FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2066566675> ?p ?o ?g. }

• W2066566675 endingPage "24948" @default.
• W2066566675 startingPage "24941" @default.
• W2066566675 abstract "Heparan sulfate proteoglycans are thought to be obligatory for receptor binding and subsequent mitogenic activity of basic fibroblast growth factor (FGF-2). In a previous study (Nurcombe V., Ford, M. D., Wildschut, J., Bartlett, P. F.(1993) Science 260, 103-106) we have shown that primary cultures of mouse neuroepithelial cells and a cell line derived from them, 2.3D, secrete a heparan sulfate proteoglycan with a high affinity for FGF-2. In this study, a combination of affinity chromatography and gel chromatography was used to further isolate heparan sulfate side chains with high affinity for FGF-2. These active chains had an average molecular weight of 18,000-20,000. In order to determine whether heparan sulfate chains with specificity for FGF-2 also displayed selectivity for the different FGF receptors, peptides designed to the heparin-binding region of the receptors were used in competitive inhibition studies. The structure of the predicted heparin-binding domain of the FGF receptor 1 was modeled on the basis of its presumed secondary and tertiary structure homology with immunoglobulin loops. These results suggested that many of the basic residues within the second immunoglobulin loop of the FGF receptor 1 form a basic domain in the molecule and therefore form part of a heparin-binding site. Peptides homologous to this region of FGF receptor 1 were shown to inhibit mitogenesis in 2.3D cells, while those to FGF receptor types 2, 3, and 4 did not. A reverse transcriptase-polymerase chain reaction assay designed to detect expression of the four FGF receptors types demonstrated that FGF receptors 1 and 3 were present on the 2.3D cell line but that receptors 2 and 4 were not. These findings indicate that unique heparan sulfate domains interact with specific cell-surface receptors to direct cellular responses. Heparan sulfate proteoglycans are thought to be obligatory for receptor binding and subsequent mitogenic activity of basic fibroblast growth factor (FGF-2). In a previous study (Nurcombe V., Ford, M. D., Wildschut, J., Bartlett, P. F.(1993) Science 260, 103-106) we have shown that primary cultures of mouse neuroepithelial cells and a cell line derived from them, 2.3D, secrete a heparan sulfate proteoglycan with a high affinity for FGF-2. In this study, a combination of affinity chromatography and gel chromatography was used to further isolate heparan sulfate side chains with high affinity for FGF-2. These active chains had an average molecular weight of 18,000-20,000. In order to determine whether heparan sulfate chains with specificity for FGF-2 also displayed selectivity for the different FGF receptors, peptides designed to the heparin-binding region of the receptors were used in competitive inhibition studies. The structure of the predicted heparin-binding domain of the FGF receptor 1 was modeled on the basis of its presumed secondary and tertiary structure homology with immunoglobulin loops. These results suggested that many of the basic residues within the second immunoglobulin loop of the FGF receptor 1 form a basic domain in the molecule and therefore form part of a heparin-binding site. Peptides homologous to this region of FGF receptor 1 were shown to inhibit mitogenesis in 2.3D cells, while those to FGF receptor types 2, 3, and 4 did not. A reverse transcriptase-polymerase chain reaction assay designed to detect expression of the four FGF receptors types demonstrated that FGF receptors 1 and 3 were present on the 2.3D cell line but that receptors 2 and 4 were not. These findings indicate that unique heparan sulfate domains interact with specific cell-surface receptors to direct cellular responses. INTRODUCTIONThe fibroblast growth factor (FGF) 1The abbreviations used are: FGFfibroblast growth factorFGF-2basic FGFFGF-1acidic FGFHSheparan sulfateHSPGheparan sulfate proteoglycanRTreverse transcriptionPCRpolymerase chain reactionbpbase pair(s)FGFR1-A22KFGFR1 specific peptideFGFR2-A22KFGFR2 specific peptideFGFR3-A22RFGFR3 specific peptideFGFR4-A22KFGFR4 specific peptide. family consists of at least nine members including acidic FGF (FGF-1) and basic FGF (FGF-2), which are known to control the proliferation, migration, and differentiation of a broad variety of cell types, including vertebrate neuroepithelial cells(1Sensenbrenner M. Progr. Neurobiol. 