FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2065762983> ?p ?o ?g. }

• W2065762983 endingPage "31494" @default.
• W2065762983 startingPage "31483" @default.
• W2065762983 abstract "A tobacco calcium/calmodulin-binding protein kinase (NtCBK1) was isolated and identified. The predicted NtCBK1 protein has 599 amino acids, an N-terminal kinase domain, and shares high homology with other calmodulin (CaM)-related kinases. Whereas NtCBK1 phosphorylates itself and substrates such as histone IIIS and syntide-2 in the absence of CaM, its kinase activity can be stimulated by tobacco CaMs. However, unlike another tobacco protein kinase designated NtCBK2, NtCBK1 was not differentially regulated by the different CaM isoforms tested. The CaM-binding domain of NtCBK1 was located between amino acids 436 and 455, and this domain was shown to be necessary for CaM modulation of kinase activity. RNA in situ hybridization showed that NtCBK1 was highly regulated in the transition to flowering. Whereas NtCBK1 mRNA was accumulated in the shoot apical meristem during vegetative growth, its expression was dramatically decreased in the shoot apical meristem after floral determination, and in young flower primordia. The expression of NtCBK1 was up-regulated to high levels in floral organ primordia. Fluctuations in NtCBK1 expression were verified by analysis of tobacco plants expressing green fluorescent protein under the control of the NtCBK1 promoter, suggesting a role of NtCBK1 in the transition to flowering. This conclusion was confirmed by overexpressing NtCBK1 in transgenic tobacco plants, where maintenance of high levels of NtCBK1 in the shoot apical meristem delayed the switch to flowering and extended the vegetative phase of growth. Further work indicated that overexpression of NtCBK1 in transgenic tobacco did not affect the expression of NFL, a tobacco homologue of the LFY gene that controls meristem initiation and floral structure in tobacco. In addition, the promotion of tobacco flowering time by DNA demethylation cannot be blocked by the overexpression of NtCBK1. A tobacco calcium/calmodulin-binding protein kinase (NtCBK1) was isolated and identified. The predicted NtCBK1 protein has 599 amino acids, an N-terminal kinase domain, and shares high homology with other calmodulin (CaM)-related kinases. Whereas NtCBK1 phosphorylates itself and substrates such as histone IIIS and syntide-2 in the absence of CaM, its kinase activity can be stimulated by tobacco CaMs. However, unlike another tobacco protein kinase designated NtCBK2, NtCBK1 was not differentially regulated by the different CaM isoforms tested. The CaM-binding domain of NtCBK1 was located between amino acids 436 and 455, and this domain was shown to be necessary for CaM modulation of kinase activity. RNA in situ hybridization showed that NtCBK1 was highly regulated in the transition to flowering. Whereas NtCBK1 mRNA was accumulated in the shoot apical meristem during vegetative growth, its expression was dramatically decreased in the shoot apical meristem after floral determination, and in young flower primordia. The expression of NtCBK1 was up-regulated to high levels in floral organ primordia. Fluctuations in NtCBK1 expression were verified by analysis of tobacco plants expressing green fluorescent protein under the control of the NtCBK1 promoter, suggesting a role of NtCBK1 in the transition to flowering. This conclusion was confirmed by overexpressing NtCBK1 in transgenic tobacco plants, where maintenance of high levels of NtCBK1 in the shoot apical meristem delayed the switch to flowering and extended the vegetative phase of growth. Further work indicated that overexpression of NtCBK1 in transgenic tobacco did not affect the expression of NFL, a tobacco homologue of the LFY gene that controls meristem initiation and floral structure in tobacco. In addition, the promotion of tobacco flowering time by DNA demethylation cannot be blocked by the overexpression of NtCBK1. Calcium (Ca2+) plays important roles as a second messenger in plant developmental and physiological processes via a group of Ca2+ target proteins, including CaM and Ca2+-dependent protein kinases (CDPKs), 1The abbreviations used are: CDPK, Ca2+-dependent protein kinase; CaMK, calcium/CaM-dependent protein kinase; CBK, CaM-binding protein kinase; CCaMK, chimeric CaM-dependent protein kinase; GFP, green fluorescent protein; Ni-NTA, nickel-nitrilotriacetic acid; FITC, fluorescein isothiocyanate; SAM, shoot apical meristem. 