FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2067762612> ?p ?o ?g. }

• W2067762612 endingPage "22688" @default.
• W2067762612 startingPage "22685" @default.
• W2067762612 abstract "Polysialic acid, or PSA, is a term used to refer to linear homopolymers of α(2,8)-sialic acid residues displayed at the surface of some mammalian cells. PSA is typically linked to the neural cell adhesion molecule N-CAM, where it can modulate the homotypic adhesive properties of this polypeptide. PSA expression is developmentally regulated, presumably through mechanisms involving regulated expression of sialyltransferases involved in PSA biosynthesis. Several different sialyltransferase sequences have been implicated in PSA expression, although the precise roles of these enzymes in this context remain unclear. One such sequence, termed STX, maintains approximately 59% amino acid sequence identity with another sialyltransferase (PST-1, from hamster; PST, human) that is known to participate in PSA expression. While a murine STX fusion protein can catalyze the synthesis of a single α(2,8)-sialic acid linkage in vitro, the ability of STX to participate in PSA expression in vivo has not been demonstrated. We show here that STX transcripts are present in a PSA-positive, N-CAM-positive human small cell carcinoma line (NCI-H69/F3), but are absent in a variant of this line (NCI-H69/E2) selected to be PSA-negative and N-CAM-positive. To functionally confirm this correlation, we have cloned a human cDNA encoding the human STX sequence, and show, by transfection studies, that human STX can restore PSA expression when expressed in the PSA-negative, N-CAM-positive small cell carcinoma variant. We furthermore show that STX can confer PSA expression when expressed in a PSA-negative, N-CAM-positive murine cell line (NIH-3T3 cells), or when expressed in PSA-negative, N-CAM-negative COS-7 cells. These observations imply that STX, like PST-1/PST, can determine PSA expression in vivo. When considered together with the correlation between STX expression and PSA expression in vivo in the brain, these results suggest a regulatory role for STX in PSA expression in the developing central nervous system and small cell lung carcinoma. Polysialic acid, or PSA, is a term used to refer to linear homopolymers of α(2,8)-sialic acid residues displayed at the surface of some mammalian cells. PSA is typically linked to the neural cell adhesion molecule N-CAM, where it can modulate the homotypic adhesive properties of this polypeptide. PSA expression is developmentally regulated, presumably through mechanisms involving regulated expression of sialyltransferases involved in PSA biosynthesis. Several different sialyltransferase sequences have been implicated in PSA expression, although the precise roles of these enzymes in this context remain unclear. One such sequence, termed STX, maintains approximately 59% amino acid sequence identity with another sialyltransferase (PST-1, from hamster; PST, human) that is known to participate in PSA expression. While a murine STX fusion protein can catalyze the synthesis of a single α(2,8)-sialic acid linkage in vitro, the ability of STX to participate in PSA expression in vivo has not been demonstrated. We show here that STX transcripts are present in a PSA-positive, N-CAM-positive human small cell carcinoma line (NCI-H69/F3), but are absent in a variant of this line (NCI-H69/E2) selected to be PSA-negative and N-CAM-positive. To functionally confirm this correlation, we have cloned a human cDNA encoding the human STX sequence, and show, by transfection studies, that human STX can restore PSA expression when expressed in the PSA-negative, N-CAM-positive small cell carcinoma variant. We furthermore show that STX can confer PSA expression when expressed in a PSA-negative, N-CAM-positive murine cell line (NIH-3T3 cells), or when expressed in PSA-negative, N-CAM-negative COS-7 cells. These observations imply that STX, like PST-1/PST, can determine PSA expression in vivo. When considered together with the correlation between STX expression and PSA expression in vivo in the brain, these results suggest a regulatory role for STX in PSA expression in the developing central nervous system and small cell lung carcinoma. INTRODUCTIONSialyltransferases represent a family of terminal glycosyltransferases that catalyze the attachment of sialic acid to carbohydrates of many glycoproteins and glycolipids(1Kitagawa H. Paulson J.C. J. Biol. Chem. 1994; 269: 17872-17878Google Scholar). Sialic acids are key determinants of carbohydrate structures involved in a variety of biological processes and are widely distributed on many cell types (2Paulson J.C. Trends Biochem. Sci. 1989; 14: 272-276Google Scholar, 3Brandley B.K. Swiedler S.J. Robbins P.W. Cell. 1990; 63: 861-863Google Scholar, 4Varki A. Curr. Opin. Cell Biol. 1992; 4: 257-266Google Scholar). Homopolymers of sialic acids in α(2,8) linkage (polysialic acid, PSA, 1The abbreviations used are: PSApolysialic acidbpbase pair(s)SCLCsmall cell lung carcinomaN-CAMneural cell adhesion moleculeRACErapid amplification of cDNA endskbkilobase(s)mAbmonoclonal antibody. also abbreviated as polySia) have a more restricted spatio-temporal tissue distribution pattern than the more commonly found α(2,6)- and α(2,3)-linked sialic acid residues. For example, PSA is expressed by neuronal tissues, in the heart and the developing kidney, and in association with malignant transformation, such as in small cell lung carcinoma (SCLC)(5Vimr E.R. McCoy R.D. Vollger H.F. Wilkison N.C. Troy F.A. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 1971-1975Google Scholar, 6Roth J. Taatjes D.J. Bitter-Suermann D. Finne J. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 1969-1973Google Scholar, 7Lackie P.M. Zuber C. Roth J. Differentiation. 1994; 57: 119-131Google Scholar, 8Scheidegger E.P. Lackie P.M. Papay J. Roth J. Lab. Invest. 1994; 70: 95-106Google Scholar). Furthermore, PSA has been reported to be associated with only two proteins, the neural cell adhesion molecule (N-CAM) and sodium channel α subunits(9Nybroe O. Linnemann D. Bock E. Neurochem. Int. 1988; 12: 251-262Google Scholar, 10Zuber C. Lackie P.M. Caterall W.A. Roth J. J. Biol. Chem. 1992; 267: 9965-9971Google Scholar). Changes in the amount of PSA on N-CAM modulates the adhesive properties of N-CAM, and also affects the cell surface properties of other molecules like some integrins, N-cadherin, and G4/NgCAM(11Acheson A. Rutishauser U. J. Cell Biol. 1988; 106: 479-486Google Scholar, 12Acheson A. Sunshine L.J. Rutishauser U. J. Cell Biol. 1991; 114: 143-153Google Scholar, 13Rutishauser U. Acheson A. Hall A.K. Mann D.M. Sunshine J. Science. 1988; 240: 53-57Google Scholar, 14Yang P.F. Yin X.H. Rutishauser U. J. Cell Biol. 1992; 116: 1487-1496Google Scholar). These effects are presumed to be due to the unusual physicochemical properties of this very large, abundant, negatively charged, and linear cell surface polyglycan(14Yang P.F. Yin X.H. Rutishauser U. J. Cell Biol. 1992; 116: 1487-1496Google Scholar).A requirement for N-CAM as an acceptor molecule in PSA synthesis is implied from several studies(15Breen K.C. Regan C.M. Development. 1985; 104: 147-154Google Scholar, 16McCoy R.D. Vimr E.R. Troy F.A. J. Biol. Chem. 1985; 260: 12695-12699Google Scholar), although this has not been demonstrated directly. Other studies suggest that PSA biosynthesis involves the concerted activity of two or more specific sialyltransferases(16McCoy R.D. Vimr E.R. Troy F.A. J. Biol. Chem. 1985; 260: 12695-12699Google Scholar, 17Kitazume S. Kitajima K. Inoue S. Inoue Y. Troy F.A. J. Biol. Chem. 1994; 269: 10330-10340Google Scholar). This includes a requirement for one or more α(2,3)-sialyltransferases to create α(2,3)-linked sialic acid moieties, that in turn are the presumed acceptor substrate for subsequent addition of α(2,8)-linked sialic acid moieties(18Livingston B.D. De Robertis E.M. Paulson J.C. Glycobiology. 1990; 1: 39-44Google Scholar, 19Finne J. J. Biol. Chem. 1982; 257: 11966-11970Google Scholar). It is possible that PSA synthesis then proceeds through a two-step process involving the addition of a single α(2,8)-linked sialic acid residue to the α(2,3)-linked sialic acid by one distinct α(2,8)-sialyltransferase (an “initiase” reaction), followed by the addition of multiple α(2,8)-linked sialic acid residues that yield PSA by a second distinct α(2,8)-sialyltransferase (a “polymerase” reaction). This possibility is supported by in vitro experiments indicating that at least three different α(2,8)-sialyltransferases (ST8SiaI, GD3 synthase, (20Sasaki K. Kurata K. Kojima N. Kurosawa N. Ohta S. Hanai N. Tsjui S. Nishi T. J. Biol. Chem. 1994; 22: 15950-15956Google Scholar, 21Nara K. Watanabe Y. Maruyama K. Kasahara K. Nagai Y. Sanai Y. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 7952-7956Google Scholar, 22Haraguchi M. Yamashiro S. Yamamoto A. Furukawa K. Takamiya K. Lloyd K. Shiku H. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 10455-10459Google Scholar); ST8SiaII, STX, (23Kojima N. Yoshida Y. Kurosawa N. Lee Y.-C. Tsuji S. FEBS Lett. 1995; 360: 1-4Google Scholar); ST8SiaIII, (24Yoshida Y. Kojima N. Kurosawa N. Hamamoto T. Tsjui S. J. Biol. Chem. 1995; 270: 14628-14633Google Scholar)) can catalyze the attachment of a single α(2,8)-linked sialic acid residue to terminal α(2,3)-sialic acid linkages.Alternatively, a single α(2,8)-sialyltransferase may operate to directly catalyze PSA synthesis on a glycoconjugate template containing a terminal α(2,3)-linked sialic acid. This notion is supported by the recent demonstration that expression of a single α(2,8)-sialyltransferase gene, termed PST-1(25Eckhardt M. Muehlenhoff M. Bethe A. Koopmann J. Frosch M. Gerardy-Schahn R. Nature. 1995; 373: 715-718Google Scholar), or PST(26Nakayama J. Fukuda M.N. Fredette B. Ranscht B. Fukuda M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7031-7035Google Scholar), is sufficient for the expression of PSA in N-CAM-positive, PSA-negative mammalian cell lines (CHO-2A10, NIH-3T3, and COS-hN-6, a COS cell line expressing with human N-CAM-140 cDNA, (25Eckhardt M. Muehlenhoff M. Bethe A. Koopmann J. Frosch M. Gerardy-Schahn R. Nature. 1995; 373: 715-718Google Scholar); COS-1 cells and HeLa cells transfected with an N-CAM expression vector, (26Nakayama J. Fukuda M.N. Fredette B. Ranscht B. Fukuda M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7031-7035Google Scholar)). In principle, both such modes of PSA synthesis may exist, although this remains to be confirmed, since it has not yet been possible to recreate polymerization of α(2,8)-linked sialic acids in vitro.The STX gene represents a member of the sialyltransferase gene family whose developmentally regulated expression patterns correlate well with PSA expression in certain tissues(1Kitagawa H. Paulson J.C. J. Biol. Chem. 1994; 269: 17872-17878Google Scholar, 24Yoshida Y. Kojima N. Kurosawa N. Hamamoto T. Tsjui S. J. Biol. Chem. 1995; 270: 14628-14633Google Scholar, 27Livingston B.D. Paulson J.C. J. Biol. Chem. 1993; 268: 11504-11507Google Scholar). A role for this sequence in PSA expression remained circumstantial, however, since initial efforts failed to demonstrate an enzymatic activity associated with the (rat) STX polypeptide(27Livingston B.D. Paulson J.C. J. Biol. Chem. 1993; 268: 11504-11507Google Scholar). Subsequent efforts have demonstrated that a recombinant (mouse) STX-protein A fusion protein can catalyze the synthesis of a single α(2,8)-sialic acid linkage in vitro(23Kojima N. Yoshida Y. Kurosawa N. Lee Y.