FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2067244501> ?p ?o ?g. }

• W2067244501 endingPage "38348" @default.
• W2067244501 startingPage "38345" @default.
• W2067244501 abstract "The sequences of 42 subunits of NADH:ubiquinone oxidoreductase (complex I) from bovine heart mitochondria have been described previously. Seven are encoded by mitochondrial DNA, whereas the remaining 35 are nuclear gene products imported into the organelle from the cytoplasm. An additional protein, which does not correspond to any previously known subunit of the complex I assembly, has now been detected. Denaturing gels of subcomplex Iλ, the hydrophilic arm of complex I, clearly show a hitherto unidentified band, which was digested with trypsin and subjected to mass-spectrometric analysis to provide several peptide sequences, used in cDNA cloning and sequencing. Measurement of the intact protein mass indicated that the N terminus is acetylated. The new complex I subunit (B16.6) is the bovine homolog of GRIM-19, the product of a cell death regulatory gene induced by interferon-β and retinoic acid, thus providing a new link between the mitochondrion and its electron-transport chain and apoptotic cell death. The sequences of 42 subunits of NADH:ubiquinone oxidoreductase (complex I) from bovine heart mitochondria have been described previously. Seven are encoded by mitochondrial DNA, whereas the remaining 35 are nuclear gene products imported into the organelle from the cytoplasm. An additional protein, which does not correspond to any previously known subunit of the complex I assembly, has now been detected. Denaturing gels of subcomplex Iλ, the hydrophilic arm of complex I, clearly show a hitherto unidentified band, which was digested with trypsin and subjected to mass-spectrometric analysis to provide several peptide sequences, used in cDNA cloning and sequencing. Measurement of the intact protein mass indicated that the N terminus is acetylated. The new complex I subunit (B16.6) is the bovine homolog of GRIM-19, the product of a cell death regulatory gene induced by interferon-β and retinoic acid, thus providing a new link between the mitochondrion and its electron-transport chain and apoptotic cell death. polyacrylamide gel electrophoresis gene associated with retinoid interferon-induced mortality collisional-induced dissociation electrospray ionization high performance liquid chromatography lauryldimethylamine oxide matrix assisted laser desorption ionization time of flight mass spectrometry polymerase chain reaction quadrupole time of flight Mitochondrial NADH:ubiquinone oxidoreductase (complex I) catalyzes the first step in the electron transport chain, the oxidation of NADH to NAD+ coupled to proton translocation across the inner mitochondrial membrane (1Saraste M. Science. 1999; 283: 1488-1493Crossref PubMed Scopus (1039) Google Scholar, 2Schultz B.E. Chan S.I. Annu. Rev. Biophys. Biomol. Struct. 2001; 30: 23-65Crossref PubMed Scopus (205) Google Scholar, 3Walker J.E. Q. Rev. Biophys. 1992; 25: 253-324Crossref PubMed Scopus (681) Google Scholar, 4Weiss H. Friedrich T. Hofhaus G. Preis D. Eur. J. Biochem. 1991; 197: 563-576Crossref PubMed Scopus (429) Google Scholar). Complex I from bovine heart mitochondria is a highly complex, multisubunit, membrane-bound assembly, with a molecular mass of over 900 kDa. The sequences of 42 of the subunits of complex I have been reported previously (3Walker J.E. Q. Rev. Biophys. 