.
• W2065634344 hasConceptScore W2065634344C104317684 @default.
• W2065634344 hasConceptScore W2065634344C115960442 @default.
• W2065634344 hasConceptScore W2065634344C12554922 @default.
• W2065634344 hasConceptScore W2065634344C147897179 @default.
• W2065634344 hasConceptScore W2065634344C153911025 @default.
• W2065634344 hasConceptScore W2065634344C185592680 @default.
• W2065634344 hasConceptScore W2065634344C24586158 @default.
• W2065634344 hasConceptScore W2065634344C49805395 @default.
• W2065634344 hasConceptScore W2065634344C552990157 @default.
• W2065634344 hasConceptScore W2065634344C55493867 @default.
• W2065634344 hasConceptScore W2065634344C70721500 @default.
• W2065634344 hasConceptScore W2065634344C86803240 @default.
• W2065634344 hasConceptScore W2065634344C95444343 @default.
• W2065634344 hasIssue "52" @default.
• W2065634344 hasLocation W20656343441 @default.
• W2065634344 hasOpenAccess W2065634344 @default.
• W2065634344 hasPrimaryLocation W20656343441 @default.
• W2065634344 hasRelatedWork W1502950372 @default.

• next