1The abbreviations used are: CDPK, Ca2+-dependent protein kinase; CaMK, calcium/CaM-dependent protein kinase; CBK, CaM-binding protein kinase; CCaMK, chimeric CaM-dependent protein kinase; GFP, green fluorescent protein; Ni-NTA, nickel-nitrilotriacetic acid; FITC, fluorescein isothiocyanate; SAM, shoot apical meristem. two well known Ca2+-binding proteins (1Chin D. Means A.R. Trends Cell Biol. 2000; 10: 322-328Google Scholar, 2Harmon A.C. Gribskov M. Harper J.F. Trends Plant Sci. 2000; 5: 154-159Google Scholar). CaM is ubiquitously expressed and has no enzymatic activity of its own. The activities and expression patterns of a variety of CaM-binding proteins including calcium/CaM-dependent protein kinases (CaMKs) are key players in Ca2+/CaM-mediated signaling pathways in plants (3Braun A.P. Schulman H. Annu. Rev. Physiol. 1995; 57: 417-445Google Scholar, 4Snedden W.A. Fromm H. New Phytol. 2001; 151: 35-66Google Scholar, 5Zhang L. Lu Y.-T. Trends Plant Sci. 2003; 8: 123-127Google Scholar). In contrast to animal systems, there are only a few reports on CaM-binding protein kinases (CBKs) in plants. To date, CBKs have been isolated from apple (CB1, a homolog of mammalian CaMK II, 6), maize (MCKs, 7, 8), rice (OsCBK, 9), and chimeric CaM-dependent protein kinases (CCaMKs) from lily, tobacco, and maize (10Takezawa D. Ramachndiran S. Paranjape V. Poovaiah B.W. J. Biol. Chem. 1996; 271: 8126-8132Google Scholar, 11Ramachandiran S. Takezawa D. Wang W. Poovaiah B.W. J. Biochem. (Tokyo). 1997; 121: 984-990Google Scholar, 12Liu Z. Xia M. Poovaiah B.W. Plant Mol. Biol. 1998; 38: 889-897Google Scholar). Whereas all of these CBKs have been shown to have CaM binding activity, only tobacco NtCBK2, rice OsCBK2, and CCaMKs have been shown experimentally to possess kinase activity. CCaMKs have been shown to have a visinin-like domain and three EF-hand motifs that are necessary for Ca2+-dependent autophosphorylation and for maximal activation (10Takezawa D. Ramachndiran S. Paranjape V. Poovaiah B.W. J. Biol. Chem. 1996; 271: 8126-8132Google Scholar, 11Ramachandiran S. Takezawa D. Wang W. Poovaiah B.W. J. Biochem. (Tokyo). 1997; 121: 984-990Google Scholar, 12Liu Z. Xia M. Poovaiah B.W. Plant Mol. Biol. 1998; 38: 889-897Google Scholar). The enzymatic activity of OsCBK, on the other hand, was found to be independent of either calcium or CaM (9Zhang L. Liu B.F. Liang S.P. Jones R.L. Lu Y.-T. Biochem. J. 2002; 368: 145-157Google Scholar). Considerable attention has recently been paid to the analyses of the expression profiles of plant CBKs (5Zhang L. Lu Y.-T. Trends Plant Sci. 2003; 8: 123-127Google Scholar, 13Reddy V.S. Ali G.S. Reddy A.S. J. Biol. Chem. 2002; 277: 9840-9852Google Scholar). These analyses have indicated that CCaMKs, MCKs, and OsCBK are regulated temporally and spatially during various stages of plant development (8Wang L. Liang S.P. Lu Y.-T. Planta. 2001; 213: 556-564Google Scholar, 9Zhang L. Liu B.F. Liang S.P. Jones R.L. Lu Y.-T. Biochem. J. 2002; 368: 145-157Google Scholar, 12Liu Z. Xia M. Poovaiah B.W. Plant Mol. Biol. 1998; 38: 889-897Google Scholar, 14Poovaiah B.W. Xia M. Liu Z. Wang W. Yang T. Sathyanarayanan P.V. Franceschi V.R. Planta. 1999; 209: 161-171Google Scholar), as well as by environmental triggers such as light. For example, red light down-regulates the expression of maize ZmCCaMK (15Pandey S. Sopory S.K. J. Exp. Bot. 2001; 52: 691-700Google Scholar). It has also been reported that overexpression of maize MCK1 in tobacco leads to the abortion of flower primordia on the main shoot axis, implying a role for MCK1 in flower development (16Liang S. Wang X.-F. Lu Y.-T. Sci. Chin. 2001; 44: 506-512Google Scholar). Because little information is available about the roles of CBKs, their biological functions remain to be elucidated. The transition from vegetative to reproductive growth is a key event in the life cycle of plants. The transition has been intensively studied (17Mouradov A. Cremer F. Coupland G. Plant Cell. 2002; 14: S111-S130Google Scholar), and the regulatory networks controlling the process are perhaps best understood in Arabidopsis (18Levy Y.Y. Dean C. Plant Cell. 1998; 10: 1973-1989Google Scholar, 19Yanovsky M.J. Kay S.A. Nat. Rev. 2003; 4: 265-275Google Scholar). Environmental factors, including photoperiod (day length), light quality (spectral composition), light quantity (photon flux density), cold temperature (vernalization), and nutrient and water availability play important roles in flowering time control in Arabidopsis (20Simpson G.G. Dean C. Science. 