1993; 41: 683-704Crossref PubMed Scopus (48) Google Scholar). The biological effects of the FGFs are derived from their interactions with specific, high affinity cell-surface receptors(2Johnson D.E. Williams L.T. Adv. Cancer Res. 1993; 60: 1-41Crossref PubMed Scopus (1170) Google Scholar, 3Jaye M. Schlessinger J. Dionne C.A. Biochim. Biophys. Acta. 1992; 1135: 185-199Crossref PubMed Scopus (596) Google Scholar). The FGF receptor family consists of at least four types: FGFR1 (flg)(4Reid H.H. Wilks A.F. Bernard O. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 1596-1600Crossref PubMed Scopus (171) Google Scholar, 5Safran A. Avivi A. Orr-Urtereger A. Neufeld G. Lonai P. Givol D. Yarden Y. Oncogene. 1990; 5: 635-643PubMed Google Scholar), FGFR2 (bek)(6Dionne C.A. Crumley G. Bellot F. Kaplow M. Searfoss G. Ruta M. Burgess W.H. Jaye M. Schlessinger J. EMBO J. 1990; 9: 2685-2692Crossref PubMed Scopus (544) Google Scholar), FGFR3(7Keegan K. Johnson D.E. Williams L.T. Hayman M.J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 1095-1099Crossref PubMed Scopus (361) Google Scholar), and FGFR4(8Stark K.L. McMahon J.A. McMahon A.P. Development. 1991; 113: 641-651PubMed Google Scholar, 9Partanen J. Makela T.P. Eerola E. Korhonen J. Hirvonen H. Claesson-Welsh L. Alitalo K. EMBO J. 1991; 10: 1347-1354Crossref PubMed Scopus (459) Google Scholar). These integral transmembrane proteins have been identified within the mammalian central nervous system(10Asai T. Wanaka A. Kato H. Masana Y. Seo M. Tohyama Y. Mol. Brain Res. 1993; 17: 174-178Crossref PubMed Scopus (112) Google Scholar). Three of these receptors, FGFR1, FGFR2, and FGFR3, can transduce the FGF-2 signal in vitro(6Dionne C.A. Crumley G. Bellot F. Kaplow M. Searfoss G. Ruta M. Burgess W.H. Jaye M. Schlessinger J. EMBO J. 1990; 9: 2685-2692Crossref PubMed Scopus (544) Google Scholar, 11Ornitz D.M. Leder P. J. Biol. Chem. 1992; 267: 16305-16311Abstract Full Text PDF PubMed Google Scholar, 12Mansukhani A. Dell'Era P. Moscatelli D. Kornbluth S. Hanafusa H. Basilico C. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 3305-3309Crossref PubMed Scopus (113) Google Scholar) and can be alternatively spliced to produce translation products with either two or three immunoglobulin domains with a variably spliced C-terminal region within the third immunoglobulin domain (isoforms) that binds FGF-2 with different affinities(13Avivi A. Yayon A. Givol D. FEBS Lett. 1993; 330: 249-252Crossref PubMed Scopus (91) Google Scholar, 14Duan D.-S.R. Werner S. Williams L.T. J. Biol. Chem. 1992; 267: 16076-16080Abstract Full Text PDF PubMed Google Scholar, 15Werner S. Duan D.-S.R. De Vries C. Peters K.G. Johnson D.E. Williams L.T. Mol. Cell. Biol. 1992; 12: 82-88Crossref PubMed Scopus (287) Google Scholar). The temporal and spatial regulation of these isoforms suggest that they are likely to play a major role in the specificity of bioactivation of the FGFs in different tissues throughout the body(16Ledoux D. Mereau A. Pieri I. Barritault D. Courty J. Growth Factors. 1991; 5: 221-231Crossref PubMed Scopus (16) Google Scholar, 17Givol D. Yayon A. FASEB J. 1992; 6: 3362-3369Crossref PubMed Scopus (398) Google Scholar, 18Chellaiah A.T. McEwen D.G. Werner S. Xu J. Ornitz D.M. J. Biol. Chem. 1994; 269: 11620-11627Abstract Full Text PDF PubMed Google Scholar).FGFs are also known to interact with a large number of low affinity sites on the cell surface and within the surrounding extracellular matrix. These sites have been identified as heparan sulfate proteoglycans (HSPG), and are proposed to form complexes with FGFs to protect them against proteolysis and thermal denaturation(19Saksela, O., Moscatelli, D., Sommer, A., Rifkin, D. B., J. Cell Biol., 107, 743-751.Google Scholar, 20David G. FASEB J. 1993; 7: 1023-1030Crossref PubMed Scopus (373) Google Scholar, 21Turnbull J.E. Gallagher J.T. Biochem. Soc. Trans. 1993; 21: 477-482Crossref PubMed Scopus (38) Google Scholar). More recently it has been shown that HSPGs are an obligatory part of the FGF interaction with FGFRs(11Ornitz D.M. Leder P. J. Biol. Chem. 1992; 267: 16305-16311Abstract Full Text PDF PubMed Google Scholar, 22Rapraeger A.C. Curr. Opin. Cell Biol. 1993; 5: 844-853Crossref PubMed Scopus (120) Google Scholar). Yayon et al. (23Yayon A. Klagsbrun M. Esko J.D. Leder P. Ornitz D.M. Cell. 1991; 64: 841-848Abstract Full Text PDF PubMed Scopus (2073) Google Scholar) and Rapraeger et al. (24Rapraeger A.C. Krufka A. Olwin B.B. Science. 