1992; 25: 253-324Crossref PubMed Scopus (681) Google Scholar, 5Skehel J.M. Fearnley I.M. Walker J.E. FEBS Lett. 1998; 438: 301-305Crossref PubMed Scopus (59) Google Scholar, 6Walker J.E. Arizmendi J.M. Dupuis A. Fearnley I.M. Finel M. Medd S.M. Pilkington S.J. Runswick M.J. Skehel J.M. J. Mol. Biol. 1992; 226: 1051-1072Crossref PubMed Scopus (177) Google Scholar, 7Arizmendi J.M. Skehel J.M. Runswick M.J. Fearnley I.M. Walker J.E. FEBS Lett. 1992; 313: 80-84Crossref PubMed Scopus (43) Google Scholar); seven are mitochondrial gene products, whereas the rest are encoded in the nucleus and imported into the organelle from the cytoplasm. Prokaryotic complex I systems are simpler assemblies of 13–14 subunits, all of them conserved in eukaryotes, and contain an equivalent set of redox cofactors (8Yagi T. Yano T. Di Bernardo S. Matsuno-Yagi A. Biochim. Biophys. Acta. 1998; 1364: 125-133Crossref PubMed Scopus (204) Google Scholar, 9Friedrich T. Biochim. Biophys. Acta. 1998; 1364: 134-146Crossref PubMed Scopus (180) Google Scholar). Mitochondrial complex I is a roughly L-shaped assembly (10Grigorieff N. J. Mol. Biol. 1998; 277: 1033-1046Crossref PubMed Scopus (301) Google Scholar, 11Grigorieff N. Curr. Opin. Struct. Biol. 1999; 9: 476-483Crossref PubMed Scopus (90) Google Scholar, 12Hofhaus G. Weiss H. Leonard K. J. Mol. Biol. 1991; 221: 1027-1043Crossref PubMed Scopus (168) Google Scholar), with one arm in the plane of the lipid bilayer. The other, containing the more hydrophilic subunits, protrudes from the membrane and can be dissociated from it, producing subcomplex Iλ (13Finel M. Majander A.S. Tyynelä J. De Jong A.M.P. Albracht S.P.J. Wikström M. Eur. J. Biochem. 1994; 226: 237-242Crossref PubMed Scopus (55) Google Scholar,14Sazanov L.A. Peak-Chew S.Y. Fearnley I.M. Walker J.E. Biochemistry. 2000; 39: 7229-7235Crossref PubMed Scopus (157) Google Scholar). The oxidation of NADH is catalyzed at an active site containing non-covalently-bound flavin mononucleotide, and electrons are transported through the assembly to the ubiquinone acceptor via iron-sulfur clusters. Subcomplex Iλ contains 15 subunits of complex I and all of its known redox cofactors but has no bound ubiquinone; it is thus active in NADH oxidation but only when coupled to artificial electron acceptors such as ferricyanide or hexaamineruthenium. With the aim of unambiguously defining the subunit composition of subcomplex Iλ (13Finel M. Majander A.S. Tyynelä J. De Jong A.M.P. Albracht S.P.J. Wikström M. Eur. J. Biochem. 1994; 226: 237-242Crossref PubMed Scopus (55) Google Scholar, 14Sazanov L.A. Peak-Chew S.Y. Fearnley I.M. Walker J.E. Biochemistry. 2000; 39: 7229-7235Crossref PubMed Scopus (157) Google Scholar), each of the bands resolved by SDS-PAGE1 analysis was examined by peptide-mass mapping. In this way, 14 known subunits of mitochondrial complex I were confirmed as being present in the subcomplex. In addition, a 15th band, not corresponding to any known subunit, was observed, running close to subunit B17.2. This additional protein, which is tightly associated with subcomplex Iλ, was investigated by mass mapping and tandem MS of its tryptic peptides, and the corresponding cDNA was sequenced. The mature protein, of 143 amino acids, has an acetylated α-amino group. The presence of the new protein has also been confirmed in intact complex I, and following the nomenclature for mitochondrial complex I it has been named B16.6 (3Walker J.E. Q. Rev. Biophys. 1992; 25: 253-324Crossref PubMed Scopus (681) Google Scholar). The amino acid sequence clearly identifies subunit B16.6 of mitochondrial complex I to be the bovine homolog of the GRIM-19 protein, the product of a cell death regulatory gene induced by interferon-β and retinoic acid. GRIM-19 has previously been detected in HeLa cells, predominantly in the nucleus, though punctate staining of the cytoplasm was also observed (15Hofman E.R. Boyanapalli M. Lindner D.J. Weihua X. Hassel B.A. Jagus R. Gutierrez P.L. Kalvakolanu D.V. Mol. Cell. Biol. 1998; 18: 6493-6504Crossref PubMed Scopus (77) Google Scholar, 16Angell J.E. Lindner D.J. Shapiro P.S. Hofmann E.R. Kalvakolanu D.V. J. Biol. Chem. 2000; 275: 33416-33426Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar). Mitochondria were isolated from bovine hearts (17Smith A.L. Methods Enzymol. 1967; 10: 81-86Crossref Scopus (472) Google Scholar), and mitochondrial membranes were prepared by disruption with a Waring blender in the presence of potassium chloride (18Walker J.E. Skehel J.M. Buchanan S.K. Methods Enzymol. 1995; 260: 14-34Crossref PubMed Scopus (88) Google Scholar). Complex I was purified according to Sazanov et al. (14Sazanov L.A. Peak-Chew S.Y. Fearnley I.M. Walker J.E. Biochemistry. 