2002; 296: 285-289Google Scholar). Not all plants use the same environmental triggers to bring about a change from vegetative to reproductive growth. For example, tobacco shows important differences in its flowering response when compared with Arabidopsis. Tobacco flowers in response to internal cues, such as plant size or number of vegetative nodes (18Levy Y.Y. Dean C. Plant Cell. 1998; 10: 1973-1989Google Scholar), and the duration of the vegetative phase is independent of day length, and regulated by as yet unidentified developmental signals (21McDaniel C.N. J. Exp. Bot. 1996; 47: 465-475Google Scholar, 22McDaniel C.N. Sangrey K.A. Singer S.R. Am. J. Bot. 1989; 76: 403-408Google Scholar). An example of the type of developmental signal that can regulate flowering time comes from overexpression of the Antirrhinum gene CENTRORADIALIS in tobacco, which brings about an extension of the vegetative growth phase and delays the switch to flowering (23Amaya I. Ratcliffe O.J. Bradley D.J. Plant Cell. 1999; 11: 1405-1417Google Scholar). Further investigations on exactly which events mark the transition to flowering and their regulation is needed (24Hempel F.D. Feldman L.J. Plant J. 1995; 8: 725-731Google Scholar). Protein kinases have been shown to be involved in many cellular processes, including regulation of metabolism, transcription, cell cycle progression, cytoskeletal rearrangement and cell movement, apoptosis, differentiation, and responses to a variety of stimuli (25Schenk P.W. Snaar-Jagalska B.E. Biochim. Biophys. Acta. 1999; 1449: 1-24Google Scholar, 26Manning G. Whyte D.B. Martinez R. Hunter T. Sudarsanam S. Science. 2002; 298: 1912-1934Google Scholar). Several protein kinases, such as protein kinase CK2 and never in mitosis A (NIMA)-like kinase, have been reported to be involved in the regulation of flowering plants. Protein kinase CK2, interacting with circadian clock-associated 1, has been shown to play an important role in the regulation of the circadian clock in Arabidopsis. Plants overexpressing CKB3, a regulatory subunit of CK2, increases CK2 activity, resulting in reduced flowering time (27Sugano S. Andronis C. Ong M.S. Green R.M. Tobin E.M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12362-12366Google Scholar, 28Sugano S. Andronis C. Ong M.S. Green R.M. Wang Z.Y. Tobin E.M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 11020-11025Google Scholar). NIMA-like kinase, on the other hand, interacts with 14-3-3 proteins and SELF-PRUNING, a member of a family of modulator proteins, to regulate tomato shoot architecture and flowering (29Pnueli L. Gutfinger T. Hareven D. Ben-Naim O. Ron N. Adir N. Lifschitz E. Plant Cell. 2001; 13: 2687-2702Google Scholar). Here we present evidence for a role of the tobacco Ca2+/CaM-binding protein kinase NtCBK1 in flowering. NtCBK1 is identified as a CBK based on molecular and biochemical evidence. NtCBK1 binds CaM in a Ca2+-dependent manner and phosphorylates both itself and substrates. Whereas kinase activity assays indicate that this kinase has enzymatic activity in the absence of CaM, this activity can be stimulated up to 5-fold by CaM. The expression of NtCBK1 in the shoot apical meristem is highly regulated during the transition to flowering as shown by both RNA in situ hybridization and transgenic analyses with GFP driven by the NtCBK1 promoter. Transgenic tobacco plants overexpressing NtCBK1 display a late-flowering phenotype, suggesting that NtCBK1 could function as a negative regulator of flowering. Further work indicated that overexpression of NtCBK1 did not affect flowering by influencing either the expression of NFL, a tobacco homologue of LFY that controls meristem initiation and floral structure, or by blocking demethylation, a treatment that promotes flowering in tobacco. Tobacco CDNA Library Screening—mRNAs were isolated from tobacco (Nicotiana tabaccum cv. W38) and used for cDNA library construction with a ZAP-cDNA synthesis kit following the manufacturer's instructions (Stratagene). The cDNA library was screened with plasmid p550 containing a maize cDNA encoding MCK1 (7Lu Y.T. Hidaka H. Feldman L.J. Planta. 