-C. Tsuji S. FEBS Lett. 1995; 360: 1-4Google Scholar). Nonetheless, a definitive demonstration that STX participates in PSA expression, in vitro or in vivo, has not been accomplished.We show here that STX expression correlates with PSA expression in a PSA-positive human small cell lung carcinoma (SCLC) cell line (NCI-H69/F3)(8Scheidegger E.P. Lackie P.M. Papay J. Roth J. Lab. Invest. 1994; 70: 95-106Google Scholar), whereas STX transcripts are absent from a variant of this line selected to be PSA-negative (NCI-H69/E2)(8Scheidegger E.P. Lackie P.M. Papay J. Roth J. Lab. Invest. 1994; 70: 95-106Google Scholar). Transfection of the PSA-negative variant SCLC line with an STX expression vector restores PSA expression in that line, and in other PSA-negative cell lines. The observations imply that transcriptional regulation of STX can regulate PSA expression, suggest that STX shares overlapping enzymatic activity with PST-1/PST, and imply that determination of PSA expression by STX can be independent of N-CAM expression.EXPERIMENTAL PROCEDURESCell LinesTwo N-CAM-positive clonal SCLC sublines differing in PSA expression (NCI-H69/F3 and NCI-H69/E2) have been described(8Scheidegger E.P. Lackie P.M. Papay J. Roth J. Lab. Invest. 1994; 70: 95-106Google Scholar). NIH-3T3 and COS-7 cells were obtained from the American Type Culture Collection and were cultured in Dulbecco's modified Eagle's medium containing 10% fetal calf serum with penicillin-streptomycin.Molecular Cloning of a Full-length Human STX cDNAA cDNA library was constructed using the mammalian expression vector pCDM8 (Invitrogen) and poly(A)+ RNA from the PSA-positive cell line (NCI-H69/F3), according to (28Aruffo A. Seed B. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 8573-8577Google Scholar). A 580-bp fragment corresponding to bp 69-649 of a human STX cDNA (1Kitagawa H. Paulson J.C. J. Biol. Chem. 1994; 269: 17872-17878Google Scholar) was generated with the PCR, using PCR primers derived from the partial STX cDNA (1Kitagawa H. Paulson J.C. J. Biol. Chem. 1994; 269: 17872-17878Google Scholar) (5′ primer, GCCCACAGCTTCGTCATCAGGTG; 3′ primer, GGCCGACAGTCAGTTTCAAAGCCC), the NCI-H69/F3 cell cDNA library as a template, and standard PCR conditions (Taq polymerase; 95°C for 30 s, 65°C for 30 s and 72°C for 90 s; 35 cycles). The resulting 580-bp PCR product was subcloned into pCR™ II (Invitrogen) and sequenced. The 580-bp insert was used to screen (29Sambrook J. Fritsch D.D. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) a human fetal heart λgt11 cDNA library (Clontech). The inserts from two positive clones (3.5 and 2.5 kb) were subcloned into pCDNAI (Invitrogen), and sequenced. Both clones were deficient in the 5′ end of the coding region. The 5′ RACE procedure (30Frohman M.A. Dush M.K. Martin G.R. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 8998-9002Google Scholar) was used to obtain the 5′ end of the open reading frame, using conditions suggested by the RACE reagent manufacturer (Life Technologies, Inc.), except that the reverse transcriptase reaction was carried out at 50°C. RACE reactions used poly(A)+ RNA from NCI-H69/F3 cells, two gene-specific primers (5′-TGGTGATGAGGAGCCGTTTATTACAACTTC; 5′-CACAGCTGATCTGATTGTACCTCTGCCTCC), and the PCR (two sequential rounds of 35 cycles each, involving incubations at 95°C for 30 s, 70°C for 30 s, and 72°C for 60 s). A 150-bp 5′ RACE product was subcloned; its sequence was consistent with that predicted for the 5′ end of the human STX cDNA. This fragment was appended to the 5′ end of the 2.5-kb cDNA described above at a shared EcoRI site, to form a cDNA encompassing a single long open reading frame predicted to encode the entire STX polypeptide. The resulting fragment was subcloned in the “sense” orientation between the HindIII and EcoRI sites of the mammalian expression vector pCDNAI, to create the vector pSTXFL.Northern Blot AnalysisNorthern blots were prepared as described(29Sambrook J. Fritsch D.D. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar), using poly(A)+ mRNA isolated from SCLC lines, or from a 17-day mouse embryo. Blots containing mRNA from multiple human tissues were obtained from Clontech. Blots were probed in 50% formamide, 5 × SSC, 1 × PE, at 42°C, using 32P-labeled (29Sambrook J. Fritsch D.D. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) DNA fragments. Probes included bp 69-649 of the human STX cDNA(1Kitagawa H. Paulson J.C. J. Biol. Chem. 1994; 269: 17872-17878Google Scholar), bp 404-875 of the human GD3 synthase cDNA(20Sasaki K. Kurata K. Kojima N. Kurosawa N. Ohta S. Hanai N. Tsjui S. Nishi T. J. Biol. Chem. 1994; 22: 15950-15956Google Scholar), or a 780-bp segment of the human glyceraldehyde-3-phosphate dehydrogenase cDNA(31Tso J.Y. Sun X.H. Kao T.H. Reece K.S. Wu R. Nucleic Acids Res. 1985; 13: 2485-2502Google Scholar). A PST-1 probe (25Eckhardt M. Muehlenhoff M. Bethe A. Koopmann J. Frosch M. Gerardy-Schahn R. Nature. 1995; 373: 715-718Google Scholar) was prepared using the PCR, cDNA prepared (29Sambrook J. Fritsch D.D. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) from Chinese hamster ovary cell RNA, and PCR primers corresponding to bp 79-108 (5′ primer) and to bp 358-331 (3′ primer) of the hamster PST-1 cDNA (25Eckhardt M. Muehlenhoff M. Bethe A. Koopmann J. Frosch M. Gerardy-Schahn R. Nature. 