2000; 39: 7229-7235Crossref PubMed Scopus (157) Google Scholar), by solubilization with dodecylmaltoside (Anatrace, Maumee, OH) and ion-exchange chromatography on Q-Sepharose HP media (Amersham Pharmacia Biotech). Pooled complex I fractions were either used to prepare subcomplex Iλ (see below) or subjected to further purification using a second ion-exchange separation, ammonium sulfate precipitation, and gel filtration (14Sazanov L.A. Peak-Chew S.Y. Fearnley I.M. Walker J.E. Biochemistry. 2000; 39: 7229-7235Crossref PubMed Scopus (157) Google Scholar). All purification steps were carried out at 0–4 °C. Subcomplex Iλ was prepared by a procedure developed from that of Finel et al. (13Finel M. Majander A.S. Tyynelä J. De Jong A.M.P. Albracht S.P.J. Wikström M. Eur. J. Biochem. 1994; 226: 237-242Crossref PubMed Scopus (55) Google Scholar). Complex I, from the first ion-exchange column above, was precipitated by addition of dodecylmaltoside to 1%, sodium cholate (Dojindo Laboratories, Kumamoto, Japan) to 1.8%, and ammonium sulfate to 50% saturation. After centrifugation, the resulting pellet was dissolved into 1% LDAO (Calbiochem), 100 mm potassium phosphate, pH 7.5, and 1 mmdithiothreitol (Melford Laboratories, Ipswich, UK), to a final concentration of ∼10 mg ml−1. Portions were layered onto linear sucrose gradients (12 ml, 5–15% sucrose, 0.5% LDAO, 500 mm potassium phosphate, pH 7.5, 1 mmdithiothreitol) and centrifuged for 18 h at 200,000 ×g. The sharp yellow-brown band in the center of the gradient was concentrated to ∼6 mg ml−1 by ultrafiltration (YM-100; Millipore, Bedford, MA), and portions (0.5 ml) were injected onto a Superose 6 HR 10/30 gel filtration column (Amersham Pharmacia Biotech) and eluted (0.3 ml min−1) in a buffer containing 0.1% LDAO, 100 mm potassium phosphate, pH 7.5, and 1 mm dithiothreitol. The colored fractions spanning the apex of the symmetrical absorbance peak (280 nm) were pooled and stored in liquid nitrogen (concentration ∼1 mg ml−1). Protein concentrations were determined by the BCA protein assay (Pierce) using bovine serum albumin as standard. Unless otherwise stated, all chemicals were purchased from Merck and were of analytical grade. SDS-PAGE was carried out by the method of Laemmli (19Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar) using a 12–22% acrylamide gradient, and gels were stained with either 0.2% Coomassie Blue R250 (7% acetic acid, 50% methanol) or 0.1% colloidal Coomassie G250 (3% phosphoric acid, 6% ammonium sulfate) (20Neuhoff V. Stamm R. Eibl H. Electrophoresis. 1985; 6: 427-448Crossref Scopus (542) Google Scholar). For N-terminal sequence analysis, proteins separated by SDS-PAGE were transferred to an Immobilon P membrane (Millipore, Bedford, MA) in a solution of 25 mm Tris, 192 mm glycine, and 10% methanol. Excised Coomassie Blue-stained bands were analyzed by automated Edman degradation using a model 494 Procise protein sequencer (Applied Biosystems, Warrington, UK). Proteins separated by SDS-PAGE were identified by peptide mass fingerprinting. Bands were excised from the gel, cleaved “in-gel” with trypsin (21Shevchenko A. Wilm M. Vorm O. Mann M. Anal. Chem. 1996; 68: 850-858Crossref PubMed Scopus (7831) Google Scholar), and the mixture of tryptic peptides was analyzed by MALDI-TOF MS using a TofSpec 2E mass spectrometer (Micromass, Altrincham, UK) and α-cyano-4-hydroxy-trans-cinnamic acid as the matrix. Spectra were calibrated using peptides from trypsin autolysis at 2163.057 and 2273.160, and a matrix-related ion at 1060.048 was present in each spectrum. Peptide sequences were obtained by tandem MS after CID with argon gas in a Q-TOF mass spectrometer equipped with ESI (Micromass Q-TOF; Altrincham, UK), which was tuned and calibrated using the CID fragments of a synthetic peptide, [Glu1] fibrinopeptide B (Sigma-Aldrich). Peptide mixtures from in-gel tryptic digest were desalted on a Poros R2 50-Å reverse-phase support (PerSeptive Biosystems), eluted in 1 µl of 1% formic acid, 60% methanol, introduced into the mass spectrometer from a nano-electrospray interface (22Wilm M.S. Mann M. Int. J. Mass Spectrom. Ion Processes. 