1991; 252: 1705-1708Crossref PubMed Scopus (1285) Google Scholar) demonstrated that cells which express FGF receptors but lack heparan sulfates (HS) do not bind or respond to FGF-2. Exogenous heparin or HS restores the binding and mitogenic activity of FGF-2, strongly suggesting that an interaction between HS and either FGF or the high affinity FGFR is required to elicit a biological response. All four FGF receptors contain a stretch of basic amino acids between the first and second immunoglobulin loop which, in FGFR1, is proposed to form a heparin-binding site(25Kan M. Wang F. Xu J. Crabb J.W. Hou J. McKeehan W.L. Science. 1993; 259: 1918-1921Crossref PubMed Scopus (472) Google Scholar). The homologous regions in each of the receptor types contain similar but uniquely different sequences rich in basic amino acids. These differences suggest a means by which cells might differentially activate receptors with unique HS domains. The site which binds FGF has been mapped to the variable C terminus of the third immunoglobulin loop (26Yayon A. Zimmer Y. Gou-Hong S. Avivi A. Yarden Y. Givol D. EMBO J. 1992; 11: 1885-1890Crossref PubMed Scopus (133) Google Scholar). The dependence of FGF-receptor interactions on heparin has recently been questioned by Roghani and colleagues (27Roghani M. Mansukhani A. Dell'Era P. Bellosta P. Basilico C. Rifkin D.B. Moscatelli D. J. Biol. Chem. 1994; 269: 3976-3984Abstract Full Text PDF PubMed Google Scholar, 28Roghani M. Moscatelli D. J. Biol. Chem. 1992; 267: 22156-22162Abstract Full Text PDF PubMed Google Scholar) who demonstrated that heparin merely increased the binding affinity of FGF for FGFR in both myeloid and CHO cells, but was not required for it.We have recently shown that embryonic day 9 murine neuroepithelial cells are capable of releasing an HSPG which selectively binds FGF-2 through HS side chains and elicits a biological response to FGF-2(29Nurcombe V. Ford M.D. Wildschut J. Bartlett P.F. Science. 1993; 260: 103-106Crossref PubMed Scopus (370) Google Scholar). This HSPG appears to play a direct role in the interactions of FGF-1 and FGF-2 with responsive cells. Between embryonic days 9 and 11, the core protein of the HSPG is variably glycosylated with HS chains that switch their affinity from FGF-2 to FGF-1. The change in affinity of the HSPG from FGF-2 to FGF-1 also correlates very closely with the period when neuroepithelial cells begin to differentiate into a neuronal phenotype(30Murphy M. Drago J. Bartlett P.F. J. Neurosci. Res. 1990; 25: 463-475Crossref PubMed Scopus (228) Google Scholar). The aim of this present study was to determine whether HS chains bearing affinity for FGF-2 display selectivity for a receptor type and mitogenic response. Receptor isoforms present in the 2.3D cell line were detected with a reverse transcriptase-polymerase chain reaction assay (RT-PCR). We show that even though FGF receptor 3 is present on the cells, the cells use FGF receptor 1 to transduce the FGF signal in the presence of an appropriate HS.EXPERIMENTAL PROCEDURESMaterialsPeptides were obtained from Chiron-Mimotopes (Clayton, Victoria, Australia). Bovine pituitary FGF-1 and FGF-2, sodium heparin from porcine intestinal mucosa (molecular mass = 12 kDa) and Pronase were from Sigma. Heparitinase (Flavobacterium heparinum) was from Calbiochem. Dulbecco's modified Eagle's medium and fetal calf serum were from Commonwealth Serum Laboratories (Parkville, Victoria, Australia). [3H]Thymidine and [3H]glucosamine was from Amersham Pty. Ltd. (Sydney, Australia). Culture plates were from Falcon LabWare (Becton Dickinson).Molecular Modeling of the FGFR1 Heparin-binding DomainThe structure of the second immunoglobulin loop in the FGFR1 (residues 152-230) which overlaps a predicted heparin-binding domain (25Kan M. Wang F. Xu J. Crabb J.W. Hou J. McKeehan W.L. Science. 1993; 259: 1918-1921Crossref PubMed Scopus (472) Google Scholar) was modeled on the known x-ray crystal structure of the CL subunit of Fab New(31Amzel L.M. Poljak R.J. Annu. Rev. Biochem. 