1995; 373: 715-718Google Scholar). A mST8Sia III probe was prepared using the PCR, a mouse brain cDNA library (Clontech), and PCR primers corresponding to bp 106-133 (5′ primer) and to bp 351-378 (3′ primer)(24Yoshida Y. Kojima N. Kurosawa N. Hamamoto T. Tsjui S. J. Biol. Chem. 1995; 270: 14628-14633Google Scholar). Blots were washed at 50°C in 2 × SSC, 0.1% SDS for 30 min and were subjected to autoradiography.Transfection Procedures- All transient transfections were completed using a commercially available liposome-based transfection reagent (DOTAP, Boehringer Mannheim), according to the manufacturer's instructions. The SCLC cell line NCI-H69/E2 was co-transfected with pRSVlarge T(32de Chasseval R. de Villartay J.-P. Nucleic Acids Res. 1991; 20: 245-250Google Scholar), a pBR322-based vector that encodes the SV40 large T antigen, to facilitate episomal replication of the co-transfected expression plasmids carrying the SV40 origin of replication. Transfection efficiencies were controlled for by co-transfecting with the vector pCDNAI-CAT (Invitrogen), and subsequently assaying extracts prepared form the transfected cells for chloramphenicol acetyltransferase activity(29Sambrook J. Fritsch D.D. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar).Immunohistochemical AnalysisTransfected cells were analyzed by fluorescence-activated flow cytometry(33Weston B.W. Smith P.L. Kelly R.J. Lowe J.B. J. Biol. Chem. 1992; 267: 24575-24584Google Scholar). Cells were stained and washed at 4°C in staining medium (RPMI 1640 medium, 2% fetal calf serum, 0.1 M HEPES, pH = 7.4). PSA expression was assessed with the mouse monoclonal anti-PSA antibody mAb 735 (used at 5 μg/ml)(34Frosch M. Goergen J. Bulnois G.J. Timmis K.M. Bitter-Suermann D. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 1194-1198Google Scholar), from Dr. D. Bitter-Suermann (Institute of Medical Microbiology, Mainz, Germany). Rabbit anti-human N-CAM antiserum was used at a saturating concentration (Dako). Cell-bound antibodies were detected with fluorescein-conjugated goat anti-mouse or anti-rabbit antibodies (Sigma).RESULTS AND DISCUSSIONRecent molecular cloning work demonstrates that a sialyltransferase sequence termed PST-1, or PST, (for polysialyltransferase) can yield cell surface PSA expression when expressed in PSA-negative cell lines(25Eckhardt M. Muehlenhoff M. Bethe A. Koopmann J. Frosch M. Gerardy-Schahn R. Nature. 1995; 373: 715-718Google Scholar, 26Nakayama J. Fukuda M.N. Fredette B. Ranscht B. Fukuda M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7031-7035Google Scholar). Although these data implicate PST-1/PST in PSA expression, an in vitro enzymatic correlate for these observations is not yet available. Among all known sialyltransferases, PST-1/PST is most similar to one termed STX (59% overall amino acid sequence identity; hamster PST-1 or human PST versus rat STX). STX is expressed primarily in the fetal and newborn brain, but not in the adult brain, and thus correlates with the temporal sequence of PSA expression in that tissue. These considerations suggest a role for STX in the developmental regulation of PSA expression in the central nervous system. However, efforts to assign an enzymatic activity to the rat STX sequence have not met with success(27Livingston B.D. Paulson J.C. J. Biol. Chem. 1993; 268: 11504-11507Google Scholar). More recent work indicates that, in vitro, mouse STX can utilize radiolabeled CMP-sialic acid to incorporate radiolabeled sialic acid into sialylated, N-linked glycoproteins(23Kojima N. Yoshida Y. Kurosawa N. Lee Y.-C. Tsuji S. FEBS Lett. 1995; 360: 1-4Google Scholar). Indirect evidence suggests that α(2,8)-sialic acid linkages were formed by STX in these experiments, although there is currently no direct evidence that STX participates in PSA biosynthesis or expression.Differential Expression of Human STX in SCLC Cell LinesWe have described an N-CAM-positive, PSA-positive small cell lung cancer cell line (NCI-H69/F3), and the isolation and characterization of clonal variants of this line that remain N-CAM-positive, but that are deficient in PSA expression(8Scheidegger E.P. Lackie P.M. Papay J. Roth J. Lab. Invest. 1994; 70: 95-106Google Scholar). One such PSA-negative line (NCI-H69/E2) and the PSA-positive control line NCI-H69/F3 were used to explore the role of PST-1 and STX in PSA expression(8Scheidegger E.P. Lackie P.M. Papay J. Roth J. Lab. Invest. 1994; 70: 95-106Google Scholar). Flow cytometry analyses confirm that the NCI-H69/F3 line expresses N-CAM and PSA, whereas the variant line NCI-H69/E2 is deficient in cell surface PSA expression, yet remains positive for N-CAM expression (Fig. 1A). The major carrier of PSA in the NCI-H69/F3 line is N-CAM, as reported previously(8Scheidegger E.P. Lackie P.M. Papay J. Roth J. Lab. Invest. 1994; 70: 95-106Google Scholar).Northern blot analyses indicate that the PSA-positive line NCI-H69/F3 is deficient in transcripts corresponding to PST-1/PST (although PST-1 transcripts are observed in human heart; Fig. 2B), indicating that this gene does not participate in PSA expression in these cells. Likewise, this cell line is deficient in GD3 synthase and mST8Sia III transcripts (data not shown). However, these analyses demonstrate that the STX transcript is easily detectable in the PSA-positive line (Fig. 2A). The STX transcript in the PSA-positive SCLC line (Fig. 2A) is similar in size (~6.0 kb) to the human (5.7 kb, human heart; data not shown and (1Kitagawa H. Paulson J.C. J. Biol. Chem. 1994; 269: 17872-17878Google Scholar)) and rat (5.5 kb, (27Livingston B.D. Paulson J.C. J. Biol. Chem. 1993; 268: 11504-11507Google Scholar)) STX transcripts, and corresponds roughly to broad range (1.7-6.7 kb) of STX transcripts observed in the embryonic mouse(24Yoshida Y. Kojima N. Kurosawa N. Hamamoto T. Tsjui S. J. Biol. Chem. 1995; 270: 14628-14633Google Scholar). By contrast, STX transcripts are absent from the PSA-negative variant SCLC line (Fig. 2A). These observations suggest that PSA expression in this pair of cell lines is controlled by transcriptional regulation of the STX gene.Figure 2:Northern blot analysis of the PSA-positive and PSA-negative SCLC cell lines. A, Northern blot hybridized with a human STX probe. The Northern blot was prepared using poly(A)+ mRNA (2 μg/lane) isolated from the PSA-positive SCLC cell line (PSA+, NCI-H69/F3), from the PSA negative SCLC cell line (PSA-, NCI-H69/E2), and from a mouse embryo at embryonic day 17 (E17). The blot was probed with a segment of the human STX cDNA (“STX”), as described under “Experimental Procedures.” B, Northern blot hybridized with a hamster PST-1 probe. The blot shown in panel A was stripped of the STX probe (29Sambrook J. Fritsch D.D. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) and hybridized with a segment of the hamster PST-1 gene (PST −1), as described under “Experimental Procedures.” Human heart (Heart) poly(A)+ RNA served as a positive control(26Nakayama J. Fukuda M.N. Fredette B. Ranscht B. Fukuda M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7031-7035Google Scholar). C, Northern blot hybridized with a human glyceraldehyde-3-phosphate dehydrogenase probe (GAPDH). The blot shown in panels A and B was stripped of the STX probe (29Sambrook J. Fritsch D.D. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) and was hybridized with a segment of the human glyceraldehyde-3-phosphate dehydrogenase gene, as described under “Experimental Procedures.” RNA molecular size standards are indicated on the left (in kilobases).View Large Image Figure ViewerDownload (PPT)Primary Structure of a Human STX cDNAWe sought to confirm an essential role for STX in PSA expression in these cell lines by expressing the STX polypeptide in the PSA-negative line, and asking if this would convert the variant to a PSA-positive state. A human cDNA encompassing the entire coding region of the human STX polypeptide was therefore isolated and characterized (see “Experimental Procedures”). The pSTXFL clone maintains a continuous 375-amino acid open reading frame (Fig. 3) encompassing segments termed sialylmotifs, which are highly conserved among members of the mammalian sialyltransferase superfamily(27Livingston B.D. Paulson J.C. J. Biol. Chem. 1993; 268: 11504-11507Google Scholar). The human STX protein maintains a 17-amino acid hydrophobic sequence near its NH2 terminus. This segment is flanked by charged residues, and thus corresponds to a “signal anchor” sequence predicting a type II transmembrane orientation characteristic of glycosyltransferases(35Paulson J.C. Colley K. J. Biol. Chem. 1989; 264: 17615-17618Google Scholar). Human STX differs from the rat enzyme at 8 positions (rat residues Ala-68, Leu-75, Ser-78, Gln-155, Thr-188, Gly-232, Ala-257, and Asn-308), for an overall 98% amino acid sequence identity between the rat and human enzymes(1Kitagawa H. Paulson J.C. J. Biol. Chem. 1994; 269: 17872-17878Google Scholar). Similarity to the mouse STX sequence cannot be determined since its DNA and derived protein sequence are not available(23Kojima N. Yoshida Y. Kurosawa N. Lee Y.-C. Tsuji S. FEBS Lett. 1995; 360: 1-4Google Scholar). Human STX shares an overall amino acid sequence identity of 59% with hamster PST-1/human PST(25Eckhardt M. Muehlenhoff M. Bethe A. Koopmann J. Frosch M. Gerardy-Schahn R. Nature. 1995; 373: 715-718Google Scholar, 26Nakayama J. Fukuda M.N. Fredette B. Ranscht B. Fukuda M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7031-7035Google Scholar), 31% with human GD3 synthase(20Sasaki K. Kurata K. Kojima N. Kurosawa N. Ohta S. Hanai N. Tsjui S. Nishi T. J. Biol. Chem. 1994; 22: 15950-15956Google Scholar), and 36% with mouse ST8Sia III(24Yoshida Y. Kojima N. Kurosawa N. Hamamoto T. Tsjui S. J. Biol. Chem. 1995; 270: 14628-14633Google Scholar), three other mammalian sialyltransferases implicated in the synthesis of α(2,8)-linked sialic acid linkages. There are local regions of sequence identity among these enzymes that are substantially higher than these values, including the region encompassing the L and S sialylmotifs (Fig. 3) (data not shown).Figure 3:Human STX cDNA and predicted amino acid sequences. The DNA sequence of the coding region of the human STX is shown above the predicted amino acid sequence. The predicted signal anchor sequence is doubly underlined and italicized. Potential asparagine-linked oligosaccharide attachment sites are underlined. Amino acids underlined with a dotted line correspond to consensus sequences identified previously for mammalian sialyltransferases (the “L” and “S” sialylmotifs; Refs. 1 and 20).View Large Image Figure ViewerDownload (PPT)Expression of PSA in Cell Lines Transiently Transfected with the Human STX cDNATo determine if human STX can restore PSA expression to the PSA-negative, STX-negative SCLC variant, the human STX cDNA was installed in a mammalian expression vector and was introduced into these cells by transfection (see “Experimental Procedures”). A substantial fraction (~30%) of the STX-transfected variant cells stain brightly (Fig. 1B) with the monoclonal antibody (mAb 735) specific for PSA(34Frosch M. Goergen J. Bulnois G.J. Timmis K.M. Bitter-Suermann D. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 1194-1198Google Scholar). The fraction of positive cells observed in this experiment is similar to the fraction of antigen (sialyl Lewis x)-positive cells seen when (sialyl Lewis x-negative) NCI-H69/E2 cells are transiently transfected with a control fucosyltransferase expression vector (pCDNAI-Fuc-TIII; (33Weston B.W. Smith P.L. Kelly R.J. Lowe J.B. J. Biol. Chem. 1992; 267: 24575-24584Google Scholar)) (data not shown). By contrast, the PSA-negative line remains PSA-negative following transfection with the control vector pCDNAI (Fig. 1B), as do cells transfected with the STX expression vector and stained with a negative control antibody (Fig. 1B). These results indicate that the human STX sequence can confer PSA expression in this N-CAM-positive cell line and are consistent with the conclusion that loss of PSA expression in this variant is a consequence of virtually complete loss of STX transcripts by these cells. It remains to be determined if this event occurs at the transcriptional or at the post-transcriptional level. The STX expression vector is also capable of generating cell surface PSA expression when introduced into the PSA-negative, N-CAM-positive murine cell line NIH-3T3 (Fig. 1B). This result demonstrates that the ability of STX to direct PSA expression is not idiosyncratic to the SCLC variant line and suggests that the catalytic specificity of human STX overlaps with that of hamster PST-1, which is also able to direct PSA expression in these cells(25Eckhardt M. Muehlenhoff M. Bethe A. Koopmann J. Frosch M. Gerardy-Schahn R. Nature. 1995; 373: 715-718Google Scholar).The bulk of PSA expression in mammalian tissues and cell lines is thought to be associated with N-CAM (9Nybroe O. Linnemann D. Bock E. Neurochem. Int. 1988; 12: 251-262Google Scholar, 10Zuber C. Lackie P.M. Caterall W.A. Roth J. J. Biol. Chem. 1992; 267: 9965-9971Google Scholar, 36Cremer H. Lange R. Christoph A. Plomann M. Vopper G. Roes J. Brown R. Baldwin S. Kraemer P. Scheff S. Barthels D. Rajewsky K. Wille W. Nature. 1994; 367: 455-459Google Scholar) and has been directly demonstrated on the SCLC cell line NCI-H69/F3(8Scheidegger E.P. Lackie P.M. Papay J. Roth J. Lab. Invest. 1994; 70: 95-106Google Scholar). These observations have been taken to mean that effective PSA synthesis and expression requires N-CAM, although PSA has also been detected in association with sodium channel α subunits(10Zuber C. Lackie P.M. Caterall W.A. Roth J. J. Biol. Chem. 1992; 267: 9965-9971Google Scholar). To directly determine if STX-directed PSA expression involves a requirement for N-CAM, STX was expressed in N-CAM-negative (data not shown) COS-7 cells, and the transfectants were assayed for PSA expression. More than 25% of the STX-transfected COS-7 cells stained with the anti-PSA monoclonal antibody mAb 735, and at levels roughly comparable to the N-CAM-positive STX transfectants. Control COS-7 transfectants remained PSA-negative. Considered together, these results indicate that STX can also determined PSA expression in the absence of N-CAM expression.The nature of the glycoconjugates that display STX-determined PSA on the cell lines we have used will require detailed structural analysis. Our experiments also do not allow us to know if STX participates in PSA expression as an “initiase” only (adds sialic acid in α(2,8) linkage to an α(2,3)-linked sialic acid precursor), or as a “polymerase” only (adds sialic acid in α(2,8) linkage to an α(2,8)-linked sialic acid precursor), or if both of these reactions are catalyzed by STX. A full biochemical resolution of this question, as it relates to STX, and to the other α(2,8)-sialyltransferases implicated in PSA expression, will require the development of an in vitro assay for PSA synthesis. INTRODUCTIONSialyltransferases represent a family of terminal glycosyltransferases that catalyze the attachment of sialic acid to carbohydrates of many glycoproteins and glycolipids(1Kitagawa H. Paulson J.C. J. Biol. Chem. 1994; 269: 17872-17878Google Scholar). Sialic acids are key determinants of carbohydrate structures involved in a variety of biological processes and are widely distributed on many cell types (2Paulson J.C. Trends Biochem. Sci. 1989; 14: 272-276Google Scholar, 3Brandley B.K. Swiedler S.J. Robbins P.W. Cell. 1990; 63: 861-863Google Scholar, 4Varki A. Curr. Opin. Cell Biol. 1992; 4: 257-266Google Scholar). Homopolymers of sialic acids in α(2,8) linkage (polysialic acid, PSA, 1The abbreviations used are: PSApolysialic acidbpbase pair(s)SCLCsmall cell lung carcinomaN-CAMneural cell adhesion moleculeRACErapid amplification of cDNA endskbkilobase(s)mAbmonoclonal antibody. also abbreviated as polySia) have a more restricted spatio-temporal tissue distribution pattern than the more commonly found α(2,6)- and α(2,3)-linked sialic acid residues. For example, PSA is expressed by neuronal tissues, in the heart and the developing kidney, and in association with malignant transformation, such as in small cell lung carcinoma (SCLC)(5Vimr E.R. McCoy R.D. Vollger H.F. Wilkison N.C. Troy F.A. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 1971-1975Google Scholar, 6Roth J. Taatjes D.J. Bitter-Suermann D. Finne J. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 1969-1973Google Scholar, 7Lackie P.M. Zuber C. Roth J. Differentiation. 1994; 57: 119-131Google Scholar, 8Scheidegger E.P. Lackie P.M. Papay J. Roth J. Lab. Invest. 1994; 70: 95-106Google Scholar). Furthermore, PSA has been reported to be associated with only two proteins, the neural cell adhesion molecule (N-CAM) and sodium channel α subunits(9Nybroe O. Linnemann D. Bock E. Neurochem. Int. 1988; 12: 251-262Google Scholar, 10Zuber C. Lackie P.M. Caterall W.A. Roth J. J. Biol. Chem. 1992; 267: 9965-9971Google Scholar). Changes in the amount of PSA on N-CAM modulates the adhesive properties of N-CAM, and also affects the cell surface properties of other molecules like some integrins, N-cadherin, and G4/NgCAM(11Acheson A. Rutishauser U. J. Cell Biol. 1988; 106: 479-486Google Scholar, 12Acheson A. Sunshine L.J. Rutishauser U. J. Cell Biol. 1991; 114: 143-153Google Scholar, 13Rutishauser U. Acheson A. Hall A.K. Mann D.M. Sunshine J. Science. 