1996; 199: 18-24Google Scholar). Positive recombinant phages for NtCBK1 were isolated and excised into recombinant pBluescript SK(–) in vivo and candidate plasmids were sequenced. Construction of NtCBK1 and Truncated NtCBK1—To define the CaM-binding domain, several truncated constructs were made with the pFastHTb expression vector (Fig. 2A). The cDNAs for the full open reading frame (NtCBK1) and three truncated forms (T1–455, T1–416, and T436–599) of NtCBK1 were amplified with 4 pairs of primers as follows: 5′ primer CGGGATCCATGGGGCACTGCTGCAGTAAGG and 3′ primer CGGGATCCTTATCGATGATGTCTTGTGCTTGAACC for NtCBK1; 5′ primer CGGGATCCATGGGGCACTGCTGCAGTAAGG and 3′ primer CGGGATCCTTAGAGGTAGATTAACTCTTC for T1–455; 5′ primer CGGGATCCATGGGGCACTGCTGCAGTAGG and 3′ primer CGGGATCCTTATAAAACAGGATTTTCCGTCC for T1–416; 5′ primer CGGGATCCAAACGTGCAGCATTGAAGGCTC and 3′ primer CGGGATCCTTATCGATGATGTCTTGTGCTTGAACC for T436–599. Whereas T1–455 contains the N terminus of NtCBK1, including the kinase catalytic domain, and a tentative CaM-binding domain, T1–416 has the same N-terminal amino acid sequence as T1–455, but lacks the tentative CaM-binding domain. The third truncated form, T436–599, contains the C terminus of NtCBK1 and the tentative CaM-binding domain. PCR products were digested with BamHI and subsequently cloned into the BamHI site of plasmid pFastHTb. After sequencing confirmation, recombinant plasmids were transformed into DH10Bac-competent cells containing the bacmid with a mini-att Tn7 target site and helper plasmid. The mini-Tn7 element on the pFastHTb donor plasmid can transpose to the mini-att Tn7 element on the bacmid in the presence of transposition proteins provided by the helper plasmid. Clones containing recombinant bacmid were identified based on the disruption of the lacZ gene. The Sf9 cells were maintained as monolayers at 27 °C supplemented with Grace's medium containing 10% fetal bovine serum and transfected by the recombinant bacmid with Cellfectin reagent according to the manufacturer's instructions (Invitrogen). Recombinant virus was harvested after 72 h and identified by PCR with the primers described above. Purification of NtCBK1 Proteins—Insect Sf9 cells were infected with the recombinant virus for 72 h and harvested at room temperature. Cells were washed once with Grace's medium, resuspended in 5 ml of lysis buffer (50 mm Tris-HCl, pH 7.5, 10% glycerol, 1% Nonidet P-40, 0.2 mm phenylmethanesulfonyl fluoride), sonicated for 30 s, and centrifuged at 12,000 × g for 10 min. The supernatant was applied to a Ni-NTA resin column pre-equilibrated with buffer A (50 mm potassium phosphate, pH 6.0, 300 mm KCl, 10% glycerol). After extensive washing with buffer A followed by buffer A containing 25 mm imidazole, NtCBK1 was eluted with buffer A containing 200 mm imidazole. The eluted NtCBK1 was dialyzed in 25 mm Tris-HCl, pH 7.5, supplemented with 0.5 mm CaCl2 for about 6 h, and loaded on a CaM-Sepharose 4B (Amersham Biosciences) column pre-equilibrated with buffer B (25 mm Tris-HCl, pH 7.5, 2 mm CaCl2). After washing with buffer B plus 200 mm NaCl, elution of NtCBK1 was with buffer C (25 mm Tris-HCl, pH 7.5, 2 mm EGTA). After dialysis in 25 mm Tris-HCl, pH 7.5, for 6 h, purified NtCBK1 was either used immediately or stored at –80 °C prior to SDS-PAGE or enzymatic analyses. Protein concentration was determined by quantification of tryptophan in NtCBK1 (30Aitken A. Learmonth M. Walker J.M. Protein Protocols Handbook. 2nd Ed. Humana Press, Totowa, NJ2002: 41-44Google Scholar). All procedures were performed at 4 °C unless stated otherwise. Preparation of 35S-Labeled and Biotinylated CaM—Tobacco calmodulin (NtCaM1/3/13) cDNAs cloned into the pET15 expression vectors (a gift from Dr. Y. Ohashi, National Institute of Agrobiological Sciences) (31Yamakawa H. Mitsuhara I. Ito N. Seo S. Kamada H. Ohashi Y. Eur. J. Biochem. 2001; 268: 3916-3929Google Scholar) were used to prepare 35S-labeled CaM as described previously (32Fromm H. Chua N.-H. Plant Mol. Biol. 1992; 10: 199-206Google Scholar, 33Lu Y.T. Harrington H.M. Plant Physiol. Biochem. 1994; 32: 413-422Google Scholar). Bovine CaM was biotinylated as described by Billingsley et al. (34Billingsley M.L. Pennypacker K.R. Hoover C.G. Brigati D.J. Kincaid R.L. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 7585-7589Google Scholar). Briefly, bovine CaM was dialyzed overnight at 4 °C against 0.1 m phosphate buffer, pH 7.4. The bovine CaM was supplemented with 1 mm CaCl2 and incubated with d-biotinoyl-ϵ-amidocaproic acid-N-hydroxysuccinimide ester (Sigma) dissolved in N,N-dimethylformamide at a final concentration of 1 mm. The incubation was performed for 2 h at 4 °C with constant stirring. The biotinylated CaM was further dialyzed in 0.1 m phosphate buffer, pH 7.4, for 48 h at 4 °C, measured with bovine serum albumin as standard (35Bradford M.M. Anal. Biochem. 1976; 72: 248-254Google Scholar) and stored in 20% glycerol at –20 °C. CaM Binding Assay—NtCBK1 and its truncated forms were separated by SDS-PAGE and blotted onto a polyvinylidene difluoride membrane. For biotinylated CaM binding assays, the membrane was blocked in 2% bovine serum albumin/Tris-buffered saline (50 mm Tris-HCl, pH 7.5, 200 mm NaCl, 50 mm MgCl2, plus 0.5 mm CaCl2 or 2 mm EGTA) and washed three times with Tris-buffered saline for 15 min each. After incubation in Tris-buffered saline containing biotinylated CaM for 3 h at room temperature and then washing with Tris-buffered saline, the membrane was treated with avidin-horseradish peroxidase conjugate (Bio-Rad) dissolved in Tris-buffered saline for 1 h. Protein bound to biotinylated CaM was visualized by color development with 4-chloro-1-naphthol and H2O2. Assay of NtCBK1 CaM Binding Affinity—CaM binding affinity was assayed as described (9Zhang L. Liu B.F. Liang S.P. Jones R.L. Lu Y.-T. Biochem. J. 2002; 368: 145-157Google Scholar, 10Takezawa D. Ramachndiran S. Paranjape V. Poovaiah B.W. J. Biol. Chem. 1996; 271: 8126-8132Google Scholar). Briefly, purified NtCBK1 protein (4 pmol) separated by SDS-PAGE was electrophoretically transferred onto nitrocellulose filters and incubated with different concentrations of 35S-labeled CaM (0.5 × 106 cpm/μg) in 1 mm CaCl2 overnight. After washing with 25 mm Tris-HCl, pH 7.5, 50 mm NaCl, and 1 mm CaCl2, the radioactivities of the bound CaM on each filter, and free CaM in the incubation buffer collected before washing, were measured by liquid scintillation counting (Beckman LS 6500). Average background counts were subtracted from the counts in NtCBK1 protein samples when calculating the specific binding. The dissociation constant Kd was calculated by using SPSS EnzymeKinetics software (SPSS Science, Inc.). The data points are expressed as means of the results from three independent assays in duplicate. Autophosphorylation of NtCBK1—Autophosphorylation was carried out in a 100-μl reaction mixture containing 25 mm Tris-HCl, pH 7.5, 0.5 mm dithiothreitol, 10 mm magnesium acetate, 100 μm ATP, 10 μCi of [γ-32P]ATP (5000 Ci/mmol) plus 0.5 mm CaCl2 or 0.5 mm CaCl2, 1 μm CaM at 30 °C. For time course assays, 1 μg of NtCBK1 was used in a 100-μl reaction mixture. Aliquots for the zero time point were taken immediately after the addition of NtCBK1 and the reactions were terminated by adding ⅕ volume of 5× SDS-PAGE sample buffer. All aliquots were separated by SDS-PAGE with a 10% separating gel. After staining with 0.1% Coomassie Brilliant Blue, gels were vacuum-dried and exposed to x-ray film at –80 °C. The amount of phosphate transferred to the enzyme was determined by counting the radioactivities of the excised NtCBK1 bands in a liquid scintillation counter. Experiments were repeated three times in duplicate. Substrate Phosphorylation Assay—Substrate phosphorylation assays were performed in a 100-μl reaction mixture containing 25 mm Tris-HCl, pH 7.5, 0.5 mm dithiothreitol, 10 mm magnesium acetate, 100 μm ATP, 10 μCi of [γ-32P]ATP (5000 Ci/mmol), 100 μm histone IIIS, or 100 μm syntide-2 plus 0.5 mm CaCl2 or 0.5 mm CaCl2,1 μm CaM with 1 μg of NtCBK1 at 30 °C. For time course assays with histone IIIS as substrate, aliquots for the zero time point were taken immediately after the addition of NtCBK1 and the reaction was terminated by adding ⅕ volume of 5× SDS-PAGE sample buffer. Aliquots were separated and counted as described above. The experiments were repeated three times in duplicate. For time course assays with syntide-2 as substrate, the experiments with two parallel reactions for different treatments were repeated three