1994; 136: 167-180Crossref Scopus (878) Google Scholar), or transferred directly (1 µl min−1) from an “on-line” capillary HPLC (CapLC; Micromass), following fractionation on a PepMapC18 column (LC Packings, Amsterdam, The Netherlands) with an acetonitrile gradient in 0.1% formic acid. MS and tandem MS data were acquired automatically. Peptide fragmentation spectra were interpreted manually, assembled into Peptide Sequence Tags (23Mann M. Wilm M. Anal. Chem. 1994; 66: 4390-4399Crossref PubMed Scopus (1318) Google Scholar), and compared with protein sequence data bases. Peptide sequences were also used to design synthetic oligonucleotide primers (see below) and later for the verification of the cDNA-derived sequence (see Table I).Table ITryptic peptides from subunit B16.6 identified by tandem MSm/zCharge of ionMH+1(monoisotopic)MH+1(sequence)PeptideResiduesSequence622.33+1864.91863.93T2–35–21VKQDMPPVGGYGPIDYK674.43+2021.22020.03T2–45–22VKQDMPPVGGYGPIDYKR818.92+1636.81636.77T37–21QDMPPVGGYGPIDYK661.42+1321.71321.69Non-tryptic11–22PVGGYGPIDYKR638.82+1276.61276.66T11–1258–67RLQIEDFEAR560.82+1120.61120.56T1259–67LQIEDFEAR613.92+1226.71226.72T1368–78IALMPLLQAEK552.33+1654.91653.95T13–1568–81IALMPLLQAEKDRR458.32+915.6915.56T15–1681–87RVLQMLR678.43+2033.12033.04T16–1782–98VLQMLRENLEEEATVMK646.82+1292.61292.60T1788–98ENLEEEATVMK566.82+1132.61132.58T19105–114VGESVFHTTR517.22+1033.41033.50Non-tryptic106–114GESVFHTTR469.82+938.6938.48Non-tryptic120–127MGELYGLR930.02+1858.91836.87T21128–143ASEEVLSATYGFIWYTIdentified sequences within peptides are underlined (I and L are isobaric and are not distinguishable). Peptides T2–3, T2–4, and T13–15 show artefactual mass differences because of deamidation, and peptide T21 is sodiated. Peptides T2–3, T2–4, T3, T11–12, T12, T13, T19, and, additionally, T3–4 (residues 7–22) and T20 (115) were also detected by MALDI-TOF MS. Open table in a new tab Identified sequences within peptides are underlined (I and L are isobaric and are not distinguishable). Peptides T2–3, T2–4, and T13–15 show artefactual mass differences because of deamidation, and peptide T21 is sodiated. Peptides T2–3, T2–4, T3, T11–12, T12, T13, T19, and, additionally, T3–4 (residues 7–22) and T20 (115) were also detected by MALDI-TOF MS. Subunit B16.6 was also purified by reverse-phase HPLC of subcomplex Iλ on an Aquapore RP-300 column (PerkinElmer Life Sciences), with an acetonitrile gradient in 0.1% trifluoroacetic acid. Before application to the column, samples were mixed with an equal volume of 6m guanidine hydrochloride in 0.1% trifluoroacetic acid and then centrifuged. Subunit B16.6 eluted at ∼63% acetonitrile, immediately following subunit PSST and often co-eluting with the 30-kDa subunit. Portions of eluate were examined by ESI MS as described below. Tryptic digests of the purified subunits, analyzed by tandem MS, provided additional, confirmatory sequence data (see Table I). The molecular mass of intact B16.6, purified by reverse-phase HPLC, was measured by ESI MS using a Sciex API III+ triple quadrupole mass spectrometer, which was tuned and calibrated with a mixture of poly(propylene glycols) over the range ofm/z 59 to 2010 and checked using horse heart myoglobin (average mass 16951.4 Da). Samples were introduced, via a Rheodyne loop, into a stream (3 µl min−1) of 50% aqueous acetonitrile, and spectra were recorded by scanning the first quadrupole (Q1) from 700 to 1700 m/z. cDNA was amplified from total bovine heart cDNA by PCR using Expand DNA polymerase (Roche Diagnostics Gmbh, Mannheim, Germany). First, the mixed primers F1, F2, R1, and R2, based on partial amino acid sequences from tandem MS, were synthesized (see Fig. 2A). Primers F1 (CARGAYATGCCNCCNGT) and R1 (GTRTACCANARRAANCC) were used to amplify a partial cDNA, and the product of this reaction was then used as template for a second reaction with the two nested primers F2 (ATHGARGAYTTYGARGC) and R2 (CCRTANARYTCNCCCAT). The PCR product from the second reaction was sequenced directly. The partial sequence was extended to the 5′- and 3′-ends using unique primers. For the 3′-extension, the primer F3 (see Fig. 2A) and a reverse oligo(dT) primer were used, and the PCR product was sequenced directly. For the first 5′-extension, bovine heart cDNA with a 5′-poly(A) tail was used as template with reverse primer R3, and the PCR product was sequenced directly, thereby extending the sequence to base 145 (see Fig. 2A). In a second 5′-extension reaction, bovine heart cDNA synthesized using a SMART PCR cDNA synthesis kit (CLONTECH, Palo Alto, CA) was used as a template, with the forward primer TAGAAGCTTGAATTCGGATCCCGCAGAGTACGCGGG (F4) and reverse primer R4. The product was cloned into a pET vector, and colonies identified by PCR screening were used for sequencing. This yielded a set of clones of different lengths, the longest extending 31 bases upstream of the ATG initiator codon. All the cDNA sequences reported, excepting bases 1–3, have been confirmed by at least two independent DNA sequences. The subunits of bovine mitochondrial complex I and subcomplex Iλ were separated by SDS-PAGE (Fig.1) and analyzed by peptide mass fingerprinting (data not shown). This confirmed the presence of 14 known components of complex I in subcomplex Iλ (Fig. 1) and also revealed a further band that did not correspond to any known complex I subunit. The new protein was also identified in intact complex I. It could not be removed from the complex by any of the following procedures: extended washing of complex I bound to an ion-exchange column, gel filtration, dialysis, treatment with 2 m NaCl followed by dialysis, ammonium sulfate precipitation, or precipitation by dialysis against a low ionic strength buffer. In addition, the new protein is also present in subcomplex Iλ, prepared by disrupting complex I with LDAO, and purified using a sucrose gradient and gel filtration. Therefore, the new protein is not adventitiously bound to complex I, and because it is present in the complex at approximately the same molar ratio as other subunits (as estimated by gel band intensities and the relative yields in HPLC experiments) it is reasonable to conclude that it is a bona fide subunit of the assembly. The new protein gave no N-terminal sequence by Edman degradation, suggesting that the N terminus is modified (see below) and in accordance with the nomenclature for bovine mitochondrial complex I has been named B16.6 (3Walker J.E. Q. Rev. Biophys. 1992; 25: 253-324Crossref PubMed Scopus (681) Google Scholar). Subunit B16.6 is observed reproducibly in all our preparations of bovine complex I and subcomplex Iλ. The complicated SDS-PAGE patterns of complex I and the inaccessibility of the N terminus provide likely reasons why B16.6 has been overlooked previously. The tryptic peptide mixture from the unidentified protein band was examined by tandem MS, and amino acid sequences from several tryptic peptides were determined (TableI). These were assembled into Protein Sequence Tags (23Mann M. Wilm M. Anal. Chem. 1994; 66: 4390-4399Crossref PubMed Scopus (1318) Google Scholar), and comparison with protein sequence data bases revealed a precise match of one tag ((879.5) L/I E D (522.3)), to the human protein GRIM-19 (accession number AF286697). A number of other peptide sequences (Table I) also aligned readily with the human sequence, suggesting B16.6 to be a homolog of human GRIM-19; they later confirmed the amino acid sequence deduced from cDNA sequencing (see below). The nucleotide sequence encoding B16.6 and the deduced amino acid sequence are displayed in Fig. 2A. The 5′-sequence of the cDNA extends 31 bases upstream of the proposed initiator methionine codon and does not contain an in-phase stop codon. The mass of the intact protein measured by ESI MS (16585 Da) was found to be consistent with the mass calculated from the sequence (16584.3 Da), provided that the initiator methionine is cleaved from the mature protein and that the N-terminal alanine residue is acetylated. The B16.6 subunit has a predicted isopotential point of 9.7. Values above pH 9.5 are predicted for approximately half the subunits of mitochondrial complex I and for almost all of the 12 nuclear-encoded subunits with modified N termini. The hydropathy profile (not shown) demonstrates the amphipathic nature of subunit B16.6 (24Kyte J. Doolittle R.F. J. Mol. Biol. 1982; 157: 105-132Crossref PubMed Scopus (17296) Google Scholar), with one potential transmembrane α-helical domain between residues 29 and 47 (25Hoffman K. Stoffel W. Biol. Chem. Hoppe-Seyler. 