1988; 240: 53-57Google Scholar, 14Yang P.F. Yin X.H. Rutishauser U. J. Cell Biol. 1992; 116: 1487-1496Google Scholar). These effects are presumed to be due to the unusual physicochemical properties of this very large, abundant, negatively charged, and linear cell surface polyglycan(14Yang P.F. Yin X.H. Rutishauser U. J. Cell Biol. 1992; 116: 1487-1496Google Scholar).A requirement for N-CAM as an acceptor molecule in PSA synthesis is implied from several studies(15Breen K.C. Regan C.M. Development. 1985; 104: 147-154Google Scholar, 16McCoy R.D. Vimr E.R. Troy F.A. J. Biol. Chem. 1985; 260: 12695-12699Google Scholar), although this has not been demonstrated directly. Other studies suggest that PSA biosynthesis involves the concerted activity of two or more specific sialyltransferases(16McCoy R.D. Vimr E.R. Troy F.A. J. Biol. Chem. 1985; 260: 12695-12699Google Scholar, 17Kitazume S. Kitajima K. Inoue S. Inoue Y. Troy F.A. J. Biol. Chem. 1994; 269: 10330-10340Google Scholar). This includes a requirement for one or more α(2,3)-sialyltransferases to create α(2,3)-linked sialic acid moieties, that in turn are the presumed acceptor substrate for subsequent addition of α(2,8)-linked sialic acid moieties(18Livingston B.D. De Robertis E.M. Paulson J.C. Glycobiology. 1990; 1: 39-44Google Scholar, 19Finne J. J. Biol. Chem. 1982; 257: 11966-11970Google Scholar). It is possible that PSA synthesis then proceeds through a two-step process involving the addition of a single α(2,8)-linked sialic acid residue to the α(2,3)-linked sialic acid by one distinct α(2,8)-sialyltransferase (an “initiase” reaction), followed by the addition of multiple α(2,8)-linked sialic acid residues that yield PSA by a second distinct α(2,8)-sialyltransferase (a “polymerase” reaction). This possibility is supported by in vitro experiments indicating that at least three different α(2,8)-sialyltransferases (ST8SiaI, GD3 synthase, (20Sasaki K. Kurata K. Kojima N. Kurosawa N. Ohta S. Hanai N. Tsjui S. Nishi T. J. Biol. Chem. 1994; 22: 15950-15956Google Scholar, 21Nara K. Watanabe Y. Maruyama K. Kasahara K. Nagai Y. Sanai Y. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 7952-7956Google Scholar, 22Haraguchi M. Yamashiro S. Yamamoto A. Furukawa K. Takamiya K. Lloyd K. Shiku H. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 10455-10459Google Scholar); ST8SiaII, STX, (23Kojima N. Yoshida Y. Kurosawa N. Lee Y.-C. Tsuji S. FEBS Lett. 1995; 360: 1-4Google Scholar); ST8SiaIII, (24Yoshida Y. Kojima N. Kurosawa N. Hamamoto T. Tsjui S. J. Biol. Chem. 1995; 270: 14628-14633Google Scholar)) can catalyze the attachment of a single α(2,8)-linked sialic acid residue to terminal α(2,3)-sialic acid linkages.Alternatively, a single α(2,8)-sialyltransferase may operate to directly catalyze PSA synthesis on a glycoconjugate template containing a terminal α(2,3)-linked sialic acid. This notion is supported by the recent demonstration that expression of a single α(2,8)-sialyltransferase gene, termed PST-1(25Eckhardt M. Muehlenhoff M. Bethe A. Koopmann J. Frosch M. Gerardy-Schahn R. Nature. 1995; 373: 715-718Google Scholar), or PST(26Nakayama J. Fukuda M.N. Fredette B. Ranscht B. Fukuda M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7031-7035Google Scholar), is sufficient for the expression of PSA in N-CAM-positive, PSA-negative mammalian cell lines (CHO-2A10, NIH-3T3, and COS-hN-6, a COS cell line expressing with human N-CAM-140 cDNA, (25Eckhardt M. Muehlenhoff M. Bethe A. Koopmann J. Frosch M. Gerardy-Schahn R. Nature. 1995; 373: 715-718Google Scholar); COS-1 cells and HeLa cells transfected with an N-CAM expression vector, (26Nakayama J. Fukuda M.N. Fredette B. Ranscht B. Fukuda M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7031-7035Google Scholar)). In principle, both such modes of PSA synthesis may exist, although this remains to be confirmed, since it has not yet been possible to recreate polymerization of α(2,8)-linked sialic acids in vitro.The STX gene represents a member of the sialyltransferase gene family whose developmentally regulated expression patterns correlate well with PSA expression in certain tissues(1Kitagawa H. Paulson J.C. J. Biol. Chem. 1994; 269: 17872-17878Google Scholar, 24Yoshida Y. Kojima N. Kurosawa N. Hamamoto T. Tsjui S. J. Biol. Chem. 1995; 270: 14628-14633Google Scholar, 27Livingston B.D. Paulson J.C. J. Biol. Chem. 1993; 268: 11504-11507Google Scholar). A role for this sequence in PSA expression remained circumstantial, however, since initial efforts failed to demonstrate an enzymatic activity associated with the (rat) STX polypeptide(27Livingston B.D. Paulson J.C. J. Biol. Chem. 1993; 268: 11504-11507Google Scholar). Subsequent efforts have demonstrated that a recombinant (mouse) STX-protein A fusion protein can catalyze the synthesis of a single α(2,8)-sialic acid linkage in vitro(23Kojima N. Yoshida Y. Kurosawa N. Lee Y.-C. Tsuji S. FEBS Lett. 1995; 360: 1-4Google Scholar). Nonetheless, a definitive demonstration that STX participates in PSA expression, in vitro or in vivo, has not been accomplished.We show here that STX expression correlates with PSA expression in a PSA-positive human small cell lung carcinoma (SCLC) cell line (NCI-H69/F3)(8Scheidegger E.P. Lackie P.M. Papay J. Roth J. Lab. Invest. 1994; 70: 95-106Google Scholar), whereas STX transcripts are absent from a variant of this line selected to be PSA-negative (NCI-H69/E2)(8Scheidegger E.P. Lackie P.M. Papay J. Roth J. Lab. Invest. 1994; 70: 95-106Google Scholar). Transfection of the PSA-negative variant SCLC line with an STX expression vector restores PSA expression in that line, and in other PSA-negative cell lines. The observations imply that transcriptional regulation of STX can regulate PSA expression, suggest that STX shares overlapping enzymatic activity with PST-1/PST, and imply that determination of PSA expression by STX can be independent of N-CAM expression." @default.