times. Aliquots for the zero time point were taken immediately after the addition of NtCBK1 to initiate the reaction and the reaction was terminated by adding ⅕ volume of 5× SDS-PAGE sample buffer. Aliquots from one reaction were separated by SDS-PAGE with a 10% separating gel. The amount of phosphates transferred to the kinase was determined by counting the radioactivities of the excised NtCBK1 bands in a liquid scintillation counter. Aliquots from another reaction were applied to P81 phosphocellulose filters (2 × 2 cm squares, Whatman) for total 32P incorporation of the kinase and syntide-2. Filters were washed four times for 10 min each in 75 mm phosphoric acid, and rinsed in 100% ethanol and then air-dried. 32P incorporation was determined by liquid scintillation counting. The amount of phosphates transferred to substrate syntide-2 was determined by subtracting 32P incorporation of NtCBK1 from total 32P incorporation of NtCBK1 plus syntide-2. Activation Assay of NtCBK1 by NtCaM Isoforms—The reaction for NtCBK1 substrate phosphorylation was performed as described above. Aliquots (10 μl) were removed and applied to P81 phosphocellulose filters (2 × 2 cm squares, Whatman). Filters were washed four times for 10 min each in 75 mm phosphoric acid and rinsed in 100% ethanol and air-dried. 32P incorporation was determined by liquid scintillation counting (Beckman LS 6500). The experiments were repeated three times in duplicate. Phosphoamino Acid Assays—Both NtCBK1 and autophosphorylated NtCBK1 were hydrolyzed in 6 m HCl for 12 h at 110 °C, dried, and dissolved in 20 μl of 10 mm borate buffer, pH 10.0. The hydrolyzed product was mixed with 20 μl of 1 mm fluorescein isothiocyanate (FITC, dissolved in acetone containing 0.05% pyridine, Sigma) and incubated in the dark for 12 h at room temperature. To prepare FITC-tagged standard amino acids and phosphoamino acids, 2 μl of standard solution containing each amino acid and phosphoamino acid (0.5 mm each) was mixed with 46 μl of 1 mm FITC, 100 μl of 20 mm borate buffer, pH 10.0, and 52 μl of H2O. The mixture was incubated in the dark for 12 h at room temperature. FITC-tagged amino acids were analyzed by capillary electrophoresis as described (36Liu B.-F. Zhang L. Lu Y.-T. J. Chromatogr. Sect. A. 2001; 918: 401-409Google Scholar). Data were collected on a computer with Spot Advanced software, and processed further with Scion Image and Origin software packages. RNA in Situ Hybridization and Detection—Tissues of tobacco were fixed in 4% paraformaldehyde, dehydrated in an ethanol series, cleared with xylene, and embedded in paraffin as described by Drews (37Drews G.N. Fixation and Embedding for in Situ Hybridization in Arabidopsis Molecular Genetics Course. Cold Spring Harbor Press, New York1995Google Scholar). Paraffin-embedded tissues were cut into 10-μm sections, which were attached to glass microscope slides coated with polylysine hydrobromide. Digoxigenin-labeled antisense and sense RNA probes for NtCBK1 were used for in situ hybridization analyses with paraffin-embedded tissue sections. The experiments were performed as described previously (8Wang L. Liang S.P. Lu Y.-T. Planta. 2001; 213: 556-564Google Scholar). Cloning of NtCBK1 Promoter—The NtCBK1 promoter region was isolated with an in vitro PCR cloning kit (TaKaRa Biotechnology, Shiga, Japan). Ten micrograms of tobacco genomic DNA was digested with the HindIII restriction enzyme, ligated with the HindIII cassette, and amplified by PCR according to the manufacturer's instructions. PCR products were cloned into the pBI101-GFP vector, and the resulting plasmid was named pNtCBK1:GFP. Genetic Transformation and Flowering Time Examination—The NtCBK1 cDNA was obtained by PCR with primers: 5′ primer CGGATCCTGAAGTGGACTTTGACTGGCCG, and 3′ primer CGGATCCTTATCGATGATGTCTTGTGCTTGAAC, using pNtCBK1 as template and cloned into pBluescript SK(–). The BamHI-digested DNA fragment was then cloned into the BamHI site of pBIm that was made by adding three restriction digestion sites and deleting the GUS sequence of pBI121 and confirmed by DNA sequencing. Then, both the construct and pBI121 were transferred into Agrobacterium tumifaciens strain LBA4404 and introduced into tobacco. For NtCBK1 RNAi constructs, the coding sequences of either NtCBK1 or NtCBK2 were amplified by PCR and double inserted into BamHI or