1979; 48: 961-997Crossref PubMed Google Scholar, 32Poljak R.J. Amzel L.M. Avey H.P. Chen B.L. Phizackerley R.P. Saul F. Proc. Natl. Acad. Sci. U. S. A. 1973; 70: 3305-3310Crossref PubMed Scopus (220) Google Scholar). The homologous amino acid residues in Fab New (protein data bank accession 3FAB) were mutated to the corresponding residues found in FGFR1 and the structure energy-minimized in vacuo using the MM+ force field with Hyperchem molecular modeling software (Hypercube, Waterloo, Canada).Purification and Chromatography of Heparan Sulfate Side ChainsIsolated [3H]glucosamine-labeled HS chains from the 2.3D neuroepithelial cell line were prepared from proteoglycan isolates by Pronase digestion as described previously(29Nurcombe V. Ford M.D. Wildschut J. Bartlett P.F. Science. 1993; 260: 103-106Crossref PubMed Scopus (370) Google Scholar). At each stage of the purification procedure, appropriate pools of analogous unlabeled material were collected and tested for their mitogenic ability to promote the incorporation of [3H]thymidine into 2.3D cells(30Murphy M. Drago J. Bartlett P.F. J. Neurosci. Res. 1990; 25: 463-475Crossref PubMed Scopus (228) Google Scholar). Side chains, which averaged 20 kDa in size(29Nurcombe V. Ford M.D. Wildschut J. Bartlett P.F. Science. 1993; 260: 103-106Crossref PubMed Scopus (370) Google Scholar), were further fractionated in denaturing solutions on the basis of their relative affinity for recombinant human FGF-2. The preparation of the FGF-2 affinity matrix and its running conditions were essentially as those described by Ishihara et al.(33Ishihara M. Tyrrell D.J. Stauber G.B. Brown S. Cousens L.S. Stack R.J. J. Biol. Chem. 1993; 268: 4675-4683Abstract Full Text PDF PubMed Google Scholar).Preparation of FGF-2 Affinity MatrixHuman recombinant FGF-2 (5 mg) and N-acetylated heparin (20 mg) in 30 ml of coupling buffer (0.1 M NaHCO3, 0.5 M NaCl, pH 8.2) were added to 3 g of CNBr-activated Sepharose 4B (Pharmacia Biotech Inc.). The mixture was gently rocked overnight at 4°C, and the remaining active groups were blocked by the addition of 50 ml of 0.1 M Tris, pH 8.0. The FGF-2-coupled beads were then extensively washed with 2 M NaCl in 10 mM Tris, pH 7.3, 2 mM EDTA in 10 mM Tris, pH 7.3, and finally equilibrated with 0.2 M NaCl in 10 mM Tris, pH 7.3. The column was stored at 4°C in 0.2 M NaCl in 10 mM Tris, pH 7.3, supplemented with 0.02% azide and 100 μg/ml porcine heparin (Sigma).Affinity Chromatography of HSThe FGF-2-coupled Sepharose was packed into a small column (0.8 × 2 cm) and equilibrated with 0.2 M NaCl in 10 mM Tris, pH 7.3. The 3H-labeled HS chains (5 × 105 cpm) were dissolved in 100 μl of the equilibration buffer and loaded onto the small column, which was then washed with 3 ml of the same buffer. The bound fraction was eluted with 0.15 to 2 M linear gradients of NaCl (1 ml/min), reapplied to the column, eluted again with a linear NaCl gradient, and the bound fractions, pooled, desalted, and tested for mitogenic activity(33Ishihara M. Tyrrell D.J. Stauber G.B. Brown S. Cousens L.S. Stack R.J. J. Biol. Chem. 1993; 268: 4675-4683Abstract Full Text PDF PubMed Google Scholar).Size-exclusion Chromatography of Bioactive HSAppropriate bioactive pools recovered from affinity chromatography were further analyzed by chromatography on Sepharose CL-6B (1 × 100 cm) according to our previously described methods(29Nurcombe V. Ford M.D. Wildschut J. Bartlett P.F. Science. 1993; 260: 103-106Crossref PubMed Scopus (370) Google Scholar). Fractions were analyzed for radioactivity by liquid scintillation counting. The elution volume of peaks emerging from the column were calibrated against those of known glycosaminoglycan standards (molecular mass range from 1.3 to 50 kDa). Peaks of unlabeled material were tested in the mitogenic assay. In some cases, the material emerging from FGF-2 affinity chromatography was characterized by first incubating them for 16 h at 37°C with 2 units of Flavobacterium heparitinase, with 1 mM phenylmethylsulfonyl fluoride, 25 mM sodium phosphate, pH 7.0(34Kojima T. Leone C. Marchildon G. Marcum J. Rosenberg R. J. Biol. Chem. 1992; 267: 4859-4869Abstract Full Text PDF PubMed Google Scholar). Highly mitogenic subpools were desalted, lyophilized, resuspended in water, and filtered through 0.22-μm cellulose acetate filters (Costar, Cambridge MA).Mitogenesis Assay2.3D cells were seeded at an initial density of 10,000 cells/well in 24-well tissue culture plates or 2,000 cells/96-well plate (Falcon) and were maintained in Dulbecco's modified Eagle's medium supplemented with 10% (v/v) fetal calf serum (29Nurcombe V. Ford M.D. Wildschut J. Bartlett P.F. Science. 