1993; 374: 166Google Scholar). These properties are consistent with B16.6 comprising part of subcomplex Iλ; whereas it is expected to be predominantly hydrophilic, isolated subcomplex Iλ aggregates in the absence of detergent, suggesting the presence of hydrophobic surface patches. Because of its strong association with subcomplex Iλ, subunit B16.6 is likely to be located predominantly on the matrix side of the inner mitochondrial membrane, but its topography in the inner membrane is not known, and either residues 1–28 or 48–143 could lie in the intermembrane space. The sequences of human GRIM-19 (16Angell J.E. Lindner D.J. Shapiro P.S. Hofmann E.R. Kalvakolanu D.V. J. Biol. Chem. 2000; 275: 33416-33426Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar) and B16.6 from bovine complex I are 83% identical (Fig. 2B). Data base entries (EMBL and EST) for other vertebrate homologs also show high identities with the bovine protein: 94, 83, 81, 73, 73, and 70% for pig, mouse, rat, zebrafish, oryzias, and chicken, respectively. In all species (see also Fig. 2B), the N-terminal sequences are highly conserved, though deletion of the N-terminal 50 amino acids of GRIM-19 did not inhibit cell death (16Angell J.E. Lindner D.J. Shapiro P.S. Hofmann E.R. Kalvakolanu D.V. J. Biol. Chem. 2000; 275: 33416-33426Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar). The 25 C-terminal amino acids are markedly less conserved. In addition, there are a number of plant homologs, for example from soybean, sorghum, cotton fiber, wheat, barley, and barrel medic, which show high identity with each other but a maximum of 46% identity with bovine B16.6. However, the sequence of residues 97–109 remains highly conserved. Deletion of the C-terminal 43 amino acids of GRIM-19 showed their importance in promoting cell death (16Angell J.E. Lindner D.J. Shapiro P.S. Hofmann E.R. Kalvakolanu D.V. J. Biol. Chem. 2000; 275: 33416-33426Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar), consistent with an important role for residues 97–109. However, this motif does not appear to have the characteristics of an ATP binding domain (26Walker J.E. Saraste M. Runswick M.J. Gay N.J. EMBO J. 1982; 1: 945-951Crossref PubMed Scopus (4269) Google Scholar) as was suggested by Angell et al.(16Angell J.E. Lindner D.J. Shapiro P.S. Hofmann E.R. Kalvakolanu D.V. J. Biol. Chem. 2000; 275: 33416-33426Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar). The acetylation of the alanine N terminus and the presence of a methionine at position −1 indicate that, in common with 18 other subunits of complex I, no cleavable presequence is used to target B16.6 to mitochondria (3Walker J.E. Q. Rev. Biophys. 1992; 25: 253-324Crossref PubMed Scopus (681) Google Scholar, 6Walker J.E. Arizmendi J.M. Dupuis A. Fearnley I.M. Finel M. Medd S.M. Pilkington S.J. Runswick M.J. Skehel J.M. J. Mol. Biol. 1992; 226: 1051-1072Crossref PubMed Scopus (177) Google Scholar). Of these 18 subunits, 12 are modified at the N terminus, 11 by acetylation and 1 by myristylation; for such proteins, the localization signal must lie within the mature protein (27Hartl F.U. Pfanner N. Nicholson D.W. Neupert W. Biochim. Biophys. Acta. 1989; 988: 1-45Crossref PubMed Scopus (547) Google Scholar, 28Neupert W. Annu. Rev. Biochem. 