Xho/SacI sites with different orientations of pBIi that was made by placing the fourth intron of Arabidopsis tubby-like protein into the BamHI/XhoI site of pBIm. Regenerated kanamycin-resistant transgenic plants were transferred to soil and grown in the greenhouse. When the terminal flower was formed, all of the nodes on the primary shoot below the terminal flower were counted. For the transgenic plants that never flowered, the number of nodes per shoot was recorded by counting the number of leaves on the primary shoot from the last leaf (1 cm long) produced to the most basal leaf. Flowering time (days to flowering) was calculated from seed sowing to the time when the first petals opened. DNA and RNA Gel Blot Analysis—DNA was extracted from tobacco leaves by using cetyltrimethylammonium bromide. 20 μg of DNA was digested with EcoRV and separated by agarose gel electrophoresis. RNA was prepared by using TRIzol (Invitrogen). For each sample, 20 μg of RNA was loaded onto an RNA gel. Both DNA and RNA were transferred to nylon membranes and hybridized with the probe for NtCBK1 that was synthesized by random primer extension (Promega). Hybridization was done under high stringency conditions (9Zhang L. Liu B.F. Liang S.P. Jones R.L. Lu Y.-T. Biochem. J. 2002; 368: 145-157Google Scholar). Cloning and Characterization of NtCBK1 CDNA—A tobacco cDNA library was screened with maize MCK1 as a probe, resulting in the isolation of a cDNA clone (designated NtCBK1) having a 2.5-kb insert (GenBank™ accession number AF435450). NtCBK1 contains an open reading frame of 1800 bp and Northern blot analyses of RNA from tobacco revealed a single band of about 2.5 kb (data not shown), consistent with the predicted size of the cDNA. The deduced amino acid sequence of NtCBK1 consists of 599 residues with a calculated molecular mass of 66.0 kDa. To search for a putative function of NtCBK1, a data base comparison was conducted to identify homology between NtCBK1 and other genes with known functions. NtCBK1 contains all 11 subdomains characteristic of the protein kinase catalytic domain (38Hanks S.K. Quinn A.M. Hunter T. Science. 1988; 241: 42-52Google Scholar), and shares high sequence identity with CBKs and CDPK-related protein kinases, including maize MCK1 (GenBank™ accession number 1839597; 69%) (7Lu Y.T. Hidaka H. Feldman L.J. Planta. 1996; 199: 18-24Google Scholar), OsCBK (GenBank™ accession number AF368282; 56%) (9Zhang L. Liu B.F. Liang S.P. Jones R.L. Lu Y.-T. Biochem. J. 2002; 368: 145-157Google Scholar), carrot CDPK-related protein kinases (GenBank™ accession number 1103386; 59%) (39Lindzen E. Choi J.H. Plant Mol. Biol. 1995; 28: 785-797Google Scholar), and NtCBK2 (GenBank™ accession number AF435452; 59%) (40Hua W. Liang S. Lu Y.-T. Biochem. J. 2003; 376: 291-302Google Scholar), suggesting that NtCBK1 could be a Ca2+/CaM-related protein kinase (Fig. 1). It is also noted that NtCBK1 does not contain Ca2+ binding EF-hands at its C terminus as in CDPKs (41Harper J.F. Sussman M.R. Schaller G.E. Putanam-Evans C. Charbonneau H. Harmon A.C. Science. 1991; 252: 951-954Google Scholar) and CCaMKs (12Liu Z. Xia M. Poovaiah B.W. Plant Mol. Biol. 1998; 38: 889-897Google Scholar) (Fig. 1). Analysis of NtCBK1 with Anthewin software indicated that the amino acid sequence at positions 436–455 of NtCBK1 could form a CaM-binding α-helix domain (33Lu Y.T. Harrington H.M. Plant Physiol. Biochem. 1994; 32: 413-422Google Scholar, 42O'Neil K.T. DeGrado W.F. Trends Biol. Sci. 1990; 15: 59-64Google Scholar). These structural features strongly suggest that NtCBK1 is a CaM-binding protein kinase. Characterization of the CaM-binding Domain of NtCBK1—To identify the putative CaM-binding domain of NtCBK1, four expression constructs (NtCBK1, T1–416, T1–455, and T436–599) were made to express full and truncated forms of NtCBK1 (Fig. 2A). Whereas T1–455 contained the N-terminal catalytic domain, and a putative CaM-binding domain (at positions 436–455) at its C terminus, T1–416 had the same amino acid sequences of T1–455, but" @default.
• W2065762983 created "2016-06-24" @default.
• W2065762983 creator A5005347875 @default.
• W2065762983 creator A5006630427 @default.
• W2065762983 creator A5024852648 @default.
• W2065762983 creator A5065119339 @default.
• W2065762983 creator A5072629804 @default.
• W2065762983 date "2004-07-01" @default.