1993; 260: 103-106Crossref PubMed Scopus (370) Google Scholar). Cells were plated in the presence of FGF-2 or FGF-1 while HS was added 1 h after plating, and the peptides were added 2 h after plating. Dose-response curves generated with these reagents were completed according to our previously published methods(30Murphy M. Drago J. Bartlett P.F. J. Neurosci. Res. 1990; 25: 463-475Crossref PubMed Scopus (228) Google Scholar). The sequence of the FGF receptor-blocking peptides and their amino acid locations (in parentheses) within the complete receptor protein sequence were FGFR1 peptide(152-175): APYWTSPEKMEKKLHAVPAAKTVK (FGFR1-A22K), FGFR2 peptide(153-176): APYWTNTEKMEKRLHAVPAANTVK (FGFR2-A22K), FGFR3 peptide(150-173): APYWTRPERMDKKLLAVPAANTVR (FGFR3-A22R), and the FGFR4 peptide(146-169): APYWTHPQRMEKKLHAVPAGNTVR (FGFR4-A22R). A peptide homologous to an amino acid sequence in mouse Ca+2/calmodulin-dependent protein kinase, LKKFNARRKLKGAILTTMLA(35Hanley R.M. Payne M.E. Cruzalequi F. Christenson M.A. Means A.R. Nucleic Acids Res. 1989; 17: 3992Crossref PubMed Scopus (19) Google Scholar), was used as a control peptide. Plating efficiencies were not affected by the presence of any of the peptides (data not shown). The treated 2.3D cells were grown for 24 h before the addition of [3H]thymidine(30Murphy M. Drago J. Bartlett P.F. J. Neurosci. Res. 1990; 25: 463-475Crossref PubMed Scopus (228) Google Scholar). At the end of the incubation period, the cells were rinsed three times with phosphate-buffered saline (pH 7.4) and then ruptured with lysis solution (3% (v/v) Triton X-100, 0.02% (w/v) EDTA, and 0.02 M NH4OH). The lysis solution was collected in a 1.5-ml tube and levels of [3H]thymidine determined by liquid scintillation counting.RT-PCR Analysis of FGFR Expression in 2.3D CellsReverse primers specific for exons comprising the C-terminal half of Ig-like loop III in the various FGFRs were R1/4, R2/4, R3/4, and R4/4 for isoforms FGFR1, 2, 3, and 4 IIIc, respectively; R1/3 and R3/3 for isoforms FGFR1 and 3 IIIb, respectively; and also R1/2 in the case of exon a‘ of FGFR1. These primers were used as 3′ primers in combination with oligo(dT) to prime cDNA synthesis of mRNA isolated from the 2.3D cell line (see “Results”). The methodology for both cDNA synthesis and the subsequent PCR were as described in the RNA-PCR kit (Perkin-Elmer, Applied Biosystems, Melbourne Australia) and Nurcombe et al.(29Nurcombe V. Ford M.D. Wildschut J. Bartlett P.F. Science. 1993; 260: 103-106Crossref PubMed Scopus (370) Google Scholar). The expression of various isoforms was assessed by a PCR assay wherein an isoform-specific primer pair and an isoform specifically primed cDNA template were present; e.g. to assess if FGFR1 IIIc was present, cDNA synthesis was primed with oligo(dT) and reverse primer R1/4, subsequent addition of the forward primer R1/1 followed with PCR for 30 cycles of 1′ at 95°C, 1′ at 60°C, and 1′ at 72°C resulted in the amplification of a specific FGFR1 IIIc fragment of 350 base pairs. Duplicate PCR assays of template from duplicate mRNA preparations were conducted in the manner described for all known isoforms of the FGFRs. The products diagnostic for these specific isoforms and the primer pairs for the PCR amplification of these products were as follows: FGFR1 IIIa‘, primer pairs R1/1 and R1/2; FGFR1 IIIb, R1/1 and R1/3; FGFR1 IIIc, R1/1 and R1/4; FGFR2 IIIc, R2/1 and R2/4; FGFR3 IIIb, R3/1 and R3/3; FGFR3 IIIc, R3/1 and R3/4; and FGFR4 IIIc, R4/1 and R4/4. The product sizes are given under “Results.” All oligonucleotides were subjected to EMBL and GenBank™ data base searches to ensure homology to a specific receptor. Primers were designed across introns to ensure that products of expected size were derived from mRNA only. PCR products were run on gels, Southern blotted, and hybridized with labeled oligonucleotides internal to the expected product, R1/5 for FGFR1 III, a‘, b, and c; R2/5 for FGFR2 III, b and c; R3/6 for FGFR3 IIIb; R3/7 for FGFR3 IIIc; and R4/7 for FGFR4 IIIc as described in Nurcombe et al.(29Nurcombe V. Ford M.D. Wildschut J. Bartlett P.F. Science. 