1997; 66: 863-917Crossref PubMed Scopus (981) Google Scholar). The cellular distribution of GRIM-19 (B16.6) is complex. It has been detected, with antibodies, primarily in the nucleus of HeLa cells, though “punctate” staining in the cytoplasm, possibly corresponding to mitochondria, was also observed (16Angell J.E. Lindner D.J. Shapiro P.S. Hofmann E.R. Kalvakolanu D.V. J. Biol. Chem. 2000; 275: 33416-33426Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar). Furthermore, transcripts of GRIM-19 are particularly elevated in human heart and skeletal muscle and to a lesser extent in liver, kidney, and placenta, correlating approximately with the relative abundance of mitochondria in these tissues (16Angell J.E. Lindner D.J. Shapiro P.S. Hofmann E.R. Kalvakolanu D.V. J. Biol. Chem. 2000; 275: 33416-33426Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar). Although only one human gene for GRIM-19 has been detected (29Chidambaram N.V. Angell J.E. Ling W. Hofmann E.R. Kalvakolanu D.V. J. Interferon Cytokine Res. 2000; 20: 661-665Crossref PubMed Scopus (37) Google Scholar), it remains possible that differential splicing provides the means to target the protein to more than one site. A second possibility is that targeting is controlled by a post-translational modification such as acetylation or phosphorylation. Angell et al. (16Angell J.E. Lindner D.J. Shapiro P.S. Hofmann E.R. Kalvakolanu D.V. J. Biol. Chem. 2000; 275: 33416-33426Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar) have suggested that human GRIM-19 is phosphorylated constitutively, but there is no indication from our mass spectrometric analysis for a phosphoryl group in mitochondrial B16.6. Another mitochondrial protein, endonuclease G, has been shown to be released from mitochondria during apoptosis and subsequently translocated to the nucleus (30Li L.Y. Luo X. Wang X. Nature. 2001; 412: 95-99Crossref PubMed Scopus (1404) Google Scholar). Clearly the targeting of GRIM-19 (B16.6) to either nucleus or mitochondria requires further study. B16.6 is the 43rd subunit of bovine mitochondrial complex I to be identified. It is possible that it represents the completion of the primary structure of this complex enzyme, although a protein with a molecular mass of 10566 (±2) Da, observed in some preparations, has not yet been explained (5Skehel J.M. Fearnley I.M. Walker J.E. FEBS Lett. 1998; 438: 301-305Crossref PubMed Scopus (59) Google Scholar). The GRIM-19 protein has now been found to fulfill two roles within the cell. The first is as part of the interferon-β- and retinoic acid-induced pathway of cell death (15Hofman E.R. Boyanapalli M. Lindner D.J. Weihua X. Hassel B.A. Jagus R. Gutierrez P.L. Kalvakolanu D.V. Mol. Cell. Biol. 1998; 18: 6493-6504Crossref PubMed Scopus (77) Google Scholar, 16Angell J.E. Lindner D.J. Shapiro P.S. Hofmann E.R. Kalvakolanu D.V. J. Biol. Chem. 2000; 275: 33416-33426Abstract Full Text Full Text PDF PubMed Scopus (196) Google Scholar). The second is as part of the mitochondrial complex I assembly. These two seemingly disparate functions may be linked by the involvement of mitochondria in apoptotic cell death." @default.
• W2067244501 created "2016-06-24" @default.
• W2067244501 creator A5007387177 @default.
• W2067244501 creator A5027808251 @default.
• W2067244501 creator A5029211607 @default.
• W2067244501 creator A5031090925 @default.
• W2067244501 creator A5056046836 @default.
• W2067244501 creator A5058069625 @default.
• W2067244501 date "2001-10-01" @default.
• W2067244501 modified "2023-10-11" @default.
• W2067244501 title "GRIM-19, a Cell Death Regulatory Gene Product, Is a Subunit of Bovine Mitochondrial NADH:Ubiquinone Oxidoreductase (Complex I)" @default.
• W2067244501 cites W124504601 @default.
• W2067244501 cites W1480948328 @default.
• W2067244501 cites W1500771632 @default.
• W2067244501 cites W1566232888 @default.
• W2067244501 cites W1973753936 @default.
• W2067244501 cites W1975304761 @default.
• W2067244501 cites W1988827270 @default.
• W2067244501 cites W1991280425 @default.
• W2067244501 cites W1991498111 @default.
• W2067244501 cites W1995006257 @default.
• W2067244501 cites W2002367940 @default.
• W2067244501 cites W2012003686 @default.