• W2067762612 created "2016-06-24" @default.
• W2067762612 creator A5043800730 @default.
• W2067762612 creator A5059962014 @default.
• W2067762612 creator A5068119079 @default.
• W2067762612 creator A5069767368 @default.
• W2067762612 date "1995-09-01" @default.
• W2067762612 modified "2023-10-17" @default.
• W2067762612 title "A Human STX cDNA Confers Polysialic Acid Expression in Mammalian Cells" @default.
• W2067762612 cites W1487427036 @default.
• W2067762612 cites W1500163587 @default.
• W2067762612 cites W1507147440 @default.
• W2067762612 cites W1536901694 @default.
• W2067762612 cites W1550866124 @default.
• W2067762612 cites W1565007202 @default.
• W2067762612 cites W1655461206 @default.
• W2067762612 cites W1964709514 @default.
• W2067762612 cites W1985572665 @default.
• W2067762612 cites W1986611378 @default.
• W2067762612 cites W1990026725 @default.
• W2067762612 cites W1990311250 @default.
• W2067762612 cites W1997261857 @default.
• W2067762612 cites W1998489650 @default.
• W2067762612 cites W2018524046 @default.
• W2067762612 cites W2021811965 @default.
• W2067762612 cites W2024451651 @default.
• W2067762612 cites W2037230002 @default.
• W2067762612 cites W2040796340 @default.
• W2067762612 cites W2049741418 @default.
• W2067762612 cites W2052316366 @default.
• W2067762612 cites W2052382514 @default.
• W2067762612 cites W2057472483 @default.
• W2067762612 cites W2068378160 @default.
• W2067762612 cites W2078032475 @default.
• W2067762612 cites W2082289133 @default.
• W2067762612 cites W2085402247 @default.
• W2067762612 cites W2098342567 @default.
• W2067762612 cites W2108388593 @default.
• W2067762612 cites W2128778791 @default.
• W2067762612 cites W2151678160 @default.
• W2067762612 cites W2153144663 @default.
• W2067762612 cites W2164831513 @default.
• W2067762612 cites W25676136 @default.
• W2067762612 doi "https://doi.org/10.1074/jbc.270.39.22685" @default.
• W2067762612 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/7559389" @default.
• W2067762612 hasPublicationYear "1995" @default.
• W2067762612 type Work @default.
• W2067762612 sameAs 2067762612 @default.
• W2067762612 citedByCount "145" @default.
• W2067762612 countsByYear W20677626122012 @default.
• W2067762612 countsByYear W20677626122013 @default.
• W2067762612 countsByYear W20677626122014 @default.
• W2067762612 countsByYear W20677626122015 @default.
• W2067762612 countsByYear W20677626122016 @default.
• W2067762612 countsByYear W20677626122017 @default.
• W2067762612 countsByYear W20677626122019 @default.
• W2067762612 countsByYear W20677626122020 @default.
• W2067762612 countsByYear W20677626122021 @default.
• W2067762612 countsByYear W20677626122022 @default.
• W2067762612 crossrefType "journal-article" @default.
• W2067762612 hasAuthorship W2067762612A5043800730 @default.
• W2067762612 hasAuthorship W2067762612A5059962014 @default.
• W2067762612 hasAuthorship W2067762612A5068119079 @default.
• W2067762612 hasAuthorship W2067762612A5069767368 @default.
• W2067762612 hasBestOaLocation W20677626121 @default.
• W2067762612 hasConcept C104317684 @default.
• W2067762612 hasConcept C122871604 @default.
• W2067762612 hasConcept C1491633281 @default.
• W2067762612 hasConcept C153911025 @default.
• W2067762612 hasConcept C185592680 @default.
• W2067762612 hasConcept C187882448 @default.
• W2067762612 hasConcept C2778993516 @default.
• W2067762612 hasConcept C2780115458 @default.
• W2067762612 hasConcept C55493867 @default.
• W2067762612 hasConcept C85789140 @default.
• W2067762612 hasConcept C86803240 @default.
• W2067762612 hasConceptScore W2067762612C104317684 @default.
• W2067762612 hasConceptScore W2067762612C122871604 @default.
• W2067762612 hasConceptScore W2067762612C1491633281 @default.
• W2067762612 hasConceptScore W2067762612C153911025 @default.
• W2067762612 hasConceptScore W2067762612C185592680 @default.
• W2067762612 hasConceptScore W2067762612C187882448 @default.
• W2067762612 hasConceptScore W2067762612C2778993516 @default.
• W2067762612 hasConceptScore W2067762612C2780115458 @default.
• W2067762612 hasConceptScore W2067762612C55493867 @default.
• W2067762612 hasConceptScore W2067762612C85789140 @default.
• W2067762612 hasConceptScore W2067762612C86803240 @default.
• W2067762612 hasIssue "39" @default.
• W2067762612 hasLocation W20677626121 @default.
• W2067762612 hasOpenAccess W2067762612 @default.
• W2067762612 hasPrimaryLocation W20677626121 @default.
• W2067762612 hasRelatedWork W2019589814 @default.
• W2067762612 hasRelatedWork W2042688936 @default.
• W2067762612 hasRelatedWork W2083453595 @default.
• W2067762612 hasRelatedWork W2095722775 @default.
• W2067762612 hasRelatedWork W2163536019 @default.
• W2067762612 hasRelatedWork W2358267043 @default.
• W2067762612 hasRelatedWork W2379536288 @default.

• next