1993; 260: 103-106Crossref PubMed Scopus (370) Google Scholar). The products were also subcloned into pGem3zf (Promega), and both strands were sequenced to further verify identity. The oligonucleotides and the reference for the source from which they were derived were as follows: for FGFR1, 1/1, CTTGACGTCGTGGAACGATCT(4Reid H.H. Wilks A.F. Bernard O. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 1596-1600Crossref PubMed Scopus (171) Google Scholar); 1/2, GCCAAGAAAGGAGGTTAAGAGTAC (15Werner S. Duan D.-S.R. De Vries C. Peters K.G. Johnson D.E. Williams L.T. Mol. Cell. Biol. 1992; 12: 82-88Crossref PubMed Scopus (287) Google Scholar); 1/3, CTGGTTAGCTTCACTAATAT(15Werner S. Duan D.-S.R. De Vries C. Peters K.G. Johnson D.E. Williams L.T. Mol. Cell. Biol. 1992; 12: 82-88Crossref PubMed Scopus (287) Google Scholar); 1/4, TTCCAGAACGGTCAACCATGCAGA (4Reid H.H. Wilks A.F. Bernard O. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 1596-1600Crossref PubMed Scopus (171) Google Scholar); 1/5, GGCCAGACAACTTGCCGTATGTCC(4Reid H.H. Wilks A.F. Bernard O. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 1596-1600Crossref PubMed Scopus (171) Google Scholar); 1/6, CGGGAATTAATAGCTCGGAT(15Werner S. Duan D.-S.R. De Vries C. Peters K.G. Johnson D.E. Williams L.T. Mol. Cell. Biol. 1992; 12: 82-88Crossref PubMed Scopus (287) Google Scholar); 1/7; ACTGCTGGAGTTAATACCACCGAC(4Reid H.H. Wilks A.F. Bernard O. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 1596-1600Crossref PubMed Scopus (171) Google Scholar); for FGFR2. 2/1, CCCATCCTCCAAGCTGGACTGCCT(36Raz V. Kelman Z. Avivi A. Neufeld G. Givol D. Yarden Y. Oncogene. 1991; 6: 756-760Google Scholar); 2/4, CTCCTTCTCTCTCACAGGCGCTGG(36Raz V. Kelman Z. Avivi A. Neufeld G. Givol D. Yarden Y. Oncogene. 1991; 6: 756-760Google Scholar); 2/5, TGATGGGCTGCCCTACCTCAAGGT(36Raz V. Kelman Z. Avivi A. Neufeld G. Givol D. Yarden Y. Oncogene. 1991; 6: 756-760Google Scholar); 2/6, AGCCAGCACTTCTGCATTGGAGCT(36Raz V. Kelman Z. Avivi A. Neufeld G. Givol D. Yarden Y. Oncogene. 1991; 6: 756-760Google Scholar); for FGFR3, 3/1, GACAGACACACGGATGTGCTGGA(11Ornitz D.M. Leder P. J. Biol. Chem. 1992; 267: 16305-16311Abstract Full Text PDF PubMed Google Scholar); 3/3, GTGAACACGCAGCAAAAGGCTTT (13Avivi A. Yayon A. Givol D. FEBS Lett. 1993; 330: 249-252Crossref PubMed Scopus (91) Google Scholar); 3/4, AGCACCACCAGCCACGCAGAGTGA(11Ornitz D.M. Leder P. J. Biol. Chem. 1992; 267: 16305-16311Abstract Full Text PDF PubMed Google Scholar); 3/6, TCCTGGATCAGTGAGATTGTGGAG(13Avivi A. Yayon A. Givol D. FEBS Lett. 1993; 330: 249-252Crossref PubMed Scopus (91) Google Scholar); 3/7, TGCAGGCGCTAACACCACCGACAA(11Ornitz D.M. Leder P. J. Biol. Chem. 1992; 267: 16305-16311Abstract Full Text PDF PubMed Google Scholar); and for FGFR4, 4/1, TACAGCTATCTCCTGGATGTGCTG(8Stark K.L. McMahon J.A. McMahon A.P. Development. 1991; 113: 641-651PubMed Google Scholar); 4/4, GAAACCGTCGGCGCCGAAGCTGCT(8Stark K.L. McMahon J.A. McMahon A.P. Development. 1991; 113: 641-651PubMed Google Scholar); 4/7, GAAGACCTCACGTGGACAACAGCA(8Stark K.L. McMahon J.A. McMahon A.P. Development. 1991; 113: 641-651PubMed Google Scholar).RESULTSMolecular Modeling of FGFR1 Heparin-binding DomainIn order to examine the possible constraints on the size of heparan sulfate domains that bind to the FGFR, we employed a computer modeling approach to examine the structure of the second Ig loop which includes the heparin-binding domain(25Kan M. Wang F. Xu J. Crabb J.W. Hou J. McKeehan W.L. Science. 1993; 259: 1918-1921Crossref PubMed Scopus (472) Google Scholar). Despite considerable differences in their amino acid sequences, the secondary and tertiary structure of loop domains in members of the immunoglobulin superfamily are very similar (31Amzel L.M. Poljak R.J. Annu. Rev. Biochem. 