• W2067244501 cites W2018287750 @default.
• W2067244501 cites W2040636296 @default.
• W2067244501 cites W2058135122 @default.
• W2067244501 cites W2066736258 @default.
• W2067244501 cites W2075704767 @default.
• W2067244501 cites W2076971346 @default.
• W2067244501 cites W2078594804 @default.
• W2067244501 cites W2079167667 @default.
• W2067244501 cites W2100837269 @default.
• W2067244501 cites W2111406382 @default.
• W2067244501 cites W2115323593 @default.
• W2067244501 cites W2126408170 @default.
• W2067244501 cites W2133205270 @default.
• W2067244501 cites W2154660868 @default.
• W2067244501 cites W2462855682 @default.
• W2067244501 cites W2688325281 @default.
• W2067244501 cites W4376848558 @default.
• W2067244501 cites W937204623 @default.
• W2067244501 doi "https://doi.org/10.1074/jbc.c100444200" @default.
• W2067244501 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11522775" @default.
• W2067244501 hasPublicationYear "2001" @default.
• W2067244501 type Work @default.
• W2067244501 sameAs 2067244501 @default.
• W2067244501 citedByCount "238" @default.
• W2067244501 countsByYear W20672445012012 @default.
• W2067244501 countsByYear W20672445012013 @default.
• W2067244501 countsByYear W20672445012014 @default.
• W2067244501 countsByYear W20672445012015 @default.
• W2067244501 countsByYear W20672445012016 @default.
• W2067244501 countsByYear W20672445012017 @default.
• W2067244501 countsByYear W20672445012018 @default.
• W2067244501 countsByYear W20672445012019 @default.
• W2067244501 countsByYear W20672445012020 @default.
• W2067244501 countsByYear W20672445012021 @default.
• W2067244501 countsByYear W20672445012022 @default.
• W2067244501 countsByYear W20672445012023 @default.
• W2067244501 crossrefType "journal-article" @default.
• W2067244501 hasAuthorship W2067244501A5007387177 @default.
• W2067244501 hasAuthorship W2067244501A5027808251 @default.
• W2067244501 hasAuthorship W2067244501A5029211607 @default.
• W2067244501 hasAuthorship W2067244501A5031090925 @default.
• W2067244501 hasAuthorship W2067244501A5056046836 @default.
• W2067244501 hasAuthorship W2067244501A5058069625 @default.
• W2067244501 hasBestOaLocation W20672445011 @default.
• W2067244501 hasConcept C104292427 @default.
• W2067244501 hasConcept C104317684 @default.
• W2067244501 hasConcept C153911025 @default.
• W2067244501 hasConcept C181199279 @default.
• W2067244501 hasConcept C185592680 @default.
• W2067244501 hasConcept C24586158 @default.
• W2067244501 hasConcept C2776319529 @default.
• W2067244501 hasConcept C2779268744 @default.
• W2067244501 hasConcept C28859421 @default.
• W2067244501 hasConcept C55493867 @default.
• W2067244501 hasConcept C86803240 @default.
• W2067244501 hasConceptScore W2067244501C104292427 @default.
• W2067244501 hasConceptScore W2067244501C104317684 @default.
• W2067244501 hasConceptScore W2067244501C153911025 @default.
• W2067244501 hasConceptScore W2067244501C181199279 @default.
• W2067244501 hasConceptScore W2067244501C185592680 @default.
• W2067244501 hasConceptScore W2067244501C24586158 @default.
• W2067244501 hasConceptScore W2067244501C2776319529 @default.
• W2067244501 hasConceptScore W2067244501C2779268744 @default.
• W2067244501 hasConceptScore W2067244501C28859421 @default.
• W2067244501 hasConceptScore W2067244501C55493867 @default.
• W2067244501 hasConceptScore W2067244501C86803240 @default.
• W2067244501 hasIssue "42" @default.
• W2067244501 hasLocation W20672445011 @default.
• W2067244501 hasOpenAccess W2067244501 @default.
• W2067244501 hasPrimaryLocation W20672445011 @default.
• W2067244501 hasRelatedWork W1557704072 @default.
• W2067244501 hasRelatedWork W1650181147 @default.
• W2067244501 hasRelatedWork W1973646521 @default.
• W2067244501 hasRelatedWork W2001254662 @default.
• W2067244501 hasRelatedWork W2065677686 @default.

• next