• W2065762983 modified "2023-10-17" @default.
• W2065762983 title "A Tobacco Calcium/Calmodulin-binding Protein Kinase Functions as a Negative Regulator of Flowering" @default.
• W2065762983 cites W1559907878 @default.
• W2065762983 cites W1584514295 @default.
• W2065762983 cites W1923170570 @default.
• W2065762983 cites W1968901680 @default.
• W2065762983 cites W1969111385 @default.
• W2065762983 cites W1986911157 @default.
• W2065762983 cites W1992775472 @default.
• W2065762983 cites W1992786701 @default.
• W2065762983 cites W1994885989 @default.
• W2065762983 cites W2003991870 @default.
• W2065762983 cites W2006457482 @default.
• W2065762983 cites W2012447671 @default.
• W2065762983 cites W2013307216 @default.
• W2065762983 cites W2014522068 @default.
• W2065762983 cites W2015790762 @default.
• W2065762983 cites W2017583361 @default.
• W2065762983 cites W2020257412 @default.
• W2065762983 cites W2022406526 @default.
• W2065762983 cites W2024050344 @default.
• W2065762983 cites W2024869652 @default.
• W2065762983 cites W2030205108 @default.
• W2065762983 cites W2038021289 @default.
• W2065762983 cites W2038702312 @default.
• W2065762983 cites W2039698523 @default.
• W2065762983 cites W2047858731 @default.
• W2065762983 cites W2052366943 @default.
• W2065762983 cites W2053356538 @default.
• W2065762983 cites W2062184990 @default.
• W2065762983 cites W2083906637 @default.
• W2065762983 cites W2086410610 @default.
• W2065762983 cites W2089077982 @default.
• W2065762983 cites W2089636056 @default.
• W2065762983 cites W2091294476 @default.
• W2065762983 cites W2094636722 @default.
• W2065762983 cites W2095985104 @default.
• W2065762983 cites W2098853326 @default.
• W2065762983 cites W2100945610 @default.
• W2065762983 cites W2104261718 @default.
• W2065762983 cites W2105127214 @default.
• W2065762983 cites W2107032029 @default.
• W2065762983 cites W2107087785 @default.
• W2065762983 cites W2108931017 @default.
• W2065762983 cites W2112079524 @default.
• W2065762983 cites W2121724732 @default.
• W2065762983 cites W2132250049 @default.
• W2065762983 cites W2132646264 @default.
• W2065762983 cites W2132859854 @default.
• W2065762983 cites W2135561607 @default.
• W2065762983 cites W2140415861 @default.
• W2065762983 cites W2149463498 @default.
• W2065762983 cites W2150586107 @default.
• W2065762983 cites W4293247451 @default.
• W2065762983 doi "https://doi.org/10.1074/jbc.m402861200" @default.
• W2065762983 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15138273" @default.
• W2065762983 hasPublicationYear "2004" @default.
• W2065762983 type Work @default.
• W2065762983 sameAs 2065762983 @default.
• W2065762983 citedByCount "36" @default.
• W2065762983 countsByYear W20657629832013 @default.
• W2065762983 countsByYear W20657629832014 @default.
• W2065762983 countsByYear W20657629832015 @default.
• W2065762983 countsByYear W20657629832016 @default.
• W2065762983 countsByYear W20657629832017 @default.
• W2065762983 countsByYear W20657629832018 @default.
• W2065762983 countsByYear W20657629832019 @default.
• W2065762983 countsByYear W20657629832021 @default.
• W2065762983 countsByYear W20657629832022 @default.
• W2065762983 countsByYear W20657629832023 @default.
• W2065762983 crossrefType "journal-article" @default.
• W2065762983 hasAuthorship W2065762983A5005347875 @default.
• W2065762983 hasAuthorship W2065762983A5006630427 @default.
• W2065762983 hasAuthorship W2065762983A5024852648 @default.
• W2065762983 hasAuthorship W2065762983A5065119339 @default.
• W2065762983 hasAuthorship W2065762983A5072629804 @default.
• W2065762983 hasBestOaLocation W20657629831 @default.
• W2065762983 hasConcept C104317684 @default.
• W2065762983 hasConcept C122229402 @default.
• W2065762983 hasConcept C126322002 @default.
• W2065762983 hasConcept C184235292 @default.
• W2065762983 hasConcept C185592680 @default.
• W2065762983 hasConcept C29688787 @default.
• W2065762983 hasConcept C519063684 @default.
• W2065762983 hasConcept C55493867 @default.
• W2065762983 hasConcept C59822182 @default.
• W2065762983 hasConcept C6929976 @default.
• W2065762983 hasConcept C71924100 @default.
• W2065762983 hasConcept C86803240 @default.
• W2065762983 hasConcept C95444343 @default.

• next