1979; 48: 961-997Crossref PubMed Google Scholar). The final modeled structure of the second immunoglobulin loop domain of FGFR1 is presented in Fig. 1, A and B. The structure consists of six anti-parallel β-strands stabilized by a disulfide bond between cysteine 178 and cysteine 230. The loop domain comprises two regions, a hydrophobic domain containing the N-terminal portion of the immunoglobulin loop and a second region containing a cluster of basic lysine and histidine residues at positions 160, 163, 164, 166, 172, 201, and 225, all of which are orientated on the outer surface of the β-strands. All of the basic residues (with the exception of lysine 207 and arginine 209) were found within this basic domain. The maximum distance between any two positively charged groups in the basic cluster (i.e. N∈ of lysines 198 and 160) was 30 Å. A heparin hexasaccharide spans approximately the same distance (Fig. 1C). With this theoretical constraint in mind, we next set out to further characterize the interaction between the 2.3D HS and the FGFR with which it might be interacting, since the sequences in the four different FGF receptors in this region have quite distinct differences in their basic residues (see Fig. 1D), suggesting the possibility of unique binding sites for specific HS domains.Fractionation of FGF-2-specific HSHeparan sulfate side chains derived from the 2.3D HSPG were fractionated on an FGF-2 affinity column using continuous gradients of NaCl (Fig. 2A). About 30% of the initially loaded HS fragments were released at NaCl concentrations below 1.0 M. Approximately 70% of the initially loaded HS fragments were released in a single peak between 1.0 and 2.0 M NaCl, indicating that a significant fraction of the 2.3D HS possessed a high affinity for FGF-2. Fractions incorporating the peak were pooled for further analysis by molecular sieving over Sepharose CL-6B (Fig. 2B). The two large peaks emerging from this column could both be degraded almost to completion with Flavobacterium heparitinase, confirming their identity as true HS. The recovery of 3H-labeled material after affinity chromatography and then molecular sieving was approximately 45%. Dose-response curves generated with HS material from the peaks recovered after gel chromatography using the 2.3D neuroepithelial cell bioassay demonstrated that peak I, which averaged 18-20 kDa in size, but not peak II, was capable of maximally potentiating mitogenesis (Fig. 2C). When cells were grown in submaximal concentrations of FGF-2 (1 ng/ml), it was found that HS from peak I could maximally trigger cell division when it was present at concentrations above 1 μg/ml. From then on a concentration of 2 μg/ml of peak I HS was used in all cell cultures, unless otherwise indicated.Figure 2Purification of HS chains with specificity for FGF-2. A, [3H]glucosamine-labeled chains from 2.3D cell-conditioned medium were first purified over Q-Sepharose and then subjected to FGF-2 affinity chromatography. Bound saccharide was released with a linear NaCl gradient (0.15-2 M) and rerun over the column, and the fractions were released in the peak above 1 M (fractions 33-38, indicated by the arrow), and pooled for further analysis. B, pooled fractions were then chromatographed over Sepharose CL-6B columns, and the indicated fractions from the two peaks (I and II) were pooled. In some experiments the HS was predigested with Flavobacterium heparitinase (○). C, lyophilized HS material from peaks I and II of HS chains were then tested for their ability to promote mitogenesis in cultured 2.3D cells exposed to [3H]thymidine when they were grown in the presence of FGF-2 (1 ng/ml).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Dose Response of FGF-2Dose-response experiments to determine the optimum concentration of FGF-2 needed to perform subsequent peptide-blocking experiments were done. 2.3D cells were maintained in medium containing 2 μg/ml HS and exposed to increasing doses of FGF-2 (Fig. 3). Maximal activity was reached between 1 and 10 ng/ml FGF-2, with inhibition of growth seen at higher concentrations. Therefore, cells were maintained in 5 ng/ml FGF-2.Figure 3Dose response of cultured 2.3D cells grown in the presence of purified HS. 2.3D neuroepithelial cells were labeled with [3H]thymidine and maintained in the presence of purified HS (2 μg/ml). FGF-2 at the indicated concentrations was added to the cultures, and th" @default.
• W2066566675 created "2016-06-24" @default.
• W2066566675 creator A5035754232 @default.
• W2066566675 creator A5046002552 @default.
• W2066566675 creator A5055005968 @default.
• W2066566675 creator A5078229589 @default.
• W2066566675 creator A5080376075 @default.
• W2066566675 date "1995-10-01" @default.
• W2066566675 modified "2023-10-16" @default.
• W2066566675 title "Heparan Sulfates Mediate the Binding of Basic Fibroblast Growth Factor to a Specific Receptor on Neural Precursor Cells" @default.
• W2066566675 cites W1487884828 @default.
• W2066566675 cites W1494551606 @default.
• W2066566675 cites W1499670070 @default.
• W2066566675 cites W1504197390 @default.
• W2066566675 cites W1512706674 @default.
• W2066566675 cites W1531144136 @default.
• W2066566675 cites W1559464451 @default.
• W2066566675 cites W1578995377 @default.
• W2066566675 cites W1582980602 @default.
• W2066566675 cites W1585322583 @default.
• W2066566675 cites W1587679599 @default.
• W2066566675 cites W1595861603 @default.
• W2066566675 cites W1636802518 @default.
• W2066566675 cites W1852034244 @default.
• W2066566675 cites W1881900550 @default.
• W2066566675 cites W1944551911 @default.
• W2066566675 cites W1963649831 @default.
• W2066566675 cites W1971359142 @default.
• W2066566675 cites W1973712296 @default.
• W2066566675 cites W1974873948 @default.
• W2066566675 cites W1975276582 @default.
• W2066566675 cites W1983583037 @default.
• W2066566675 cites W1984670732 @default.
• W2066566675 cites W2003632139 @default.
• W2066566675 cites W2006615195 @default.
• W2066566675 cites W2006641366 @default.
• W2066566675 cites W2007230427 @default.
• W2066566675 cites W2016677774 @default.
• W2066566675 cites W2027737655 @default.
• W2066566675 cites W2029503020 @default.
• W2066566675 cites W2041245161 @default.
• W2066566675 cites W2050082215 @default.
• W2066566675 cites W2050256171 @default.
• W2066566675 cites W2053717197 @default.
• W2066566675 cites W2058525519 @default.
• W2066566675 cites W2064007974 @default.
• W2066566675 cites W2081194385 @default.
• W2066566675 cites W2082131963 @default.
• W2066566675 cites W2122225748 @default.
• W2066566675 cites W2163170931 @default.
• W2066566675 cites W2165233782 @default.
• W2066566675 cites W2398446063 @default.
• W2066566675 cites W2412203941 @default.
• W2066566675 cites W986709771 @default.
• W2066566675 doi "https://doi.org/10.1074/jbc.270.42.24941" @default.
• W2066566675 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/7559620" @default.
• W2066566675 hasPublicationYear "1995" @default.
• W2066566675 type Work @default.
• W2066566675 sameAs 2066566675 @default.
• W2066566675 citedByCount "84" @default.
• W2066566675 countsByYear W20665666752012 @default.
• W2066566675 countsByYear W20665666752013 @default.
• W2066566675 countsByYear W20665666752014 @default.
• W2066566675 countsByYear W20665666752015 @default.
• W2066566675 countsByYear W20665666752016 @default.
• W2066566675 countsByYear W20665666752017 @default.
• W2066566675 countsByYear W20665666752019 @default.
• W2066566675 crossrefType "journal-article" @default.
• W2066566675 hasAuthorship W2066566675A5035754232 @default.
• W2066566675 hasAuthorship W2066566675A5046002552 @default.
• W2066566675 hasAuthorship W2066566675A5055005968 @default.
• W2066566675 hasAuthorship W2066566675A5078229589 @default.
• W2066566675 hasAuthorship W2066566675A5080376075 @default.
• W2066566675 hasBestOaLocation W20665666751 @default.
• W2066566675 hasConcept C147708747 @default.
• W2066566675 hasConcept C1491633281 @default.
• W2066566675 hasConcept C170493617 @default.
• W2066566675 hasConcept C185592680 @default.
• W2066566675 hasConcept C2778041096 @default.
• W2066566675 hasConcept C50044444 @default.
• W2066566675 hasConcept C55493867 @default.
• W2066566675 hasConcept C66400584 @default.
• W2066566675 hasConcept C74373430 @default.
• W2066566675 hasConcept C82867764 @default.
• W2066566675 hasConcept C86803240 @default.
• W2066566675 hasConcept C95444343 @default.
• W2066566675 hasConceptScore W2066566675C147708747 @default.
• W2066566675 hasConceptScore W2066566675C1491633281 @default.
• W2066566675 hasConceptScore W2066566675C170493617 @default.
• W2066566675 hasConceptScore W2066566675C185592680 @default.
• W2066566675 hasConceptScore W2066566675C2778041096 @default.
• W2066566675 hasConceptScore W2066566675C50044444 @default.
• W2066566675 hasConceptScore W2066566675C55493867 @default.
• W2066566675 hasConceptScore W2066566675C66400584 @default.
• W2066566675 hasConceptScore W2066566675C74373430 @default.
• W2066566675 hasConceptScore W2066566675C82867764 @default.
• W2066566675 hasConceptScore W2066566675C86803240 @default.
• W2066566675 hasConceptScore W2066566675C95444343 @default.

• next